Starting /dee2/code/volunteer_pipeline.sh SRR7172151 current disk space = 3117572395008 free memory = 1480531936 SRR7172151 SRAfilesize b86d2635607d509095956bdbd4d6ace0 SRR7172151.sra SRR7172151.sra file validated SRR7172151 is paired end SRR7172151 is conventional basespace SRR7172151 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172151_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6845 33.0 33.0 34.0 32.0 34.0 2 33.04125 34.0 33.0 34.0 32.0 34.0 3 32.4425 33.0 33.0 34.0 31.0 34.0 4 33.0675 33.0 33.0 34.0 32.0 34.0 5 32.89625 33.0 33.0 34.0 32.0 34.0 6 36.806 38.0 37.0 38.0 35.0 38.0 7 37.34675 38.0 38.0 38.0 37.0 38.0 8 37.507 38.0 38.0 38.0 37.0 38.0 9 37.52425 38.0 38.0 38.0 38.0 38.0 10-14 37.3114 38.0 38.0 38.0 37.2 38.0 15-19 37.5109 38.0 38.0 38.0 37.8 38.0 20-24 37.47065 38.0 38.0 38.0 37.6 38.0 25-29 37.3977 38.0 38.0 38.0 37.0 38.0 30-34 37.401349999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.232499999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.221399999999996 38.0 38.0 38.0 36.8 38.0 45-49 36.93605 38.0 38.0 38.0 36.0 38.0 50-54 37.23255 38.0 38.0 38.0 36.6 38.0 55-59 37.361200000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.323249999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.28175 38.0 38.0 38.0 37.0 38.0 70-74 37.182399999999994 38.0 38.0 38.0 36.6 38.0 75-79 37.0561 38.0 38.0 38.0 36.0 38.0 80-84 37.0295 38.0 38.0 38.0 36.0 38.0 85-89 36.876050000000006 38.0 38.0 38.0 35.2 38.0 90-94 36.82620000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.78215 38.0 38.0 38.0 35.0 38.0 100-104 36.769600000000004 38.0 38.0 38.0 34.8 38.0 105-109 36.5821 38.0 38.0 38.0 34.2 38.0 110-114 36.443149999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.296850000000006 38.0 37.4 38.0 33.8 38.0 120-124 36.25005 38.0 37.4 38.0 33.8 38.0 125-129 35.93605 38.0 36.8 38.0 32.6 38.0 130-134 35.639300000000006 38.0 36.4 38.0 31.2 38.0 135-139 35.3339 38.0 36.0 38.0 31.0 38.0 140-144 34.7627 38.0 35.2 38.0 28.2 38.0 145-149 34.10095 38.0 34.0 38.0 26.2 38.0 150-151 28.877375 34.5 17.5 38.0 6.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 1.0 19 3.0 20 2.0 21 2.0 22 3.0 23 2.0 24 6.0 25 8.0 26 6.0 27 13.0 28 29.0 29 31.0 30 30.0 31 59.0 32 83.0 33 108.0 34 146.0 35 246.0 36 682.0 37 2534.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.75 17.025000000000002 13.475000000000001 39.75 2 18.55 25.624999999999996 39.475 16.35 3 17.7 30.475 26.950000000000003 24.875 4 21.025 37.85 21.125 20.0 5 20.825 37.15 23.549999999999997 18.475 6 16.025 36.85 25.7 21.425 7 12.4 18.95 46.475 22.175 8 17.45 21.125 29.5 31.924999999999997 9 18.325 21.875 30.5 29.299999999999997 10-14 19.491865836513355 30.53323960634666 26.049407511548505 23.925487045591485 15-19 19.96 29.075 27.779999999999998 23.185 20-24 19.285 29.459999999999997 27.589999999999996 23.665 25-29 19.650000000000002 29.82 27.310000000000002 23.22 30-34 19.81 28.860000000000003 27.865000000000002 23.465 35-39 20.169999999999998 28.96 26.99 23.880000000000003 40-44 20.155 29.205 27.295 23.345 45-49 19.345000000000002 28.225 28.110000000000003 24.32 50-54 20.474999999999998 