Starting /dee2/code/volunteer_pipeline.sh SRR7172152 current disk space = 3115676205056 free memory = 1578198696 SRR7172152 SRAfilesize 56cc2f6b4adb03ff9f35c3b8e1183d80 SRR7172152.sra SRR7172152.sra file validated SRR7172152 is paired end SRR7172152 is conventional basespace SRR7172152 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172152_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92325 33.0 33.0 34.0 32.0 34.0 2 33.179 34.0 33.0 34.0 32.0 34.0 3 33.1295 34.0 33.0 34.0 32.0 34.0 4 33.26725 34.0 33.0 34.0 33.0 34.0 5 33.2075 34.0 33.0 34.0 33.0 34.0 6 37.25125 38.0 38.0 38.0 36.0 38.0 7 37.4845 38.0 38.0 38.0 37.0 38.0 8 37.53275 38.0 38.0 38.0 37.0 38.0 9 37.51775 38.0 38.0 38.0 38.0 38.0 10-14 37.35395 38.0 38.0 38.0 37.2 38.0 15-19 37.49795 38.0 38.0 38.0 38.0 38.0 20-24 37.413650000000004 38.0 38.0 38.0 37.6 38.0 25-29 37.36325 38.0 38.0 38.0 37.2 38.0 30-34 37.376400000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.29835 38.0 38.0 38.0 37.0 38.0 40-44 37.2177 38.0 38.0 38.0 37.0 38.0 45-49 37.00535 38.0 38.0 38.0 36.0 38.0 50-54 37.191199999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.25664999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.1891 38.0 38.0 38.0 37.0 38.0 65-69 37.18135 38.0 38.0 38.0 37.0 38.0 70-74 37.09935 38.0 38.0 38.0 36.4 38.0 75-79 36.9469 38.0 38.0 38.0 36.0 38.0 80-84 36.9517 38.0 38.0 38.0 36.0 38.0 85-89 36.8112 38.0 38.0 38.0 35.6 38.0 90-94 36.72 38.0 38.0 38.0 35.2 38.0 95-99 36.66005 38.0 38.0 38.0 35.0 38.0 100-104 36.70524999999999 38.0 38.0 38.0 35.4 38.0 105-109 36.54605 38.0 38.0 38.0 34.2 38.0 110-114 36.3783 38.0 38.0 38.0 34.0 38.0 115-119 36.204899999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.10825 38.0 37.8 38.0 33.6 38.0 125-129 35.86125 38.0 37.0 38.0 33.0 38.0 130-134 35.59535 38.0 36.6 38.0 31.6 38.0 135-139 35.2759 38.0 36.0 38.0 31.0 38.0 140-144 34.815599999999996 38.0 36.0 38.0 28.8 38.0 145-149 34.159000000000006 38.0 36.0 38.0 26.4 38.0 150-151 29.393625 35.5 26.0 38.0 7.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 0.0 10 0.0 11 1.0 12 2.0 13 3.0 14 1.0 15 4.0 16 2.0 17 3.0 18 2.0 19 1.0 20 0.0 21 5.0 22 9.0 23 8.0 24 11.0 25 15.0 26 15.0 27 22.0 28 12.0 29 31.0 30 41.0 31 38.0 32 58.0 33 84.0 34 138.0 35 238.0 36 522.0 37 2730.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.325000000000003 16.900000000000002 17.150000000000002 35.625 2 18.7 23.974999999999998 38.95 18.375 3 16.825000000000003 30.625000000000004 29.849999999999998 22.7 4 19.7 38.625 21.75 19.925 5 19.625 37.75 24.25 18.375 6 16.75 37.85 25.650000000000002 19.75 7 12.225 22.0 45.425 20.349999999999998 8 17.599999999999998 23.575 29.175 29.65 9 16.8 24.25 31.35 27.6 10-14 18.42580515701816 32.457108457911104 26.31684559044848 22.800240794622255 15-19 18.69 30.835 27.715 22.759999999999998 20-24 19.13 30.620000000000005 27.47 22.78 25-29 18.765 30.685000000000002 27.495000000000005 23.055 30-34 18.89 30.915 27.355 22.84 35-39 18.95 31.005 27.689999999999998 22.355 40-44 19.064999999999998 30.755 27.27 22.91 45-49 19.035 30.56 27.250000000000004 23.155 50-54 19.425 30.380000000000003 27.24 22.955000000000002 55-59 19.525000000000002 29.945 27.79 22.74 60-64 19.655 30.235 27.43 22.68 65-69 19.5 29.805 27.875 22.82 70-74 19.305 29.970000000000002 27.61 23.115 75-79 19.59 29.23 