Starting /dee2/code/volunteer_pipeline.sh SRR7172150 current disk space = 3117571903488 free memory = 1484901912 SRR7172150 SRAfilesize 829e5a7f60d9eaa940b6d808ef87d965 SRR7172150.sra SRR7172150.sra file validated SRR7172150 is paired end SRR7172150 is conventional basespace SRR7172150 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172150_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73775 33.0 33.0 34.0 32.0 34.0 2 33.1175 34.0 33.0 34.0 32.0 34.0 3 32.7545 33.0 33.0 34.0 32.0 34.0 4 33.142 34.0 33.0 34.0 33.0 34.0 5 33.167 34.0 33.0 34.0 32.0 34.0 6 37.0845 38.0 37.0 38.0 36.0 38.0 7 37.35925 38.0 38.0 38.0 36.0 38.0 8 37.5255 38.0 38.0 38.0 37.0 38.0 9 37.57025 38.0 38.0 38.0 38.0 38.0 10-14 37.32065 38.0 38.0 38.0 37.2 38.0 15-19 37.49745 38.0 38.0 38.0 38.0 38.0 20-24 37.47475000000001 38.0 38.0 38.0 37.6 38.0 25-29 37.3993 38.0 38.0 38.0 37.2 38.0 30-34 37.4222 38.0 38.0 38.0 37.2 38.0 35-39 37.29775 38.0 38.0 38.0 37.0 38.0 40-44 37.2358 38.0 38.0 38.0 36.8 38.0 45-49 36.932050000000004 38.0 38.0 38.0 35.8 38.0 50-54 37.2592 38.0 38.0 38.0 36.6 38.0 55-59 37.367149999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.293499999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.2502 38.0 38.0 38.0 37.0 38.0 70-74 37.141949999999994 38.0 38.0 38.0 36.2 38.0 75-79 37.0159 38.0 38.0 38.0 35.8 38.0 80-84 37.099199999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.93025 38.0 38.0 38.0 36.0 38.0 90-94 36.855000000000004 38.0 38.0 38.0 35.2 38.0 95-99 36.7777 38.0 38.0 38.0 35.0 38.0 100-104 36.7949 38.0 38.0 38.0 35.0 38.0 105-109 36.63075 38.0 38.0 38.0 34.6 38.0 110-114 36.4365 38.0 38.0 38.0 34.0 38.0 115-119 36.24495 38.0 37.6 38.0 34.0 38.0 120-124 36.1356 38.0 37.2 38.0 33.8 38.0 125-129 35.8468 38.0 37.0 38.0 32.6 38.0 130-134 35.56295 38.0 36.4 38.0 31.4 38.0 135-139 35.22535 38.0 36.0 38.0 31.0 38.0 140-144 34.69285000000001 38.0 35.6 38.0 28.6 38.0 145-149 33.822950000000006 38.0 35.0 38.0 23.2 38.0 150-151 28.6875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 2.0 21 2.0 22 7.0 23 6.0 24 8.0 25 15.0 26 14.0 27 12.0 28 24.0 29 27.0 30 43.0 31 55.0 32 92.0 33 102.0 34 136.0 35 236.0 36 612.0 37 2604.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.675 16.25 15.2 39.875 2 18.8 25.05 38.975 17.175 3 18.099999999999998 30.25 27.3 24.349999999999998 4 20.674999999999997 37.075 22.15 20.1 5 19.925 37.3 23.7 19.075 6 16.475 36.575 25.900000000000002 21.05 7 12.6 20.625 45.300000000000004 21.475 8 17.625 21.55 28.95 31.874999999999996 9 18.35 22.0 31.075000000000003 28.575 10-14 19.35208437970869 30.070316423907585 26.68006027122049 23.897538925163232 15-19 19.744999999999997 29.160000000000004 27.92 23.175 20-24 19.41 29.049999999999997 28.15 23.39 25-29 19.195 29.970000000000002 27.455000000000002 23.380000000000003 30-34 19.384999999999998 29.110000000000003 27.939999999999998 23.565 35-39 19.265 28.95 28.315 23.47 40-44 19.685 29.24 27.534999999999997 23.54 45-49 19.064999999999998 28.720000000000002 28.01 24.205 50-54 19.875 28.955 28.095 23.075000000000003 55-59 20.03 29.299999999999997 27.375 23.294999999999998 60-64 19.685 28.63 28.13 23.555 65-69 19.985 28.9 27.405 23.71 70-74 19.52 29.025000000000002 27.68 23.775 75-79 19.695 28.59 28.625 23.09 80-84 19.505 28.355000000000004 28.18 