Starting /dee2/code/volunteer_pipeline.sh SRR7172154 current disk space = 3116736667648 free memory = 1448956912 SRR7172154 SRAfilesize 2a512d2b8b27e5b9684c982888aeddfd SRR7172154.sra SRR7172154.sra file validated SRR7172154 is paired end SRR7172154 is conventional basespace SRR7172154 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172154_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01575 34.0 33.0 34.0 32.0 34.0 2 33.24225 34.0 33.0 34.0 32.0 34.0 3 33.105 34.0 33.0 34.0 32.0 34.0 4 33.181 34.0 33.0 34.0 32.0 34.0 5 33.20525 34.0 33.0 34.0 33.0 34.0 6 37.05225 38.0 37.0 38.0 36.0 38.0 7 37.44525 38.0 38.0 38.0 37.0 38.0 8 37.52825 38.0 38.0 38.0 37.0 38.0 9 37.34975 38.0 38.0 38.0 38.0 38.0 10-14 37.5159 38.0 38.0 38.0 38.0 38.0 15-19 37.51495 38.0 38.0 38.0 37.8 38.0 20-24 37.45715 38.0 38.0 38.0 37.4 38.0 25-29 37.42575 38.0 38.0 38.0 37.4 38.0 30-34 37.324400000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.33985 38.0 38.0 38.0 37.0 38.0 40-44 37.24855 38.0 38.0 38.0 36.8 38.0 45-49 37.2363 38.0 38.0 38.0 36.8 38.0 50-54 37.342650000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.30915 38.0 38.0 38.0 37.0 38.0 60-64 37.20215 38.0 38.0 38.0 36.8 38.0 65-69 37.20115 38.0 38.0 38.0 36.4 38.0 70-74 37.1769 38.0 38.0 38.0 36.4 38.0 75-79 37.024 38.0 38.0 38.0 36.0 38.0 80-84 36.997699999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.8942 38.0 38.0 38.0 35.8 38.0 90-94 36.82935 38.0 38.0 38.0 35.0 38.0 95-99 36.7827 38.0 38.0 38.0 35.0 38.0 100-104 36.62705 38.0 38.0 38.0 34.2 38.0 105-109 36.61645 38.0 38.0 38.0 34.6 38.0 110-114 36.2719 38.0 37.8 38.0 34.0 38.0 115-119 36.1682 38.0 37.4 38.0 33.6 38.0 120-124 35.94180000000001 38.0 37.0 38.0 32.2 38.0 125-129 35.541700000000006 38.0 37.0 38.0 31.0 38.0 130-134 35.579150000000006 38.0 36.4 38.0 31.0 38.0 135-139 35.1242 38.0 36.0 38.0 29.2 38.0 140-144 34.54375 38.0 35.2 38.0 27.8 38.0 145-149 33.894600000000004 38.0 34.8 38.0 24.2 38.0 150-151 28.50425 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 1.0 20 3.0 21 7.0 22 2.0 23 3.0 24 10.0 25 17.0 26 17.0 27 19.0 28 29.0 29 28.0 30 46.0 31 49.0 32 57.0 33 120.0 34 135.0 35 265.0 36 606.0 37 2581.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.85 15.7 14.975 36.475 2 19.85 23.549999999999997 38.675 17.925 3 19.125 29.299999999999997 26.650000000000002 24.925 4 20.68017004251063 36.70917729432358 22.030507626906726 20.580145036259065 5 19.950000000000003 36.85 23.875 19.325 6 16.05 36.675000000000004 26.075 21.2 7 12.049999999999999 18.75 48.05 21.15 8 18.0 20.925 28.425 32.65 9 16.817724068479357 21.928499496475325 31.49546827794562 29.758308157099698 10-14 19.394848712178046 30.21255313828457 26.18154538634659 24.2110527631908 15-19 19.415 28.970000000000002 27.935 23.68 20-24 20.035 29.035 27.72 23.21 25-29 19.2059602980149 29.10145507275364 27.736386819340968 23.956197809890494 30-34 19.8 29.23 27.46 23.51 35-39 19.81 28.835 27.375 23.98 40-44 19.847977196579485 28.559283892583885 27.88418262739411 23.708556283442515 45-49 19.877981697254587 29.37440616092414 27.33410011501725 23.41351202680402 50-54 19.8 29.095 27.625 23.48 55-59 19.634999999999998 28.655 28.17 23.54 60-64 19.725 28.53 27.800000000000004 23.945 65-69 20.305 28.405 28.28 23.01 70-74 19.890994549727488 28.63143157157858 28.30641532076604 23.171158557927896 75-79 20.161008050402522 28.961448072403623 27.936396819840994 22.941147057352868 80-84 20.635 28.065 27.994999999999997 23.305 85-89 20.637063706370636 28.32783278327833 27.772777277727773 23.262326232623263 90-94 19.84599229961498 