Starting /dee2/code/volunteer_pipeline.sh SRR7172153 current disk space = 3116992155648 free memory = 1449090316 SRR7172153 SRAfilesize 48656b17696ba0a82f401460c850dba9 SRR7172153.sra SRR7172153.sra file validated SRR7172153 is paired end SRR7172153 is conventional basespace SRR7172153 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172153_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.37525 34.0 33.0 34.0 32.0 34.0 2 33.0275 34.0 33.0 34.0 31.0 34.0 3 32.88925 34.0 33.0 34.0 32.0 34.0 4 33.33925 34.0 33.0 34.0 33.0 34.0 5 33.527 34.0 33.0 34.0 33.0 34.0 6 37.16075 38.0 37.0 38.0 36.0 38.0 7 37.572 38.0 38.0 38.0 37.0 38.0 8 37.7165 38.0 38.0 38.0 38.0 38.0 9 37.73475 38.0 38.0 38.0 38.0 38.0 10-14 37.73965 38.0 38.0 38.0 38.0 38.0 15-19 37.684450000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.714150000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.69475 38.0 38.0 38.0 38.0 38.0 30-34 37.65445 38.0 38.0 38.0 38.0 38.0 35-39 37.587599999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.57209999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.5663 38.0 38.0 38.0 38.0 38.0 50-54 37.4836 38.0 38.0 38.0 37.4 38.0 55-59 37.40465 38.0 38.0 38.0 37.0 38.0 60-64 37.411500000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.3301 38.0 38.0 38.0 37.0 38.0 70-74 37.27695 38.0 38.0 38.0 37.0 38.0 75-79 37.15295 38.0 38.0 38.0 36.2 38.0 80-84 37.12385 38.0 38.0 38.0 36.2 38.0 85-89 37.0182 38.0 38.0 38.0 36.0 38.0 90-94 36.9359 38.0 38.0 38.0 35.8 38.0 95-99 36.86845 38.0 38.0 38.0 35.0 38.0 100-104 36.727149999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.51610000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.41685 38.0 38.0 38.0 34.0 38.0 115-119 36.195 38.0 37.2 38.0 34.0 38.0 120-124 36.16425 38.0 37.6 38.0 33.6 38.0 125-129 35.89425 38.0 37.0 38.0 33.0 38.0 130-134 35.583600000000004 38.0 36.4 38.0 31.8 38.0 135-139 35.18645 38.0 36.0 38.0 29.2 38.0 140-144 34.928450000000005 38.0 35.6 38.0 28.8 38.0 145-149 34.30965 38.0 35.0 38.0 26.6 38.0 150-151 30.937624999999997 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 1.0 18 5.0 19 2.0 20 3.0 21 3.0 22 2.0 23 10.0 24 2.0 25 9.0 26 13.0 27 14.0 28 23.0 29 24.0 30 20.0 31 37.0 32 34.0 33 70.0 34 107.0 35 233.0 36 680.0 37 2705.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.85817115435884 18.208477739269526 15.169288189816049 34.76406291655558 2 19.85992996498249 24.462231115557778 36.99349674837419 18.684342171085543 3 16.1 32.15 27.35 24.4 4 20.95 36.4 22.375 20.275000000000002 5 19.275000000000002 37.775 23.474999999999998 19.475 6 16.025 35.05 26.974999999999998 21.95 7 12.6 20.8 45.35 21.25 8 17.599999999999998 22.5 29.299999999999997 30.599999999999998 9 18.775 21.099999999999998 30.975 29.15 10-14 18.895 29.985 27.16 23.96 15-19 19.564999999999998 28.925 28.1 23.41 20-24 19.415 28.82 28.01 23.755000000000003 25-29 19.33 28.99 28.310000000000002 23.369999999999997 30-34 19.375 29.470000000000002 28.134999999999998 23.02 35-39 19.439999999999998 29.310000000000002 27.96 23.29 40-44 19.384999999999998 28.849999999999998 28.560000000000002 23.205000000000002 45-49 19.55 28.78 28.535 23.135 50-54 19.045 29.154999999999998 27.57 24.23 55-59 19.84 28.895 