23.96 85-89 19.825 29.03 27.810000000000002 23.335 90-94 20.025000000000002 28.185 28.310000000000002 23.48 95-99 19.515 28.77 27.595 24.12 100-104 20.035 29.349999999999998 27.845 22.770000000000003 105-109 20.006003301816 28.640752413827602 27.37005352944119 23.983190754915203 110-114 19.738947789557912 28.390678135627123 28.240648129625924 23.629725945189037 115-119 20.751037551877594 28.71643582179109 27.636381819090953 22.89614480724036 120-124 20.203081232493 28.94157663065226 27.546018407362943 23.309323729491798 125-129 19.954954954954953 28.73873873873874 28.008008008008005 23.2982982982983 130-134 20.73 28.565 27.279999999999998 23.425 135-139 20.805 28.675 26.665 23.855 140-144 20.695 28.63 26.955000000000002 23.72 145-149 20.825 27.93 27.700000000000003 23.544999999999998 150-151 21.087500000000002 29.1625 25.9625 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 1.0 21 2.0 22 2.0 23 1.5 24 1.5 25 4.5 26 5.0 27 8.5 28 13.5 29 15.5 30 23.5 31 34.5 32 42.0 33 53.0 34 66.5 35 77.0 36 104.0 37 133.5 38 146.5 39 180.0 40 221.0 41 248.0 42 271.5 43 285.0 44 285.5 45 254.5 46 238.5 47 234.5 48 206.5 49 170.0 50 140.5 51 123.0 52 98.0 53 70.5 54 57.5 55 46.0 56 30.5 57 25.0 58 23.0 59 17.5 60 9.5 61 7.5 62 5.0 63 3.0 64 3.5 65 1.5 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.44999999999999996 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.055 110-114 0.02 115-119 0.005 120-124 0.04 125-129 0.1 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.425000000000001 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.4375 0.0 0.0 0.0 0.0 138-139 7.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAAC 10 0.0065993075 146.65823 9 TCAAAAG 10 0.0065993075 146.65823 6 AAAGCAG 10 0.0065993075 146.65823 9 ACTCCGT 10 0.0068555363 144.825 4 TATTTTC 10 0.0068555363 144.825 2 CAAAAGC 25 8.320307E-4 87.99494 7 AAAAGCA 35 0.0031634236 62.853523 8 ATCGGAA 45 0.009000138 48.275 145 >>END_MODULE SRR7172150 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172150_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95375 33.0 33.0 34.0 32.0 34.0 2 32.98925 34.0 33.0 34.0 32.0 34.0 3 33.07525 34.0 33.0 34.0 32.0 34.0 4 33.05875 34.0 33.0 34.0 33.0 34.0 5 33.08725 34.0 33.0 34.0 33.0 34.0 6 37.25975 38.0 38.0 38.0 37.0 38.0 7 37.338 38.0 38.0 38.0 37.0 38.0 8 37.352 38.0 38.0 38.0 37.0 38.0 9 37.2965 38.0 38.0 38.0 37.0 38.0 10-14 37.3055 38.0 38.0 38.0 37.0 38.0 15-19 37.29045000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.179449999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.091950000000004 38.0 38.0 38.0 36.6 38.0 30-34 37.14275 38.0 38.0 38.0 37.0 38.0 35-39 37.1105 38.0 38.0 38.0 36.8 38.0 40-44 37.024950000000004 38.0 38.0 38.0 36.6 38.0 45-49 37.07165 38.0 38.0 38.0 36.6 38.0 50-54 37.11685 38.0 38.0 38.0 36.8 38.0 55-59 37.04415 38.0 38.0 38.0 36.4 38.0 60-64 37.045100000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.93535 38.0 38.0 38.0 36.0 38.0 70-74 36.8677 38.0 38.0 38.0 36.0 38.0 75-79 36.8566 38.0 38.0 38.0 36.0 38.0 80-84 36.785900000000005 38.0 38.0 38.0 35.4 38.0 85-89 36.682 38.0 38.0 38.0 35.0 38.0 90-94 36.55055 38.0 38.0 38.0 34.4 38.0 95-99 36.34889999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.31085 38.0 38.0 38.0 34.0 38.0 105-109 36.32809999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.122150000000005 38.0 37.8 38.0 33.4 38.0 115-119 35.9531 38.0 37.4 38.0 32.8 38.0 120-124 35.845 38.0 37.0 38.0 32.4 38.0 125-129 35.6869 38.0 37.0 38.0 31.8 38.0 130-134 35.3501 38.0 36.2 38.0 30.6 38.0 135-139 34.91205 38.0 36.0 38.0 28.8 38.0 140-144 34.34045 38.0 34.8 38.0 26.2 38.0 145-149 33.6671 38.0 34.4 38.0 21.2 38.0 150-151 28.958875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 0.0 6 2.