28.836441822091103 27.51137556877844 23.806190309515475 95-99 20.44 28.355000000000004 27.46 23.745 100-104 19.84099204960248 28.33641682084104 27.826391319565978 23.996199809990497 105-109 20.006000300015 28.026401320066004 27.85639281964098 24.111205560278016 110-114 20.94398236296222 28.640144303036376 27.482713698767412 22.93315963523399 115-119 20.205000000000002 28.76 28.110000000000003 22.925 120-124 20.875875875875877 27.982982982982985 27.43743743743744 23.703703703703706 125-129 21.233219795632138 28.305950711280303 26.99859747545582 23.462232017631738 130-134 20.96 28.910000000000004 26.865 23.265 135-139 20.855 28.28 26.77 24.095 140-144 20.906045302265113 28.711435571778587 26.986349317465873 23.396169808490423 145-149 20.905 28.299999999999997 27.02 23.775 150-151 21.55 28.175 27.025 23.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 1.5 23 2.0 24 2.5 25 4.5 26 7.5 27 8.0 28 12.5 29 23.0 30 27.5 31 27.5 32 38.5 33 46.0 34 60.0 35 87.0 36 102.5 37 127.5 38 151.0 39 159.0 40 183.0 41 225.5 42 266.5 43 281.5 44 274.0 45 270.5 46 259.5 47 225.0 48 202.5 49 176.0 50 149.0 51 132.5 52 97.5 53 76.0 54 66.5 55 49.0 56 38.5 57 29.5 58 22.0 59 19.5 60 15.5 61 13.0 62 9.0 63 7.5 64 4.5 65 3.0 66 2.0 67 2.0 68 2.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.7000000000000001 10-14 0.025 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.005 80-84 0.0 85-89 0.01 90-94 0.005 95-99 0.0 100-104 0.005 105-109 0.005 110-114 0.21 115-119 0.0 120-124 0.1 125-129 0.18 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.1375000000000002 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.4875 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.9749999999999996 0.0 0.0 0.0 0.0 124-125 3.225 0.0 0.0 0.0 0.0 126-127 3.525 0.0 0.0 0.0 0.0 128-129 3.8375 0.0 0.0 0.0 0.0 130-131 4.2875 0.0 0.0 0.0 0.0 132-133 4.7875 0.0 0.0 0.0 0.0 134-135 5.1125 0.0 0.0 0.0 0.0 136-137 5.45 0.0 0.0 0.0 0.0 138-139 5.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAATC 10 0.006883923 144.625 2 >>END_MODULE SRR7172154 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172154_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8935 33.0 33.0 34.0 32.0 34.0 2 33.02375 34.0 33.0 34.0 32.0 34.0 3 33.08725 34.0 33.0 34.0 32.0 34.0 4 33.0095 34.0 33.0 34.0 32.0 34.0 5 33.016 34.0 33.0 34.0 32.0 34.0 6 37.0945 38.0 38.0 38.0 37.0 38.0 7 37.225 38.0 38.0 38.0 37.0 38.0 8 37.1325 38.0 38.0 38.0 37.0 38.0 9 37.18 38.0 38.0 38.0 37.0 38.0 10-14 37.085249999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.11135 38.0 38.0 38.0 37.0 38.0 20-24 37.05315 38.0 38.0 38.0 37.0 38.0 25-29 36.98355 38.0 38.0 38.0 36.8 38.0 30-34 36.993449999999996 38.0 38.0 38.0 37.0 38.0 35-39 36.9457 38.0 38.0 38.0 36.4 38.0 40-44 36.801 38.0 38.0 38.0 35.8 38.0 45-49 36.86229999999999 38.0 38.0 38.0 36.2 38.0 50-54 36.8948 38.0 38.0 38.0 36.2 38.0 55-59 36.8531 38.0 38.0 38.0 36.0 38.0 60-64 36.822500000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.699149999999996 38.0 38.0 38.0 35.6 38.0 70-74 36.6857 38.0 38.0 38.0 35.8 38.0 75-79 36.65295 38.0 38.0 38.0 35.0 38.0 80-84 36.5141 38.0 38.0 38.0 34.8 38.0 85-89 36.4993 38.0 38.0 38.0 34.8 38.0 90-94 36.29385 38.0 38.0 38.0 33.6 38.0 95-99 36.092150000000004 38.0 38.0 38.0 33.4 38.0 100-104 36.07645 38.0 38.0 38.0 33.6 38.0 105-109 35.9987 38.0 38.0 38.0 33.6 38.0 110-114 35.7124 38.0 37.0 38.0 31.6 38.0 115-119 35.6167 38.0 37.2 38.0 31.0 38.0 120-124 35.3 38.0 37.0 38.0 30.6 38.0 125-129 35.0556 38.0 36.4 38.0 29.2 38.0 130-134 34.6983 38.0 36.0 38.0 27.2 38.0 135-139 34.2374 38.0 35.6 38.0 24.2 38.0 140-144 33.476099999999995 38.0 33.4 38.0 19.2 38.0 145-149 32.82090000000001 38.0 33.0 38.0 11.0 38.0 150-151 27.752000000000002 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 3.0 5 3.0 6 2.0 7 4.0 8 2.0 9 2.