27.800000000000004 23.465 60-64 19.775000000000002 28.355000000000004 28.57 23.3 65-69 19.755 29.325000000000003 27.305 23.615 70-74 19.75 29.065 27.775 23.41 75-79 19.29 28.84 27.98 23.89 80-84 19.64 28.7 28.139999999999997 23.52 85-89 19.79 28.975 27.735 23.5 90-94 19.965 28.349999999999998 28.000000000000004 23.685000000000002 95-99 19.68 28.599999999999998 28.765 22.955000000000002 100-104 20.465 28.349999999999998 28.110000000000003 23.075000000000003 105-109 20.02 29.205 27.105 23.669999999999998 110-114 20.14 29.005 27.58 23.275000000000002 115-119 20.39 28.615000000000002 27.884999999999998 23.11 120-124 20.075000000000003 28.76 27.639999999999997 23.525 125-129 20.685000000000002 29.025000000000002 26.995 23.294999999999998 130-134 20.32 28.310000000000002 27.68 23.69 135-139 20.76 28.475 26.99 23.775 140-144 20.7 27.875 27.450000000000003 23.974999999999998 145-149 20.43 28.49 27.250000000000004 23.830000000000002 150-151 19.975 29.2 27.275 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.0 23 2.5 24 4.0 25 4.0 26 5.5 27 8.5 28 11.5 29 18.0 30 26.5 31 31.0 32 41.0 33 50.0 34 63.5 35 100.0 36 122.0 37 131.0 38 168.0 39 198.0 40 225.0 41 253.5 42 257.0 43 261.0 44 265.5 45 255.5 46 233.5 47 231.5 48 223.0 49 183.0 50 139.0 51 105.0 52 84.5 53 66.5 54 56.5 55 43.5 56 31.0 57 26.0 58 16.0 59 9.5 60 8.0 61 8.0 62 7.5 63 4.5 64 4.0 65 3.0 66 1.0 67 1.5 68 2.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.225 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.5750000000000002 0.0 0.0 0.0 0.0 118-119 1.7625 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.2750000000000004 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.325 0.0 0.0 0.0 0.0 130-131 3.5 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.725 0.0 0.0 0.0 0.0 138-139 5.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCTCC 10 0.0068378756 144.95 4 >>END_MODULE SRR7172153 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172153_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35975 34.0 33.0 34.0 33.0 34.0 2 33.42525 34.0 33.0 34.0 33.0 34.0 3 33.476 34.0 33.0 34.0 33.0 34.0 4 33.44775 34.0 33.0 34.0 33.0 34.0 5 33.427 34.0 33.0 34.0 33.0 34.0 6 37.55225 38.0 38.0 38.0 38.0 38.0 7 37.62175 38.0 38.0 38.0 38.0 38.0 8 37.58775 38.0 38.0 38.0 38.0 38.0 9 37.59025 38.0 38.0 38.0 38.0 38.0 10-14 37.604099999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.59544999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.58055 38.0 38.0 38.0 38.0 38.0 25-29 37.537 38.0 38.0 38.0 38.0 38.0 30-34 37.50995 38.0 38.0 38.0 38.0 38.0 35-39 37.475 38.0 38.0 38.0 38.0 38.0 40-44 37.42095 38.0 38.0 38.0 38.0 38.0 45-49 37.443349999999995 38.0 38.0 38.0 37.8 38.0 50-54 37.386700000000005 38.0 38.0 38.0 37.2 38.0 55-59 37.32705 38.0 38.0 38.0 37.0 38.0 60-64 37.24735 38.0 38.0 38.0 37.0 38.0 65-69 37.2102 38.0 38.0 38.0 37.0 38.0 70-74 37.17855 38.0 38.0 38.0 37.0 38.0 75-79 37.0202 38.0 38.0 38.0 36.2 38.0 80-84 37.01115 38.0 38.0 38.0 36.2 38.0 85-89 36.9073 38.0 38.0 38.0 36.0 38.0 90-94 36.864999999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.726600000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.676700000000004 38.0 38.0 38.0 35.0 38.0 105-109 36.54075 38.0 38.0 38.0 34.6 38.0 110-114 36.43865 38.0 38.0 38.0 34.2 38.0 115-119 36.1631 38.0 37.6 38.0 33.6 38.0 120-124 35.98265 38.0 37.6 38.0 33.4 38.0 125-129 35.699 38.0 37.0 38.0 32.0 38.0 130-134 35.370549999999994 38.0 36.2 38.0 31.0 38.0 135-139 35.11515000000001 38.0 36.0 38.0 29.0 38.0 140-144 34.75769999999999 38.0 35.4 38.0 28.0 38.0 145-149 34.2188 38.0 34.4 38.0 26.4 38.0 150-151 30.161499999999997 36.5 28.