27.744999999999997 23.435 80-84 19.535 29.285 27.894999999999996 23.285 85-89 20.145 29.785 27.025 23.044999999999998 90-94 19.555 29.54 27.555000000000003 23.35 95-99 19.525000000000002 29.354999999999997 27.644999999999996 23.474999999999998 100-104 19.830000000000002 29.054999999999996 28.22 22.895 105-109 20.065016254063515 29.262315578894725 27.481870467616904 23.190797699424856 110-114 20.48114434330299 28.76863058917675 27.293187956386916 23.45703711113334 115-119 20.131006550327516 28.8114405720286 27.631381569078457 23.426171308565426 120-124 20.586322477362547 28.70078543198759 27.02486367502126 23.688028415628594 125-129 20.212233456802483 28.82170387426169 27.40514566022625 23.56091700870958 130-134 20.974999999999998 28.904999999999998 26.44 23.68 135-139 21.16 28.249999999999996 26.63 23.96 140-144 20.36 28.470000000000002 27.04 24.13 145-149 21.215 28.43 26.700000000000003 23.655 150-151 20.9125 28.425 26.7125 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 1.0 12 0.5 13 0.5 14 1.5 15 1.5 16 1.5 17 1.0 18 1.5 19 1.5 20 0.5 21 2.0 22 1.5 23 2.0 24 5.5 25 8.0 26 12.5 27 16.5 28 17.5 29 23.0 30 34.0 31 40.5 32 59.0 33 81.0 34 106.5 35 136.5 36 142.5 37 147.0 38 176.5 39 196.5 40 202.5 41 228.0 42 240.0 43 247.0 44 255.0 45 236.0 46 228.0 47 213.0 48 182.5 49 157.0 50 135.0 51 106.0 52 75.5 53 63.5 54 57.0 55 41.5 56 27.5 57 22.0 58 14.0 59 9.5 60 5.5 61 4.5 62 4.0 63 3.5 64 3.5 65 2.0 66 1.0 67 3.0 68 3.0 69 0.5 70 0.5 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.33 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.025 110-114 0.03 115-119 0.005 120-124 0.055 125-129 0.11 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.4874999999999998 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 5.2625 0.0 0.0 0.0 0.0 130-131 5.9875 0.0 0.0 0.0 0.0 132-133 6.512499999999999 0.0 0.0 0.0 0.0 134-135 7.2125 0.0 0.0 0.0 0.0 136-137 7.737500000000001 0.0 0.0 0.0 0.0 138-139 8.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAACAT 10 0.006830828 145.0 1 >>END_MODULE SRR7172152 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172152_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01925 33.0 33.0 34.0 32.0 34.0 2 33.0005 34.0 33.0 34.0 32.0 34.0 3 33.01 34.0 33.0 34.0 32.0 34.0 4 32.9295 34.0 33.0 34.0 32.0 34.0 5 32.983 34.0 33.0 34.0 33.0 34.0 6 37.113 38.0 38.0 38.0 37.0 38.0 7 37.24775 38.0 38.0 38.0 37.0 38.0 8 37.17875 38.0 38.0 38.0 37.0 38.0 9 37.13675 38.0 38.0 38.0 37.0 38.0 10-14 37.1574 38.0 38.0 38.0 37.0 38.0 15-19 37.13785 38.0 38.0 38.0 37.0 38.0 20-24 37.051700000000004 38.0 38.0 38.0 37.0 38.0 25-29 36.997550000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.02910000000001 38.0 38.0 38.0 37.0 38.0 35-39 36.9452 38.0 38.0 38.0 37.0 38.0 40-44 36.89385 38.0 38.0 38.0 36.6 38.0 45-49 36.93515 38.0 38.0 38.0 36.8 38.0 50-54 36.9766 38.0 38.0 38.0 36.8 38.0 55-59 36.95025 38.0 38.0 38.0 36.8 38.0 60-64 36.9295 38.0 38.0 38.0 37.0 38.0 65-69 36.917049999999996 38.0 38.0 38.0 37.0 38.0 70-74 36.84655 38.0 38.0 38.0 36.0 38.0 75-79 36.81635 38.0 38.0 38.0 36.0 38.0 80-84 36.72675 38.0 38.0 38.0 35.8 38.0 85-89 36.6168 38.0 38.0 38.0 35.4 38.0 90-94 36.50599999999999 38.0 38.0 38.0 35.2 38.0 95-99 36.2923 38.0 38.0 38.0 34.0 38.0 100-104 36.22385 38.0 38.0 38.0 34.0 38.0 105-109 36.27295 38.0 38.0 38.0 34.0 38.0 110-114 36.1147 38.0 38.0 38.0 34.0 38.0 115-119 35.986900000000006 38.0 38.0 38.0 33.6 38.0 120-124 35.8287 38.0 38.0 38.0 32.6 38.0 125-129 35.772400000000005 38.0 37.8 38.0 32.2 38.0 130-134 35.34315 38.0 36.6 38.0 31.0 38.0 135-139 35.06705 38.0 36.0 38.0 30.0 38.0 140-144 34.6147 38.0 36.0 38.0 28.2 38.0 145-149 33.9279 38.0 36.0 38.0 24.2 38.0 150-151 29.148375 35.5 18.