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 1.0 16 1.0 17 0.0 18 4.0 19 5.0 20 13.0 21 15.0 22 8.0 23 12.0 24 18.0 25 19.0 26 17.0 27 30.0 28 32.0 29 38.0 30 60.0 31 57.0 32 82.0 33 117.0 34 140.0 35 224.0 36 546.0 37 2528.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.94235588972431 14.536340852130325 16.74185463659148 31.779448621553886 2 23.223223223223226 24.074074074074073 35.53553553553554 17.167167167167165 3 21.115836877658246 26.82011508631474 30.94821115836878 21.115836877658246 4 24.2992992992993 34.609609609609606 21.146146146146148 19.944944944944947 5 22.59194395796848 37.32799599699775 22.016512384288216 18.06354766074556 6 16.766766766766768 37.16216216216216 25.350350350350347 20.72072072072072 7 16.916916916916914 16.066066066066064 44.44444444444444 22.57257257257257 8 20.72072072072072 22.097097097097095 29.07907907907908 28.103103103103106 9 22.236118059029515 23.736868434217108 29.539769884942473 24.487243621810904 10-14 23.024570885252466 28.42416053645599 26.317369764299652 22.233898813991892 15-19 22.83783783783784 27.78778778778779 27.8978978978979 21.476476476476478 20-24 23.08923569427771 27.921168467386952 28.251300520208083 20.73829531812725 25-29 23.162316231623162 27.61776177617762 27.96779677967797 21.252125212521253 30-34 23.325000000000003 27.88 27.800000000000004 20.995 35-39 23.044999999999998 28.43 27.92 20.605 40-44 22.615 27.88 28.04 21.465 45-49 22.634999999999998 27.589999999999996 28.575 21.2 50-54 23.60118005900295 28.311415570778536 28.14140707035352 19.94599729986499 55-59 23.300825206301575 28.857214303575894 27.431857964491122 20.41010252563141 60-64 23.23580895223806 27.516879219804952 28.212053013253314 21.035258814703674 65-69 23.05076269067267 27.836959239809957 28.327081770442607 20.78519629907477 70-74 22.99074768692173 27.991997999499873 27.976994248562143 21.040260065016252 75-79 23.55588897224306 27.401850462615652 28.30207551887972 20.740185046261566 80-84 22.930732683170792 28.632158039509875 27.846961740435113 20.59014753688422 85-89 23.465866466616657 27.68192048012003 28.252063015753937 20.600150037509376 90-94 23.900975243810954 27.526881720430108 28.307076769192296 20.26506626656664 95-99 23.604720944188838 27.945589117823566 28.290658131626323 20.15903180636127 100-104 24.026201310065503 27.66638331916596 28.106405320266013 20.201010050502525 105-109 23.244999999999997 28.38 28.425 19.950000000000003 110-114 23.705000000000002 27.689999999999998 28.335 20.27 115-119 23.91358703805571 27.819172875931393 28.404260639095863 19.862979446917038 120-124 24.20605151287822 28.18704676169042 27.521880470117527 20.08502125531383 125-129 24.021005251312825 28.31707926981745 27.47186796699175 20.19004751187797 130-134 24.50112528132033 27.811952988247064 28.10202550637659 19.584896224056013 135-139 24.221055263815956 28.127031757939484 27.97199299824956 19.679919979995 140-144 24.566141535383846 28.13703425856464 27.101775443860966 20.19504876219055 145-149 24.977497749774976 28.63286328632863 27.037703770377036 19.351935193519353 150-151 25.7 27.187499999999996 26.875 20.