28.79 27.915 22.82 55-59 20.29 28.505000000000003 27.67 23.535 60-64 19.7 28.799999999999997 27.54 23.96 65-69 19.384999999999998 28.689999999999998 28.27 23.655 70-74 20.21 28.725 27.455000000000002 23.61 75-79 20.474999999999998 28.475 27.825 23.225 80-84 20.405 28.21 27.685 23.7 85-89 20.205000000000002 28.355000000000004 27.755000000000003 23.685000000000002 90-94 21.01 28.555000000000003 26.974999999999998 23.46 95-99 20.505000000000003 28.475 27.315 23.705000000000002 100-104 20.775 28.76 27.3 23.165 105-109 20.05300795119268 28.50927639145872 27.139070860629094 24.298644796719508 110-114 20.553082962444368 28.594289143371505 27.559133870080508 23.293494024103616 115-119 21.36 28.1 27.584999999999997 22.955000000000002 120-124 20.489097819563913 28.42068413682737 27.550510102020404 23.53970794158832 125-129 20.754528169718803 28.294806364455116 27.704393075152606 23.24627239067347 130-134 20.695 28.139999999999997 27.655 23.51 135-139 20.94 28.265 27.215 23.580000000000002 140-144 20.765 28.015 27.525 23.695 145-149 21.154999999999998 28.525 26.75 23.57 150-151 20.7 28.775000000000002 27.0125 23.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 0.5 24 2.5 25 3.5 26 4.5 27 7.0 28 9.5 29 14.0 30 22.5 31 29.0 32 39.0 33 52.5 34 67.5 35 82.5 36 105.0 37 133.5 38 143.5 39 157.0 40 185.0 41 225.5 42 262.0 43 279.0 44 287.0 45 265.5 46 245.0 47 232.0 48 211.0 49 185.0 50 158.0 51 125.5 52 103.0 53 89.5 54 66.5 55 54.5 56 38.5 57 29.5 58 29.5 59 18.5 60 8.0 61 6.5 62 6.0 63 4.5 64 3.5 65 2.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.42 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.015 115-119 0.0 120-124 0.02 125-129 0.06999999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 4.125 0.0 0.0 0.0 0.0 134-135 4.4625 0.0 0.0 0.0 0.0 136-137 4.9875 0.0 0.0 0.0 0.0 138-139 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172151 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172151_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04375 33.0 33.0 34.0 32.0 34.0 2 33.05225 34.0 33.0 34.0 32.0 34.0 3 33.1225 34.0 33.0 34.0 33.0 34.0 4 33.10575 34.0 33.0 34.0 33.0 34.0 5 33.12325 34.0 33.0 34.0 33.0 34.0 6 37.28925 38.0 38.0 38.0 37.0 38.0 7 37.366 38.0 38.0 38.0 37.0 38.0 8 37.425 38.0 38.0 38.0 37.0 38.0 9 37.29925 38.0 38.0 38.0 37.0 38.0 10-14 37.31905 38.0 38.0 38.0 37.0 38.0 15-19 37.273849999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.24065 38.0 38.0 38.0 37.0 38.0 25-29 37.1897 38.0 38.0 38.0 37.0 38.0 30-34 37.23645 38.0 38.0 38.0 37.0 38.0 35-39 37.10565 38.0 38.0 38.0 36.6 38.0 40-44 37.022000000000006 38.0 38.0 38.0 36.6 38.0 45-49 37.10785 38.0 38.0 38.0 36.6 38.0 50-54 37.18035 38.0 38.0 38.0 37.0 38.0 55-59 37.14405 38.0 38.0 38.0 36.8 38.0 60-64 37.0619 38.0 38.0 38.0 36.4 38.0 65-69 37.02545 38.0 38.0 38.0 36.0 38.0 70-74 36.9713 38.0 38.0 38.0 36.0 38.0 75-79 36.9393 38.0 38.0 38.0 36.0 38.0 80-84 36.78295 38.0 38.0 38.0 35.8 38.0 85-89 36.692049999999995 38.0 38.0 38.0 35.2 38.0 90-94 36.57015 38.0 38.0 38.0 34.6 38.0 95-99 36.42125 38.0 38.0 38.0 34.0 38.0 100-104 36.3542 38.0 38.0 38.0 34.0 38.0 105-109 36.250150000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.21714999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.10525 38.0 37.8 38.0 33.4 38.0 120-124 35.89815 38.0 37.4 38.0 32.6 38.0 125-129 35.77380000000001 38.0 37.0 38.0 32.2 38.0 130-134 35.376650000000005 38.0 36.4 38.0 31.0 38.0 135-139 35.0736 38.0 36.0 38.0 30.6 38.0 140-144 34.4556 38.0 35.2 38.0 26.8 38.0 145-149 33.7345 38.0 34.6 38.0 22.4 38.0 150-151 29.09 35.5 25.