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 2.0 14 1.0 15 2.0 16 4.0 17 2.0 18 3.0 19 3.0 20 5.0 21 6.0 22 8.0 23 16.0 24 7.0 25 19.0 26 13.0 27 23.0 28 26.0 29 38.0 30 47.0 31 64.0 32 64.0 33 114.0 34 136.0 35 242.0 36 516.0 37 2629.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.06633291614518 13.516896120150188 17.822277847309138 35.59449311639549 2 21.68795391935888 22.21387427998998 39.24367643375908 16.85449536689206 3 20.410718757826196 25.694966190833963 32.456799398948164 21.437515652391685 4 24.993739043325817 34.63561232156274 20.98672677185074 19.383921863260706 5 22.784176264396592 38.057085628442664 21.88282423635453 17.27591387080621 6 16.854213553388348 39.45986496624156 24.031007751937985 19.654913728432106 7 16.225 15.5 46.5 21.775 8 21.9 20.349999999999998 28.375 29.375 9 23.05 23.65 28.875 24.425 10-14 22.72113605680284 28.32141607080354 26.94634731736587 22.011100555027753 15-19 22.955000000000002 27.965 28.435 20.645 20-24 22.85 27.834999999999997 28.225 21.09 25-29 23.335 27.845 28.360000000000003 20.46 30-34 22.89 28.07 28.48 20.560000000000002 35-39 22.73 28.26 27.665 21.345 40-44 23.43 28.09 27.96 20.52 45-49 23.294999999999998 27.474999999999998 28.560000000000002 20.669999999999998 50-54 22.695 27.61 28.904999999999998 20.79 55-59 23.53 28.175 28.28 20.015 60-64 22.814999999999998 28.815 27.900000000000002 20.47 65-69 22.99 28.560000000000002 28.439999999999998 20.01 70-74 23.494999999999997 28.265 27.529999999999998 20.71 75-79 23.294999999999998 27.334999999999997 29.185 20.185 80-84 23.14 28.365000000000002 28.675 19.82 85-89 22.745 28.24 28.27 20.745 90-94 22.965 28.060000000000002 28.689999999999998 20.285 95-99 23.395 28.325 28.565 19.715 100-104 23.799999999999997 28.494999999999997 28.015 19.689999999999998 105-109 23.48 28.155 28.1 20.265 110-114 23.985 28.7 27.500000000000004 19.814999999999998 115-119 23.799999999999997 28.189999999999998 28.044999999999998 19.965 120-124 23.845 27.98 28.46 19.715 125-129 24.23 28.42 28.03 19.32 130-134 24.16 27.43 28.565 19.845 135-139 24.57 28.22 27.925 19.285 140-144 24.48 28.084999999999997 27.665 19.77 145-149 24.895 28.444999999999997 27.224999999999998 19.435 150-151 25.5125 27.900000000000002 26.974999999999998 19.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.0 24 1.0 25 2.5 26 4.0 27 5.0 28 8.0 29 11.0 30 15.5 31 22.5 32 30.5 33 43.5 34 52.5 35 71.0 36 96.5 37 119.0 38 141.5 39 184.0 40 222.0 41 241.5 42 261.0 43 263.5 44 285.0 45 285.5 46 258.5 47 238.5 48 220.0 49 193.0 50 164.5 51 134.0 52 95.0 53 75.5 54 63.5 55 43.0 56 25.5 57 28.5 58 26.0 59 12.5 60 10.0 61 8.5 62 8.5 63 7.5 64 2.5 65 1.0 66 1.0 67 2.5 68 3.5 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.15 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.3624999999999998 0.0 0.0 0.0 0.0 112-113 1.5499999999999998 0.0 0.0 0.0 0.0 114-115 1.8875000000000002 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.2125 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 3.8625 0.0 0.0 0.0 0.0 128-129 4.3875 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.3875 0.0 0.0 0.0 0.0 134-135 5.85 0.0 0.0 0.0 0.0 136-137 6.4 0.0 0.0 0.0 0.0 138-139 6.