Starting /dee2/code/volunteer_pipeline.sh SRR7172453 current disk space = 3116829196288 free memory = 1480347276 SRR7172453 SRAfilesize 77e1793390db40262ad06494ebb39696 SRR7172453.sra SRR7172453.sra file validated SRR7172453 is paired end SRR7172453 is conventional basespace SRR7172453 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172453_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87325 34.0 33.0 34.0 33.0 34.0 2 33.3645 34.0 34.0 34.0 33.0 34.0 3 33.41225 34.0 34.0 34.0 33.0 34.0 4 33.4435 34.0 34.0 34.0 33.0 34.0 5 33.4895 34.0 34.0 34.0 33.0 34.0 6 37.14625 38.0 38.0 38.0 36.0 38.0 7 37.37625 38.0 38.0 38.0 37.0 38.0 8 37.45125 38.0 38.0 38.0 37.0 38.0 9 37.458 38.0 38.0 38.0 38.0 38.0 10-14 37.48795 38.0 38.0 38.0 38.0 38.0 15-19 37.511849999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.509049999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.501400000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.41055 38.0 38.0 38.0 37.4 38.0 35-39 37.3662 38.0 38.0 38.0 37.2 38.0 40-44 37.22715000000001 38.0 38.0 38.0 36.8 38.0 45-49 37.2122 38.0 38.0 38.0 36.6 38.0 50-54 37.006699999999995 38.0 38.0 38.0 36.0 38.0 55-59 37.023649999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.00905 38.0 38.0 38.0 36.0 38.0 65-69 36.924099999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.801100000000005 38.0 38.0 38.0 35.2 38.0 75-79 36.697199999999995 38.0 38.0 38.0 34.6 38.0 80-84 36.58795 38.0 38.0 38.0 34.0 38.0 85-89 36.5077 38.0 38.0 38.0 34.0 38.0 90-94 36.289550000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.2168 38.0 37.8 38.0 33.6 38.0 100-104 35.9113 38.0 37.2 38.0 32.6 38.0 105-109 35.72875 38.0 37.0 38.0 31.6 38.0 110-114 35.32705 38.0 36.6 38.0 29.2 38.0 115-119 35.45799999999999 38.0 36.6 38.0 30.4 38.0 120-124 35.1868 38.0 36.0 38.0 28.6 38.0 125-129 34.7224 38.0 35.2 38.0 27.0 38.0 130-134 34.58540000000001 38.0 35.2 38.0 26.4 38.0 135-139 34.1476 38.0 34.8 38.0 24.0 38.0 140-144 33.4492 38.0 33.6 38.0 19.0 38.0 145-149 32.52615 38.0 33.2 38.0 13.6 38.0 150-151 28.029875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 0.0 15 2.0 16 5.0 17 5.0 18 7.0 19 5.0 20 6.0 21 12.0 22 11.0 23 8.0 24 8.0 25 19.0 26 12.0 27 34.0 28 38.0 29 42.0 30 43.0 31 56.0 32 76.0 33 119.0 34 163.0 35 308.0 36 755.0 37 2261.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.98015772068176 13.965911981684052 11.549224116001017 36.504706181633175 2 21.75 19.075 34.849999999999994 24.325 3 18.6 25.324999999999996 25.55 30.525000000000002 4 21.25 34.4 21.925 22.425 5 21.15 37.55 23.175 18.125 6 18.099999999999998 34.775 26.775 20.349999999999998 7 13.700000000000001 22.425 44.800000000000004 19.075 8 17.9 23.575 30.575000000000003 27.950000000000003 9 17.5 22.25 33.900000000000006 26.35 10-14 20.45 28.78 26.32 24.45 15-19 19.525000000000002 28.04 28.194999999999997 24.240000000000002 20-24 20.21 28.025 27.634999999999998 24.13 25-29 19.77 28.765 27.63 23.835 30-34 20.005 28.27 27.700000000000003 24.025 35-39 20.1 28.28 27.865000000000002 23.755000000000003 40-44 19.59 28.794999999999998 27.815 23.799999999999997 45-49 20.485 28.52 27.405 23.59 50-54 19.79 29.520000000000003 27.63 23.06 55-59 20.135 28.310000000000002 27.66 23.895 60-64 20.150000000000002 28.349999999999998 27.815 23.685000000000002 65-69 20.455000000000002 28.355000000000004 27.27 23.919999999999998 70-74 20.794999999999998 27.834999999999997 27.405 23.965 75-79 20.525 27.950000000000003 27.62 23.905 80-84 20.23 28.025 27.91 23.835 85-89 20.71 28.265 27.195000000000004 23.830000000000002 90-94 20.505000000000003 28.57 27.215 23.71 95-99 20.560000000000002 27.944999999999997 