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 5.0 16 2.0 17 1.0 18 3.0 19 0.0 20 6.0 21 2.0 22 9.0 23 4.0 24 10.0 25 13.0 26 16.0 27 19.0 28 27.0 29 34.0 30 53.0 31 57.0 32 83.0 33 98.0 34 149.0 35 233.0 36 498.0 37 2663.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.94971228421316 14.185639229422067 16.937703277458095 35.92694520890668 2 22.984476715072606 22.909364046069104 37.25588382573861 16.850275413119682 3 20.450563204005007 25.65707133917397 30.76345431789737 23.128911138923655 4 23.823823823823822 34.85985985985986 20.77077077077077 20.545545545545547 5 23.473473473473476 37.23723723723724 22.047047047047048 17.24224224224224 6 17.67941985496374 38.03450862715679 23.905976494123532 20.38009502375594 7 17.724999999999998 14.424999999999999 45.65 22.2 8 20.275000000000002 22.45 26.8 30.475 9 22.575 22.225 29.725 25.474999999999998 10-14 22.706135306765336 28.016400820041003 26.74633731686584 22.531126556327816 15-19 23.03 28.555000000000003 27.85 20.565 20-24 22.255 28.095 28.575 21.075 25-29 22.509999999999998 28.110000000000003 27.575 21.805 30-34 22.98 28.205000000000002 27.735 21.08 35-39 23.150000000000002 28.389999999999997 27.560000000000002 20.9 40-44 22.795 28.52 27.655 21.029999999999998 45-49 23.575 28.515 27.315 20.595 50-54 22.905 28.084999999999997 27.994999999999997 21.015 55-59 23.28 27.82 28.015 20.885 60-64 23.13 27.68 28.71 20.48 65-69 23.62 28.244999999999997 27.865000000000002 20.27 70-74 23.57 28.449999999999996 27.79 20.19 75-79 23.265 27.794999999999998 28.08 20.86 80-84 23.47 28.050000000000004 28.02 20.46 85-89 23.25 28.544999999999998 27.845 20.36 90-94 23.54 27.625 28.395 20.44 95-99 24.285 27.37 27.900000000000002 20.445 100-104 23.330000000000002 27.93 28.075 20.665 105-109 23.665 28.389999999999997 28.005000000000003 19.939999999999998 110-114 23.724999999999998 28.000000000000004 27.51 20.765 115-119 24.015 27.55 27.894999999999996 20.54 120-124 23.54 28.425 28.1 19.935 125-129 24.34 27.665 28.03 19.965 130-134 24.060000000000002 27.435 28.335 20.169999999999998 135-139 23.875 27.83 27.91 20.385 140-144 25.224999999999998 28.060000000000002 27.325 19.39 145-149 24.65 27.529999999999998 27.325 20.495 150-151 24.224999999999998 27.250000000000004 28.199999999999996 20.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 2.0 26 3.5 27 2.0 28 3.0 29 8.5 30 15.5 31 18.5 32 19.0 33 28.5 34 46.5 35 64.0 36 83.5 37 108.0 38 140.5 39 174.5 40 213.5 41 248.0 42 262.0 43 276.0 44 272.5 45 268.5 46 270.5 47 245.0 48 215.0 49 206.0 50 186.5 51 150.0 52 115.5 53 87.0 54 70.0 55 48.0 56 32.5 57 28.0 58 20.5 59 15.5 60 14.0 61 11.0 62 9.0 63 7.5 64 4.5 65 2.