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAAC 10 0.006830828 145.0 1 TTCAAGC 10 0.006830828 145.0 2 GTTTCAT 10 0.006830828 145.0 1 ATCGGAA 40 0.005621335 54.375 145 >>END_MODULE Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882704 spots for SRR7172150.sra Written 882704 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra Read 882702 spots for SRR7172150.sra Written 882702 spots for SRR7172150.sra SRR ids: ['SRR7172150.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i1p6p75h SRR7172150.sra spots: 17654042 blocks: [[1, 882702], [882703, 1765404], [1765405, 2648106], [2648107, 3530808], [3530809, 4413510], [4413511, 5296212], [5296213, 6178914], [6178915, 7061616], [7061617, 7944318], [7944319, 8827020], [8827021, 9709722], [9709723, 10592424], [10592425, 11475126], [11475127, 12357828], [12357829, 13240530], [13240531, 14123232], [14123233, 15005934], [15005935, 15888636], [15888637, 16771338], [16771339, 17654042]] SRR7172150 file size 5960675 SRR7172150 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172150 SRR7172150_1.fastq SRR7172150_2.fastq Input file: SRR7172150_1.fastq Paired file: SRR7172150_2.fastq trimmed: SRR7172150-trimmed-pair1.fastq, SRR7172150-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:45:21 2025 >> started Fri Feb 14 08:45:42 2025 >> done (21.145s) 17654042 read pairs processed; of these: 8822 ( 0.05%) short read pairs filtered out after trimming by size control 7412 ( 0.04%) empty read pairs filtered out after trimming by size control 17637808 (99.91%) read pairs available; of these: 8881821 (50.36%) trimmed read pairs available after processing 8755987 (49.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 2 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 2 0.00% 25 5 0.00% 26 2 0.00% 27 3 0.00% 28 3 0.00% 29 7 0.00% 30 3 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 9 0.00% 35 6 0.00% 36 9 0.00% 37 3 0.00% 38 6 0.00% 39 4 0.00% 40 6 0.00% 41 6 0.00% 42 7 0.00% 43 6 0.00% 44 7 0.00% 45 6 0.00% 46 13 0.00% 47 18 0.00% 48 17 0.00% 49 26 0.00% 50 17 0.00% 51 30 0.00% 52 24 0.00% 53 33 0.00% 54 40 0.00% 55 47 0.00% 56 40 0.00% 57 61 0.00% 58 70 0.00% 59 95 0.00% 60 105 0.00% 61 98 0.00% 62 113 0.00% 63 140 0.00% 64 155 0.00% 65 184 0.00% 66 195 0.00% 67 215 0.00% 68 244 0.00% 69 247 0.00% 70 331 0.00% 71 374 0.00% 72 434 0.00% 73 457 0.00% 74 581 0.00% 75 637 0.00% 76 668 0.00% 77 898 0.01% 78 975 0.01% 79 1106 0.01% 80 1317 0.01% 81 1380 0.01% 82 1669 0.01% 83 2017 0.01% 84 3036 0.02% 85 3650 0.02% 86 3628 0.02% 87 4259 0.02% 88 4450 0.03% 89 4608 0.03% 90 4893 0.03% 91 5345 0.03% 92 5862 0.03% 93 6538 0.04% 94 6848 0.04% 95 7602 0.04% 96 8399 0.05% 97 8980 0.05% 98 9831 0.06% 99 10949 0.06% 100 12545 0.07% 101 12490 0.07% 102 13203 0.07% 103 14534 0.08% 104 15155 0.09% 105 16333 0.09% 106 17534 0.10% 107 18086 0.10% 108 19764 0.11% 109 20900 0.12% 110 22036 0.12% 111 23188 0.13% 112 24550 0.14% 113 25425 0.14% 114 27075 0.15% 