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 1.0 12 3.0 13 2.0 14 0.0 15 0.0 16 3.0 17 0.0 18 5.0 19 5.0 20 3.0 21 5.0 22 6.0 23 6.0 24 12.0 25 7.0 26 12.0 27 10.0 28 21.0 29 24.0 30 28.0 31 28.0 32 50.0 33 66.0 34 126.0 35 210.0 36 572.0 37 2787.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.75 13.950000000000001 18.925 31.374999999999996 2 24.675 22.05 34.975 18.3 3 20.3 25.650000000000002 32.625 21.425 4 23.75 34.2 21.45 20.599999999999998 5 23.674999999999997 37.25 20.424999999999997 18.65 6 18.3 38.224999999999994 22.45 21.025 7 16.75 16.650000000000002 45.125 21.475 8 20.775 22.1 27.700000000000003 29.425 9 22.175 23.674999999999997 29.725 24.425 10-14 22.505 29.025000000000002 26.634999999999998 21.834999999999997 15-19 22.79 27.675 28.38 21.154999999999998 20-24 22.375 28.665000000000003 28.025 20.935000000000002 25-29 22.59 28.299999999999997 27.935 21.175 30-34 22.825 28.555000000000003 27.96 20.66 35-39 22.725 28.410000000000004 28.360000000000003 20.505000000000003 40-44 23.52 28.16 27.77 20.549999999999997 45-49 23.01 28.720000000000002 27.689999999999998 20.580000000000002 50-54 23.200000000000003 27.96 28.265 20.575 55-59 23.425 27.750000000000004 28.299999999999997 20.525 60-64 22.88 28.43 27.825 20.865000000000002 65-69 23.095 28.62 27.925 20.36 70-74 23.474999999999998 27.58 28.660000000000004 20.285 75-79 23.59 28.16 28.194999999999997 20.055 80-84 23.205000000000002 28.134999999999998 28.199999999999996 20.46 85-89 23.535 28.000000000000004 28.265 20.200000000000003 90-94 23.669999999999998 28.09 28.139999999999997 20.1 95-99 23.724999999999998 28.32 27.72 20.235 100-104 23.835 27.639999999999997 28.044999999999998 20.48 105-109 23.830000000000002 27.715 28.645 19.81 110-114 23.485 27.595 28.634999999999998 20.285 115-119 24.03 27.525 28.335 20.11 120-124 24.195 27.810000000000002 28.155 19.84 125-129 23.990000000000002 28.075 27.87 20.064999999999998 130-134 23.86 28.34 27.900000000000002 19.900000000000002 135-139 24.349999999999998 28.439999999999998 27.500000000000004 19.71 140-144 24.69 28.29 27.450000000000003 19.57 145-149 24.404999999999998 27.91 28.12 19.564999999999998 150-151 25.1 27.3125 27.85 19.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 1.5 26 2.5 27 3.5 28 7.0 29 13.5 30 15.5 31 15.0 32 19.5 33 35.5 34 54.0 35 69.0 36 91.5 37 114.5 38 144.5 39 191.0 40 207.0 41 233.0 42 258.5 43 266.5 44 289.5 45 286.0 46 273.5 47 256.5 48 218.0 49 196.5 50 176.0 51 137.0 52 102.5 53 73.5 54 56.5 55 41.0 56 33.0 57 25.0 58 20.0 59 18.5 60 13.5 61 9.5 62 4.5 63 5.0 64 5.0 65 3.0 66 3.0 67 2.