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.15 3 0.125 4 0.1 5 0.1 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4275653923541248 0.8500000000000001 3 0.05030181086519115 0.15 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.7750000000000004 0.0 0.0 0.0 0.0 128-129 3.0999999999999996 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 4.1 0.0 0.0 0.0 0.0 134-135 4.45 0.0 0.0 0.0 0.0 136-137 4.9875 0.0 0.0 0.0 0.0 138-139 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812976 spots for SRR7172151.sra Written 812976 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra Read 812963 spots for SRR7172151.sra Written 812963 spots for SRR7172151.sra SRR ids: ['SRR7172151.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__l5h31vy SRR7172151.sra spots: 16259273 blocks: [[1, 812963], [812964, 1625926], [1625927, 2438889], [2438890, 3251852], [3251853, 4064815], [4064816, 4877778], [4877779, 5690741], [5690742, 6503704], [6503705, 7316667], [7316668, 8129630], [8129631, 8942593], [8942594, 9755556], [9755557, 10568519], [10568520, 11381482], [11381483, 12194445], [12194446, 13007408], [13007409, 13820371], [13820372, 14633334], [14633335, 15446297], [15446298, 16259273]] SRR7172151 file size 5488033 SRR7172151 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172151 SRR7172151_1.fastq SRR7172151_2.fastq Input file: SRR7172151_1.fastq Paired file: SRR7172151_2.fastq trimmed: SRR7172151-trimmed-pair1.fastq, SRR7172151-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:39:50 2025 >> started Fri Feb 14 08:40:09 2025 >> done (18.684s) 16259273 read pairs processed; of these: 7311 ( 0.04%) short read pairs filtered out after trimming by size control 6938 ( 0.04%) empty read pairs filtered out after trimming by size control 16245024 (99.91%) read pairs available; of these: 7939923 (48.88%) trimmed read pairs available after processing 8305101 (51.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 2 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 4 0.00% 29 5 0.00% 30 1 0.00% 31 1 0.00% 32 5 0.00% 33 5 0.00% 34 3 0.00% 35 4 0.00% 36 6 0.00% 37 4 0.00% 38 9 0.00% 39 6 0.00% 40 8 0.00% 41 7 0.00% 42 11 0.00% 43 12 0.00% 44 15 0.00% 45 24 0.00% 46 8 0.00% 47 15 0.00% 48 18 0.00% 49 17 0.00% 50 19 0.00% 51 26 0.00% 52 32 0.00% 53 35 0.00% 54 47 0.00% 55 49 0.00% 56 55 0.00% 57 65 0.00% 58 98 0.00% 59 100 0.00% 60 106 0.00% 61 105 0.00% 62 114 0.00% 63 156 0.00% 64 164 0.00% 65 155 0.00% 66 239 0.00% 67 206 0.00% 68 307 0.00% 69 270 0.00% 70 320 0.00% 71 394 0.00% 72 463 0.00% 73 502 0.00% 74 588 0.00% 75 697 0.00% 76 724 0.00% 77 934 0.01% 78 949 0.01% 79 1119 0.01% 80 1249 0.01% 81 1407 0.01% 82 1625 0.01% 83 1896 0.01% 84 2825 0.02% 85 3288 0.02% 86 3420 0.02% 87 3900 0.02% 88 4238 0.03% 89 4208 0.03% 90 4429 0.03% 91 4679 0.03% 92 5239 0.03% 93 5602 0.03% 94 6084 0.04% 95 6679 0.04% 96 7084 0.04% 97 7600 0.05% 98 8265 0.05% 99 9153 0.06% 100 10188 0.06% 101 10272 0.06% 102 10800 0.07% 103 11514 0.07% 104 11776 0.07% 105 12734 0.08% 106 13515 0.08% 107 14083 0.09% 108 14860 0.09% 109 15488 0.10% 110 16480 0.10% 111 17290 0.11% 112 18111 0.11% 113 18731 0.12% 114 19870 0.12% 115 21111 0.13% 