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 3.0 27 6.0 28 7.5 29 7.5 30 15.5 31 30.0 32 40.0 33 44.5 34 49.5 35 58.0 36 76.0 37 108.5 38 144.0 39 180.0 40 210.0 41 222.0 42 243.0 43 264.0 44 278.5 45 276.5 46 264.5 47 245.0 48 214.0 49 181.5 50 145.5 51 143.0 52 129.0 53 91.0 54 72.5 55 58.0 56 43.0 57 33.5 58 28.0 59 22.5 60 15.0 61 11.0 62 7.0 63 4.0 64 4.0 65 4.0 66 3.0 67 2.0 68 1.0 69 1.0 70 0.5 71 1.0 72 2.0 73 1.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.1 3 0.075 4 0.1 5 0.075 6 0.1 7 0.1 8 0.1 9 0.05 10-14 0.08499999999999999 15-19 0.1 20-24 0.04 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.025 95-99 0.02 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.025 125-129 0.025 130-134 0.025 135-139 0.025 140-144 0.025 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64841788046208 99.2 2 0.25113008538422904 0.5 3 0.10045203415369162 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.4875 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.6875 0.0 0.0 0.0 0.0 134-135 5.0125 0.0 0.0 0.0 0.0 136-137 5.35 0.0 0.0 0.0 0.0 138-139 5.887499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAGTA 10 0.006830828 145.0 1 >>END_MODULE Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100746 spots for SRR7172154.sra Written 1100746 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra Read 1100742 spots for SRR7172154.sra Written 1100742 spots for SRR7172154.sra SRR ids: ['SRR7172154.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yi00gp4e SRR7172154.sra spots: 22014844 blocks: [[1, 1100742], [1100743, 2201484], [2201485, 3302226], [3302227, 4402968], [4402969, 5503710], [5503711, 6604452], [6604453, 7705194], [7705195, 8805936], [8805937, 9906678], [9906679, 11007420], [11007421, 12108162], [12108163, 13208904], [13208905, 14309646], [14309647, 15410388], [15410389, 16511130], [16511131, 17611872], [17611873, 18712614], [18712615, 19813356], [19813357, 20914098], [20914099, 22014844]] SRR7172154 file size 7438407 SRR7172154 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172154 SRR7172154_1.fastq SRR7172154_2.fastq Input file: SRR7172154_1.fastq Paired file: SRR7172154_2.fastq trimmed: SRR7172154-trimmed-pair1.fastq, SRR7172154-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:37:57 2025 >> started Fri Feb 14 09:38:32 2025 >> done (34.548s) 22014844 read pairs processed; of these: 20730 ( 0.09%) short read pairs filtered out after trimming by size control 17028 ( 0.08%) empty read pairs filtered out after trimming by size control 21977086 (99.83%) read pairs available; of these: 12621355 (57.43%) trimmed read pairs available after processing 9355731 (42.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 0 0.00% 20 9 0.00% 21 5 0.00% 22 10 0.00% 23 7 0.00% 24 9 0.00% 25 4 0.00% 26 9 0.00% 27 12 0.00% 28 12 0.00% 29 10 0.00% 30 7 0.00% 31 8 0.00% 32 3 0.00% 33 9 0.00% 34 7 0.00% 35 15 0.00% 36 22 0.00% 37 13 0.00% 38 12 0.00% 39 9 0.00% 40 10 0.00% 41 25 0.00% 42 11 0.00% 43 12 0.00% 44 15 0.00% 45 18 0.00% 46 24 0.00% 47 27 0.00% 48 20 0.00% 49 30 0.00% 50 34 0.00% 51 45 0.00% 52 45 0.00% 53 51 0.00% 54 52 0.00% 55 68 0.00% 56 74 0.00% 57 107 0.00% 58 250 0.00% 59 406 0.00% 60 272 0.00% 61 228 0.00% 62 174 0.00% 63 188 0.00% 64 241 0.00% 65 255 0.00% 66 297 0.00% 67 291 0.00% 68 348 0.00% 69 393 0.00% 70 446 0.00% 71 533 0.00% 72 609 0.00% 73 726 0.00% 74 873 0.00% 75 991 0.00% 76 1095 0.00% 77 1248 0.01% 78 1694 0.01% 79 1735 0.01% 80 2006 0.01% 81 2093 0.01% 82 2771 0.01% 83 4223 0.02% 84 6280 0.03% 85 7034 0.03% 86 6774 0.03% 87 7589 0.03% 88 7598 0.03% 89 7492 0.03% 90 7470 0.03% 91 7863 0.04% 92 8408 0.04% 93 9367 0.04% 94 10202 0.05% 95 11187 0.05% 96 11905 0.05% 97 12670 0.06% 98 13578 0.06% 99 14811 0.07% 100 16827 0.08% 101 