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.25100401606425704 0.5 3 0.07530120481927711 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 0.9874999999999999 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 2.025 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.4625 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 3.25 0.0 0.0 0.0 0.0 130-131 3.425 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.225 0.0 0.0 0.0 0.0 136-137 4.7 0.0 0.0 0.0 0.0 138-139 5.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGTAT 10 0.006830828 145.0 6 TGACAAG 10 0.006830828 145.0 8 ATGTATG 10 0.006830828 145.0 7 TGTATGC 10 0.006830828 145.0 8 CAGCTTT 10 0.006830828 145.0 8 >>END_MODULE Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra Read 551878 spots for SRR7172153.sra Written 551878 spots for SRR7172153.sra Read 551862 spots for SRR7172153.sra Written 551862 spots for SRR7172153.sra SRR ids: ['SRR7172153.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wjckqvgb SRR7172153.sra spots: 11037256 blocks: [[1, 551862], [551863, 1103724], [1103725, 1655586], [1655587, 2207448], [2207449, 2759310], [2759311, 3311172], [3311173, 3863034], [3863035, 4414896], [4414897, 4966758], [4966759, 5518620], [5518621, 6070482], [6070483, 6622344], [6622345, 7174206], [7174207, 7726068], [7726069, 8277930], [8277931, 8829792], [8829793, 9381654], [9381655, 9933516], [9933517, 10485378], [10485379, 11037256]] SRR7172153 file size 3718463 SRR7172153 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172153 SRR7172153_1.fastq SRR7172153_2.fastq Input file: SRR7172153_1.fastq Paired file: SRR7172153_2.fastq trimmed: SRR7172153-trimmed-pair1.fastq, SRR7172153-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:15:39 2025 >> started Fri Feb 14 09:15:55 2025 >> done (16.384s) 11037256 read pairs processed; of these: 5880 ( 0.05%) short read pairs filtered out after trimming by size control 5027 ( 0.05%) empty read pairs filtered out after trimming by size control 11026349 (99.90%) read pairs available; of these: 5301763 (48.08%) trimmed read pairs available after processing 5724586 (51.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 0 0.00% 25 2 0.00% 26 2 0.00% 27 10 0.00% 28 0 0.00% 29 6 0.00% 30 4 0.00% 31 3 0.00% 32 4 0.00% 33 2 0.00% 34 2 0.00% 35 2 0.00% 36 3 0.00% 37 6 0.00% 38 4 0.00% 39 7 0.00% 40 1 0.00% 41 7 0.00% 42 6 0.00% 43 4 0.00% 44 10 0.00% 45 2 0.00% 46 8 0.00% 47 9 0.00% 48 6 0.00% 49 10 0.00% 50 15 0.00% 51 16 0.00% 52 11 0.00% 53 21 0.00% 54 17 0.00% 55 27 0.00% 56 31 0.00% 57 29 0.00% 58 25 0.00% 59 33 0.00% 60 37 0.00% 61 46 0.00% 62 59 0.00% 63 77 0.00% 64 64 0.00% 65 104 0.00% 66 90 0.00% 67 127 0.00% 68 128 0.00% 69 146 0.00% 70 170 0.00% 71 206 0.00% 72 207 0.00% 73 245 0.00% 74 292 0.00% 75 333 0.00% 76 428 0.00% 77 452 0.00% 78 488 0.00% 79 558 0.01% 80 619 0.01% 81 708 0.01% 82 816 0.01% 83 992 0.01% 84 1291 0.01% 85 1606 0.01% 86 1837 0.02% 87 2099 0.02% 88 2302 0.02% 89 2501 0.02% 90 2570 0.02% 91 2781 0.03% 92 3056 0.03% 93 3293 0.03% 94 3551 0.03% 95 3932 0.04% 96 4124 0.04% 97 4497 0.04% 98 4788 0.04% 99 5247 0.05% 100 5687 0.05% 101 5937 0.05% 102 6537 0.06% 103 6899 0.06% 104 7577 0.07% 105 8047 0.07% 106 8462 0.08% 107 8980 0.08% 108 9809 0.09% 109 10195 0.09% 110 10695 0.10% 111 11605 0.11% 112 12200 0.11% 113 12747 0.12% 114 13675 0.12% 115 14340 0.13% 116 14900 0.14% 117 15885 0.14% 118 16412 0.15% 119 17305 0.16% 120 17730 0.16% 121 18677 0.17% 