116 22028 0.14% 117 22924 0.14% 118 24407 0.15% 119 25287 0.16% 120 26051 0.16% 121 27253 0.17% 122 28417 0.17% 123 29717 0.18% 124 31330 0.19% 125 32415 0.20% 126 34229 0.21% 127 35737 0.22% 128 37571 0.23% 129 39435 0.24% 130 41169 0.25% 131 42934 0.26% 132 45824 0.28% 133 48160 0.30% 134 51574 0.32% 135 55132 0.34% 136 59084 0.36% 137 62560 0.39% 138 68146 0.42% 139 75187 0.46% 140 85747 0.53% 141 90144 0.55% 142 100739 0.62% 143 113003 0.70% 144 132344 0.81% 145 158584 0.98% 146 198950 1.22% 147 271105 1.67% 148 412695 2.54% 149 822926 5.07% 150 4248173 26.15% 151 8305101 51.12% 16245024 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=20 prefix-density=0.31 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=378.82 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=36.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=27 prefix-density=0.30 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=297.83 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=30.1 sequence=GAAGAAGAAGAAA SRR7172151 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:40:53 Started mapping on | Feb 14 08:40:53 Finished on | Feb 14 08:42:40 Mapping speed, Million of reads per hour | 546.56 Number of input reads | 16245024 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15324884 Uniquely mapped reads % | 94.34% Average mapped length | 295.15 Number of splices: Total | 15635587 Number of splices: Annotated (sjdb) | 15380942 Number of splices: GT/AG | 15387281 Number of splices: GC/AG | 198358 Number of splices: AT/AC | 11113 Number of splices: Non-canonical | 38835 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.35 Insertion rate per base | 0.03% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455826 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 71214 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 473122 473122 473122 N_multimapping 455826 455826 455826 N_noFeature 399801 15191978 459338 N_ambiguous 153272 629 79543 UnstrandedReadsAssigned:14771811 PositiveStrandReadsAssigned:132277 NegativeStrandReadsAssigned:14786003 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172151 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172151-trimmed-pair1.fastq SRR7172151-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,245,024 reads, 14,635,399 reads pseudoaligned [quant] estimated average fragment length: 248.227 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR7172151.ke.tsv 34699 SRR7172151.se.tsv 87100 total ==> SRR7172151.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.77 809 29.2988 Potri.005G024800.1.v4.1 1035 787.773 229 18.6423 Potri.004G059700.1.v4.1 961 713.793 32 2.87503 Potri.007G009000.2.v4.1 1416 1168.77 0 0 Potri.003G141000.2.v4.1 2943 2695.77 469.255 11.1632 Potri.016G087400.1.v4.1 270 77.639 1318.53 1089.12 Potri.015G069301.1.v4.1 564 321.369 0 0 Potri.010G195200.1.v4.1 1773 1525.77 239.36 10.0607 Potri.012G127500.1.v4.1 977 729.783 5039 442.808 ==> SRR7172151.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 309 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 254 SRR7172151 completed mapping pipeline successfully