27.405 24.09 100-104 20.623717274866095 28.71301997296891 26.910947589728185 23.7523151624368 105-109 20.630000000000003 28.285 27.785 23.3 110-114 20.59472470163474 27.835723598435465 27.905927188847656 23.663624511082137 115-119 20.599999999999998 28.84 26.950000000000003 23.61 120-124 21.02 28.63 26.945000000000004 23.405 125-129 20.62 28.205000000000002 27.32 23.855 130-134 20.62 28.32 27.0 24.060000000000002 135-139 20.665 28.655 26.775 23.905 140-144 21.165 28.660000000000004 26.96 23.215 145-149 21.310000000000002 28.52 26.424999999999997 23.745 150-151 20.974999999999998 28.299999999999997 27.1 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.5 21 2.5 22 2.0 23 2.0 24 4.5 25 6.5 26 8.5 27 9.5 28 11.5 29 12.5 30 16.0 31 30.0 32 36.0 33 44.0 34 61.5 35 77.5 36 81.5 37 94.5 38 138.0 39 165.0 40 187.5 41 201.5 42 207.0 43 251.0 44 268.5 45 252.0 46 239.0 47 235.5 48 225.5 49 215.0 50 191.0 51 133.5 52 113.0 53 107.0 54 79.5 55 66.5 56 53.5 57 38.5 58 34.5 59 28.5 60 19.5 61 12.0 62 13.0 63 7.5 64 0.0 65 3.0 66 3.5 67 1.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.11499999999999999 105-109 0.0 110-114 0.29 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7056451612903225 1.4000000000000001 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4500000000000002 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.85 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.4000000000000004 0.0 0.0 0.0 0.0 126-127 3.7125 0.0 0.0 0.0 0.0 128-129 3.9875 0.0 0.0 0.0 0.0 130-131 4.300000000000001 0.0 0.0 0.0 0.0 132-133 4.7625 0.0 0.0 0.0 0.0 134-135 5.2125 0.0 0.0 0.0 0.0 136-137 5.9375 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCGT 10 0.006832588 144.9875 6 TGATTTT 10 0.006832588 144.9875 8 CATCTGA 10 0.006832588 144.9875 4 ATCTGAC 10 0.006832588 144.9875 5 >>END_MODULE SRR7172453 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172453_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.585 33.0 33.0 34.0 32.0 34.0 2 32.6445 34.0 33.0 34.0 32.0 34.0 3 32.687 34.0 33.0 34.0 32.0 34.0 4 32.59225 34.0 33.0 34.0 32.0 34.0 5 32.5925 34.0 33.0 34.0 32.0 34.0 6 36.724 38.0 38.0 38.0 36.0 38.0 7 36.79125 38.0 38.0 38.0 36.0 38.0 8 36.694 38.0 38.0 38.0 36.0 38.0 9 36.70925 38.0 38.0 38.0 36.0 38.0 10-14 36.7232 38.0 38.0 38.0 36.2 38.0 15-19 36.7385 38.0 38.0 38.0 36.8 38.0 20-24 36.6979 38.0 38.0 38.0 36.2 38.0 25-29 36.72735 38.0 38.0 38.0 36.8 38.0 30-34 36.68275 38.0 38.0 38.0 36.2 38.0 35-39 36.6412 38.0 38.0 38.0 36.0 38.0 40-44 36.67100000000001 38.0 38.0 38.0 36.2 38.0 45-49 36.69565 38.0 38.0 38.0 36.2 38.0 50-54 36.61055 38.0 38.0 38.0 36.0 38.0 55-59 36.5368 38.0 38.0 38.0 35.8 38.0 60-64 36.52095 38.0 38.0 38.0 35.8 38.0 65-69 36.484750000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.5019 38.0 38.0 38.0 36.0 38.0 75-79 36.1909 38.0 38.0 38.0 34.4 38.0 80-84 36.26025 38.0 38.0 38.0 34.4 38.0 85-89 36.27239999999999 38.0 38.0 38.0 34.8 38.0 90-94 36.054899999999996 38.0 38.0 38.0 34.0 38.0 95-99 35.90474999999999 38.0 38.0 38.0 33.6 38.0 100-104 35.8282 38.0 38.0 38.0 33.2 38.0 105-109 35.5221 38.0 38.0 38.0 31.0 38.0 110-114 35.537800000000004 38.0 38.0 38.0 31.4 38.0 115-119 35.3509 38.0 37.6 38.0 30.6 38.0 120-124 35.1425 38.0 37.0 38.0 30.0 38.0 125-129 34.8333 38.0 36.2 38.0 28.0 38.0 130-134 34.423649999999995 38.0 36.0 38.0 25.0 38.0 135-139 33.9118 38.0 35.4 38.0 21.0 38.0 140-144 33.31570000000001 38.0 33.8 38.0 16.8 38.0 145-149 32.67975 38.0 33.0 38.0 10.8 38.0 150-151 28.760375000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 4.0 4 5.0 5 3.0 6 2.0 7 0.0 8 2.0 9 1.0 10 2.0 11 2.0 12 2.0 13 4.0 14 4.0 15 7.0 16 6.0 17 4.0 18 13.0 19 8.0 20 8.0 21 10.0 22 9.0 23 21.0 24 12.0 25 16.0 26 28.0 27 35.0 28 31.0 29 35.0 30 45.0 31 56.0 32 46.0 33 83.0 34 114.0 35 205.0 36 496.0 37 2645.