122 19198 0.17% 123 20534 0.19% 124 21614 0.20% 125 22343 0.20% 126 23794 0.22% 127 25059 0.23% 128 26020 0.24% 129 27312 0.25% 130 28836 0.26% 131 30232 0.27% 132 32048 0.29% 133 34008 0.31% 134 36128 0.33% 135 38104 0.35% 136 40318 0.37% 137 42908 0.39% 138 45985 0.42% 139 49503 0.45% 140 53121 0.48% 141 58111 0.53% 142 65120 0.59% 143 73256 0.66% 144 86479 0.78% 145 104492 0.95% 146 133772 1.21% 147 190289 1.73% 148 305589 2.77% 149 642201 5.82% 150 2713857 24.61% 151 5724586 51.92% 11026349 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=36 prefix-density=0.28 prefix-fanout=2.2 sequence=CTTTTGGTGTAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=264.87 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=20.4 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.49 fanout-score-rank=27 prefix-density=0.31 prefix-fanout=3.4 sequence=TGCAAGTGCGGCAGTGGCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=131.47 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=14.2 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR7172153 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:16:51 Started mapping on | Feb 14 09:16:51 Finished on | Feb 14 09:18:09 Mapping speed, Million of reads per hour | 508.91 Number of input reads | 11026349 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10368104 Uniquely mapped reads % | 94.03% Average mapped length | 295.15 Number of splices: Total | 9650792 Number of splices: Annotated (sjdb) | 9416663 Number of splices: GT/AG | 9480764 Number of splices: GC/AG | 126723 Number of splices: AT/AC | 8918 Number of splices: Non-canonical | 34387 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.35 Insertion rate per base | 0.03% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320602 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 29280 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 345147 345147 345147 N_multimapping 320602 320602 320602 N_noFeature 372167 10256897 427516 N_ambiguous 119540 628 63363 UnstrandedReadsAssigned:9876397 PositiveStrandReadsAssigned:110579 NegativeStrandReadsAssigned:9877225 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172153 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172153-trimmed-pair1.fastq SRR7172153-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,026,349 reads, 9,814,128 reads pseudoaligned [quant] estimated average fragment length: 250.069 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 988 rounds 52401 SRR7172153.ke.tsv 34699 SRR7172153.se.tsv 87100 total ==> SRR7172153.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.93 925 47.76 Potri.005G024800.1.v4.1 1035 785.931 280 32.5392 Potri.004G059700.1.v4.1 961 711.966 19 2.43741 Potri.007G009000.2.v4.1 1416 1166.93 0 0 Potri.003G141000.2.v4.1 2943 2693.93 279 9.45914 Potri.016G087400.1.v4.1 270 77.0304 949 1125.22 Potri.015G069301.1.v4.1 564 320.634 0 0 Potri.010G195200.1.v4.1 1773 1523.93 122 7.31187 Potri.012G127500.1.v4.1 977 727.946 9895 1241.51 ==> SRR7172153.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 158 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 151 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 369 SRR7172153 completed mapping pipeline successfully