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 5.0 4 4.0 5 3.0 6 1.0 7 3.0 8 1.0 9 4.0 10 1.0 11 2.0 12 3.0 13 0.0 14 4.0 15 1.0 16 3.0 17 2.0 18 3.0 19 4.0 20 1.0 21 13.0 22 10.0 23 5.0 24 10.0 25 19.0 26 18.0 27 24.0 28 28.0 29 19.0 30 37.0 31 48.0 32 60.0 33 87.0 34 108.0 35 221.0 36 466.0 37 2773.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.80220330495744 15.172759138708061 18.327491236855284 31.69754631947922 2 23.947895791583164 22.895791583166332 35.87174348697395 17.284569138276552 3 21.21212121212121 25.29426496368645 31.755572251440018 21.738041572752316 4 24.3175557225144 32.006010518407216 23.09040821437516 20.586025544703233 5 25.262894341512272 37.105658487731596 20.806209313970957 16.825237856785176 6 18.479619904976243 37.409352338084524 24.15603900975244 19.954988747186796 7 19.400000000000002 15.85 43.875 20.875 8 21.85 22.400000000000002 27.224999999999998 28.525 9 22.975 25.575 27.650000000000002 23.799999999999997 10-14 23.796189809490475 28.766438321916095 26.32131606580329 21.11605580279014 15-19 23.775 27.779999999999998 27.33 21.115000000000002 20-24 23.73 28.235 27.735 20.3 25-29 23.905 28.155 27.169999999999998 20.77 30-34 23.365 27.925 28.15 20.560000000000002 35-39 23.505000000000003 28.54 27.67 20.285 40-44 23.815 27.994999999999997 27.445000000000004 20.745 45-49 24.21 27.91 27.694999999999997 20.185 50-54 23.53 28.275 27.655 20.54 55-59 24.02 28.555000000000003 27.529999999999998 19.895 60-64 23.68 27.944999999999997 27.750000000000004 20.625 65-69 23.169999999999998 27.875 28.615000000000002 20.34 70-74 24.115000000000002 28.07 28.194999999999997 19.62 75-79 24.235 27.084999999999997 28.515 20.165 80-84 24.04 27.71 28.515 19.735 85-89 24.145 28.21 27.665 19.98 90-94 23.330000000000002 27.815 28.59 20.265 95-99 23.3 27.925 28.62 20.155 100-104 23.735 27.725 28.555000000000003 19.985 105-109 23.745 27.92 29.005 19.33 110-114 23.005 28.17 28.77 20.055 115-119 23.830000000000002 27.694999999999997 28.810000000000002 19.665 120-124 23.674999999999997 28.305000000000003 28.63 19.39 125-129 24.375 28.115000000000002 28.410000000000004 19.1 130-134 24.5 27.74 28.09 19.67 135-139 24.26 27.834999999999997 28.73 19.175 140-144 24.715 27.889999999999997 28.34 19.055 145-149 24.73 28.255000000000003 28.21 18.805 150-151 26.0375 27.125 28.249999999999996 18.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 2.0 24 2.0 25 0.5 26 2.0 27 2.5 28 2.5 29 5.0 30 7.0 31 11.0 32 21.5 33 35.5 34 42.5 35 54.0 36 86.5 37 112.5 38 140.5 39 174.0 40 192.5 41 227.0 42 269.5 43 271.0 44 276.0 45 291.0 46 290.5 47 271.5 48 246.5 49 216.0 50 172.0 51 140.5 52 97.5 53 77.0 54 65.0 55 47.5 56 37.0 57 24.0 58 20.0 59 12.5 60 10.0 61 12.0 62 8.0 63 5.0 64 5.0 65 2.0 66 1.0 67 2.5 68 2.