17087 0.08% 102 18091 0.08% 103 19380 0.09% 104 20295 0.09% 105 21956 0.10% 106 22810 0.10% 107 23962 0.11% 108 25645 0.12% 109 26832 0.12% 110 28305 0.13% 111 29753 0.14% 112 31656 0.14% 113 34000 0.15% 114 35329 0.16% 115 37334 0.17% 116 39220 0.18% 117 41599 0.19% 118 43491 0.20% 119 45388 0.21% 120 47917 0.22% 121 50175 0.23% 122 52197 0.24% 123 54760 0.25% 124 58420 0.27% 125 61983 0.28% 126 65062 0.30% 127 68568 0.31% 128 71839 0.33% 129 74849 0.34% 130 78188 0.36% 131 81801 0.37% 132 85898 0.39% 133 90018 0.41% 134 94976 0.43% 135 100209 0.46% 136 106983 0.49% 137 111890 0.51% 138 119587 0.54% 139 129925 0.59% 140 144158 0.66% 141 154608 0.70% 142 172127 0.78% 143 195988 0.89% 144 229735 1.05% 145 268419 1.22% 146 342778 1.56% 147 467206 2.13% 148 681008 3.10% 149 1355434 6.17% 150 6250210 28.44% 151 9355731 42.57% 21977086 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=27 prefix-density=0.40 prefix-fanout=2.3 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=107.88 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=12.9 sequence=TCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAA criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=24 prefix-density=0.36 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=86.96 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.5 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGAATT SRR7172154 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:39:47 Started mapping on | Feb 14 09:39:47 Finished on | Feb 14 09:45:09 Mapping speed, Million of reads per hour | 245.71 Number of input reads | 21977086 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19755940 Uniquely mapped reads % | 89.89% Average mapped length | 293.27 Number of splices: Total | 18456134 Number of splices: Annotated (sjdb) | 18083098 Number of splices: GT/AG | 18138903 Number of splices: GC/AG | 241843 Number of splices: AT/AC | 16323 Number of splices: Non-canonical | 59065 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.04% Deletion average length | 2.27 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 587023 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 63183 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.04% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1656686 1656686 1656686 N_multimapping 587023 587023 587023 N_noFeature 631027 19563970 722671 N_ambiguous 208061 1011 107292 UnstrandedReadsAssigned:18916852 PositiveStrandReadsAssigned:190959 NegativeStrandReadsAssigned:18925977 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172154 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172154-trimmed-pair1.fastq SRR7172154-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,977,086 reads, 18,768,190 reads pseudoaligned [quant] estimated average fragment length: 235.814 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR7172154.ke.tsv 34699 SRR7172154.se.tsv 87100 total ==> SRR7172154.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.19 1961 57.8945 Potri.005G024800.1.v4.1 1035 800.186 458 30.1322 Potri.004G059700.1.v4.1 961 726.202 39 2.82724 Potri.007G009000.2.v4.1 1416 1181.19 0 0 Potri.003G141000.2.v4.1 2943 2708.19 777.221 15.1085 Potri.016G087400.1.v4.1 270 80.9247 936.209 609.043 Potri.015G069301.1.v4.1 564 332.465 0 0 Potri.010G195200.1.v4.1 1773 1538.19 1238 42.3709 Potri.012G127500.1.v4.1 977 742.197 18173 1289.03 ==> SRR7172154.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 411 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 367 SRR7172154 completed mapping pipeline successfully