115 28809 0.16% 116 30123 0.17% 117 31560 0.18% 118 32754 0.19% 119 34682 0.20% 120 36095 0.20% 121 37894 0.21% 122 39335 0.22% 123 41056 0.23% 124 43295 0.25% 125 44464 0.25% 126 46966 0.27% 127 48592 0.28% 128 51361 0.29% 129 53558 0.30% 130 55613 0.32% 131 57894 0.33% 132 61246 0.35% 133 63803 0.36% 134 67536 0.38% 135 71348 0.40% 136 75860 0.43% 137 79734 0.45% 138 85825 0.49% 139 94041 0.53% 140 104366 0.59% 141 109872 0.62% 142 120722 0.68% 143 134042 0.76% 144 153813 0.87% 145 181472 1.03% 146 224153 1.27% 147 298480 1.69% 148 447122 2.54% 149 877073 4.97% 150 4520379 25.63% 151 8755987 49.64% 17637808 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=7.25 fanout-score-rank=11 prefix-density=0.52 prefix-fanout=2.5 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=315.05 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=21.4 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=34 prefix-density=0.32 prefix-fanout=2.0 sequence=TTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=263.01 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=12.9 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAAC SRR7172150 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:46:26 Started mapping on | Feb 14 08:46:26 Finished on | Feb 14 08:49:03 Mapping speed, Million of reads per hour | 404.43 Number of input reads | 17637808 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16359258 Uniquely mapped reads % | 92.75% Average mapped length | 294.25 Number of splices: Total | 15194733 Number of splices: Annotated (sjdb) | 14849846 Number of splices: GT/AG | 14918435 Number of splices: GC/AG | 214002 Number of splices: AT/AC | 13808 Number of splices: Non-canonical | 48488 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.26 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 446465 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 59183 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.28% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 842265 842265 842265 N_multimapping 446465 446465 446465 N_noFeature 702083 16210836 777558 N_ambiguous 162215 794 88993 UnstrandedReadsAssigned:15494960 PositiveStrandReadsAssigned:147628 NegativeStrandReadsAssigned:15492707 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172150 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172150-trimmed-pair1.fastq SRR7172150-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,637,808 reads, 15,355,009 reads pseudoaligned [quant] estimated average fragment length: 234.739 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR7172150.ke.tsv 34699 SRR7172150.se.tsv 87100 total ==> SRR7172150.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.26 1625 62.2998 Potri.005G024800.1.v4.1 1035 801.261 548 46.7841 Potri.004G059700.1.v4.1 961 727.282 10 0.940565 Potri.007G009000.2.v4.1 1416 1182.26 0 0 Potri.003G141000.2.v4.1 2943 2709.26 640.48 16.1714 Potri.016G087400.1.v4.1 270 82.1752 771.034 641.836 Potri.015G069301.1.v4.1 564 333.722 0 0 Potri.010G195200.1.v4.1 1773 1539.26 776.92 34.5268 Potri.012G127500.1.v4.1 977 743.271 17719 1630.74 ==> SRR7172150.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 295 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 568 SRR7172150 completed mapping pipeline successfully