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.2 3 0.17500000000000002 4 0.17500000000000002 5 0.15 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.4874999999999998 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.0875000000000004 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.9125 0.0 0.0 0.0 0.0 132-133 6.4625 0.0 0.0 0.0 0.0 134-135 7.1625 0.0 0.0 0.0 0.0 136-137 7.7 0.0 0.0 0.0 0.0 138-139 8.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTGC 10 0.006830828 145.0 6 TTTTGCT 10 0.006830828 145.0 7 GGGTTCC 10 0.006830828 145.0 4 TGGGGAT 10 0.006830828 145.0 1 >>END_MODULE Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707168 spots for SRR7172152.sra Written 707168 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra Read 707162 spots for SRR7172152.sra Written 707162 spots for SRR7172152.sra SRR ids: ['SRR7172152.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fm66dg3q SRR7172152.sra spots: 14143246 blocks: [[1, 707162], [707163, 1414324], [1414325, 2121486], [2121487, 2828648], [2828649, 3535810], [3535811, 4242972], [4242973, 4950134], [4950135, 5657296], [5657297, 6364458], [6364459, 7071620], [7071621, 7778782], [7778783, 8485944], [8485945, 9193106], [9193107, 9900268], [9900269, 10607430], [10607431, 11314592], [11314593, 12021754], [12021755, 12728916], [12728917, 13436078], [13436079, 14143246]] SRR7172152 file size 4770981 SRR7172152 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172152 SRR7172152_1.fastq SRR7172152_2.fastq Input file: SRR7172152_1.fastq Paired file: SRR7172152_2.fastq trimmed: SRR7172152-trimmed-pair1.fastq, SRR7172152-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:19:20 2025 >> started Fri Feb 14 10:19:40 2025 >> done (19.741s) 14143246 read pairs processed; of these: 17535 ( 0.12%) short read pairs filtered out after trimming by size control 13213 ( 0.09%) empty read pairs filtered out after trimming by size control 14112498 (99.78%) read pairs available; of these: 7087887 (50.22%) trimmed read pairs available after processing 7024611 (49.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 1 0.00% 21 11 0.00% 22 13 0.00% 23 12 0.00% 24 8 0.00% 25 14 0.00% 26 10 0.00% 27 14 0.00% 28 14 0.00% 29 12 0.00% 30 13 0.00% 31 10 0.00% 32 11 0.00% 33 5 0.00% 34 13 0.00% 35 8 0.00% 36 10 0.00% 37 13 0.00% 38 6 0.00% 39 7 0.00% 40 5 0.00% 41 14 0.00% 42 18 0.00% 43 26 0.00% 44 18 0.00% 45 21 0.00% 46 23 0.00% 47 41 0.00% 48 23 0.00% 49 25 0.00% 50 39 0.00% 51 40 0.00% 52 48 0.00% 53 41 0.00% 54 62 0.00% 55 52 0.00% 56 63 0.00% 57 91 0.00% 58 87 0.00% 59 123 0.00% 60 111 0.00% 61 139 0.00% 62 152 0.00% 63 194 0.00% 64 204 0.00% 65 195 0.00% 66 233 0.00% 67 254 0.00% 68 290 0.00% 69 339 0.00% 70 345 0.00% 71 484 0.00% 72 514 0.00% 73 590 0.00% 74 718 0.01% 75 847 0.01% 76 1034 0.01% 77 1098 0.01% 78 1203 0.01% 79 1393 0.01% 80 1502 0.01% 81 1729 0.01% 82 2115 0.01% 83 2465 0.02% 84 3821 0.03% 85 4748 0.03% 86 5152 0.04% 87 5843 0.04% 88 6312 0.04% 89 6234 0.04% 90 6503 0.05% 91 6901 0.05% 92 7195 0.05% 93 7844 0.06% 94 8378 0.06% 95 9192 0.07% 96 9709 0.07% 97 10901 0.08% 98 11532 0.08% 99 12691 0.09% 100 14318 0.10% 101 14759 0.10% 102 15198 0.11% 103 16728 0.12% 104 17400 0.12% 105 18933 0.13% 106 19848 0.14% 107 21243 0.15% 108 22503 0.16% 109 23321 0.17% 110 24828 0.18% 111 26013 0.18% 112 26971 0.19% 113 28355 0.20% 114 29817 0.21% 115 31630 0.22% 116 32860 0.23% 117 34412 0.24% 118 35882 0.25% 119 36932 0.26% 120 37993 0.27% 121 40218 0.28% 