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.457661290322584 19.254032258064516 15.725806451612904 26.5625 2 26.008064516129032 27.21774193548387 32.15725806451613 14.616935483870968 3 21.446572580645164 27.39415322580645 30.34274193548387 20.816532258064516 4 24.029248613212303 35.09833585476551 21.759959657085222 19.112455874936966 5 22.440746343923347 37.31719616742309 22.793746848209786 17.448310640443772 6 19.581653225806452 37.14717741935484 24.798387096774192 18.472782258064516 7 18.67439516129032 18.397177419354836 42.086693548387096 20.84173387096774 8 20.992943548387096 24.445564516129032 28.049395161290324 26.51209677419355 9 22.001008064516128 23.538306451612904 30.040322580645164 24.420362903225808 10-14 23.06451612903226 28.588709677419356 26.522177419354836 21.824596774193548 15-19 23.180443548387096 28.07459677419355 27.73185483870968 21.01310483870968 20-24 22.51008064516129 28.422379032258068 27.923387096774192 21.144153225806452 25-29 22.746975806451612 28.24092741935484 28.276209677419356 20.735887096774196 30-34 22.67641129032258 28.165322580645164 27.888104838709676 21.27016129032258 35-39 22.610887096774192 27.87802419354839 28.482862903225808 21.028225806451616 40-44 22.827620967741936 28.734879032258064 27.535282258064512 20.902217741935484 45-49 22.57560483870968 27.22782258064516 28.795362903225808 21.401209677419356 50-54 22.913306451612904 27.016129032258064 28.195564516129036 21.875 55-59 23.14516129032258 28.014112903225808 27.368951612903224 21.471774193548388 60-64 23.009072580645164 27.61592741935484 28.230846774193548 21.144153225806452 65-69 23.578629032258064 27.797379032258064 27.651209677419352 20.972782258064516 70-74 23.28125 27.505040322580644 28.392137096774196 20.82157258064516 75-79 23.77016129032258 26.622983870967744 27.862903225806452 21.743951612903224 80-84 23.63407258064516 27.34375 27.515120967741936 21.5070564516129 85-89 23.639112903225808 27.535282258064512 27.62096774193548 21.204637096774192 90-94 23.215725806451612 27.237903225806452 28.084677419354836 21.4616935483871 95-99 23.160282258064516 27.71673387096774 28.744959677419356 20.378024193548384 100-104 23.568548387096776 27.29334677419355 27.76209677419355 21.376008064516128 105-109 24.117943548387096 27.51008064516129 27.802419354838708 20.569556451612904 110-114 24.279233870967744 27.888104838709676 27.258064516129032 20.574596774193548 115-119 23.75 27.666330645161292 27.772177419354836 20.811491935483872 120-124 24.329637096774192 27.99899193548387 27.142137096774192 20.52923387096774 125-129 24.19858870967742 27.21774193548387 28.22076612903226 20.362903225806452 130-134 24.410282258064516 27.268145161290324 27.99899193548387 20.32258064516129 135-139 24.380040322580644 27.515120967741936 27.17741935483871 20.927419354838708 140-144 24.657258064516128 27.076612903225804 27.580645161290324 20.68548387096774 145-149 24.606854838709676 27.444556451612907 27.379032258064516 20.569556451612904 150-151 24.962197580645164 28.30141129032258 26.86491935483871 19.871471774193548 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 33.0 1 16.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 1.0 18 0.5 19 1.5 20 1.0 21 2.0 22 3.5 23 2.0 24 1.5 25 4.0 26 6.0 27 8.0 28 11.0 29 11.0 30 16.5 31 28.5 32 30.0 33 37.0 34 49.5 35 65.0 36 85.0 37 104.5 38 134.5 39 152.5 40 177.5 41 199.0 42 214.5 43 270.5 44 289.5 45 258.5 46 247.0 47 239.5 48 214.5 49 195.5 50 180.5 51 144.5 52 112.0 53 101.5 54 92.5 55 69.5 56 47.0 57 37.0 58 28.5 59 24.0 60 22.5 61 17.0 62 12.0 63 7.5 64 3.