122 41443 0.29% 123 43315 0.31% 124 44544 0.32% 125 45840 0.32% 126 47869 0.34% 127 50006 0.35% 128 51632 0.37% 129 53347 0.38% 130 54865 0.39% 131 56789 0.40% 132 59098 0.42% 133 61476 0.44% 134 64395 0.46% 135 67400 0.48% 136 70003 0.50% 137 73246 0.52% 138 77701 0.55% 139 82560 0.59% 140 90173 0.64% 141 93324 0.66% 142 100531 0.71% 143 108808 0.77% 144 122966 0.87% 145 141054 1.00% 146 167443 1.19% 147 217322 1.54% 148 313372 2.22% 149 602348 4.27% 150 3372678 23.90% 151 7024611 49.78% 14112498 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=23 prefix-density=0.71 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=35.85 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=10.7 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCAATGGT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=17 prefix-density=0.66 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.19 sequence-density-rank=21 fanout-score=19.89 fanout-score-rank=1 prefix-density=1.26 prefix-fanout=3.0 sequence=CTGCAAATGAGGAAACATGGGCATGGTTCCAACAAAGCAGTAGTTAATCTATCAGTTGGTCAGCTCATGTTTGTATAATGGTGCTTCTTGTTAAATAATAATAAACAGCAAAG SRR7172152 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:20:33 Started mapping on | Feb 14 10:20:33 Finished on | Feb 14 10:22:23 Mapping speed, Million of reads per hour | 461.86 Number of input reads | 14112498 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13078820 Uniquely mapped reads % | 92.68% Average mapped length | 292.32 Number of splices: Total | 10134309 Number of splices: Annotated (sjdb) | 9874730 Number of splices: GT/AG | 9943418 Number of splices: GC/AG | 132864 Number of splices: AT/AC | 9567 Number of splices: Non-canonical | 48460 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.05% Deletion average length | 2.43 Insertion rate per base | 0.03% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 387193 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 77356 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.88% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 666584 666584 666584 N_multimapping 387193 387193 387193 N_noFeature 374049 12895662 431383 N_ambiguous 199370 1198 72918 UnstrandedReadsAssigned:12505401 PositiveStrandReadsAssigned:181960 NegativeStrandReadsAssigned:12574519 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172152 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172152-trimmed-pair1.fastq SRR7172152-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,112,498 reads, 12,555,733 reads pseudoaligned [quant] estimated average fragment length: 218.101 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR7172152.ke.tsv 34699 SRR7172152.se.tsv 87100 total ==> SRR7172152.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.9 1039 36.0613 Potri.005G024800.1.v4.1 1035 817.899 275 21.0159 Potri.004G059700.1.v4.1 961 743.904 44 3.69701 Potri.007G009000.2.v4.1 1416 1198.9 0 0 Potri.003G141000.2.v4.1 2943 2725.9 560 12.8408 Potri.016G087400.1.v4.1 270 86.197 1020 739.644 Potri.015G069301.1.v4.1 564 348.27 0 0 Potri.010G195200.1.v4.1 1773 1555.9 473 19.0018 Potri.012G127500.1.v4.1 977 759.899 9900 814.318 ==> SRR7172152.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 1410 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 622 SRR7172152 completed mapping pipeline successfully