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.8 3 0.8 4 0.8500000000000001 5 0.8500000000000001 6 0.8 7 0.8 8 0.8 9 0.8 10-14 0.8 15-19 0.8 20-24 0.8 25-29 0.8 30-34 0.8 35-39 0.8 40-44 0.8 45-49 0.8 50-54 0.8 55-59 0.8 60-64 0.8 65-69 0.8 70-74 0.8 75-79 0.8 80-84 0.8 85-89 0.8 90-94 0.8 95-99 0.8 100-104 0.8 105-109 0.8 110-114 0.8 115-119 0.8 120-124 0.8 125-129 0.8 130-134 0.8 135-139 0.8 140-144 0.8 145-149 0.8 150-151 0.8 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08163265306122 97.1 2 0.6887755102040817 1.35 3 0.10204081632653061 0.3 4 0.05102040816326531 0.2 5 0.05102040816326531 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025510204081632654 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 32 0.8 No Hit AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.8625 0.0 0.0 0.0 0.0 128-129 4.137499999999999 0.0 0.0 0.0 0.0 130-131 4.425000000000001 0.0 0.0 0.0 0.0 132-133 4.875 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.95 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Read 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra Written 791808 spots for SRR7172453.sra SRR ids: ['SRR7172453.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j27nkhi3 SRR7172453.sra spots: 15836160 blocks: [[1, 791808], [791809, 1583616], [1583617, 2375424], [2375425, 3167232], [3167233, 3959040], [3959041, 4750848], [4750849, 5542656], [5542657, 6334464], [6334465, 7126272], [7126273, 7918080], [7918081, 8709888], [8709889, 9501696], [9501697, 10293504], [10293505, 11085312], [11085313, 11877120], [11877121, 12668928], [12668929, 13460736], [13460737, 14252544], [14252545, 15044352], [15044353, 15836160]] SRR7172453 file size 5344654 SRR7172453 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172453 SRR7172453_1.fastq SRR7172453_2.fastq Input file: SRR7172453_1.fastq Paired file: SRR7172453_2.fastq trimmed: SRR7172453-trimmed-pair1.fastq, SRR7172453-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:29:07 2025 >> started Fri Feb 14 09:29:24 2025 >> done (16.982s) 15836160 read pairs processed; of these: 24579 ( 0.16%) short read pairs filtered out after trimming by size control 109129 ( 0.69%) empty read pairs filtered out after trimming by size control 15702452 (99.16%) read pairs available; of these: 8283487 (52.75%) trimmed read pairs available after processing 7418965 (47.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 5 0.00% 21 6 0.00% 22 7 0.00% 23 9 0.00% 24 6 0.00% 25 6 0.00% 26 10 0.00% 27 11 0.00% 28 11 0.00% 29 10 0.00% 30 17 0.00% 31 14 0.00% 32 8 0.00% 33 20 0.00% 34 11 0.00% 35 14 0.00% 36 19 0.00% 37 18 0.00% 38 19 0.00% 39 27 0.00% 40 26 0.00% 41 39 0.00% 42 33 0.00% 43 45 0.00% 44 35 0.00% 45 39 0.00% 46 45 0.00% 47 59 0.00% 48 71 0.00% 49 73 0.00% 50 83 0.00% 51 89 0.00% 52 103 0.00% 53 114 0.00% 54 149 0.00% 55 127 0.00% 56 153 0.00% 57 149 0.00% 58 203 0.00% 59 231 0.00% 60 240 0.00% 61 274 0.00% 62 349 0.00% 63 356 0.00% 64 411 0.00% 65 453 0.00% 66 480 0.00% 67 573 0.00% 68 636 0.00% 69 808 0.01% 70 1154 0.01% 71 1368 0.01% 72 1328 0.01% 73 1224 0.01% 74 1361 0.01% 75 1490 0.01% 76 1541 0.01% 77 1697 0.01% 78 1837 0.01% 79 2244 0.01% 80 2461 0.02% 81 2786 0.02% 82 3192 0.02% 83 3542 0.02% 84 4959 0.03% 85 5476 0.03% 86 6057 0.04% 87 6255 0.04% 88 6572 0.04% 89 7055 0.04% 90 7679 0.05% 91 8165 0.05% 92 8844 0.06% 93 9781 0.06% 94 10483 0.07% 95 10891 0.07% 96 11115 0.07% 97 11753 0.07% 98 11996 0.08% 99 12591 0.08% 100 13453 0.09% 101 14207 0.09% 102 15337 0.10% 103 16426 0.10% 104 17403 0.11% 105 18231 0.12% 106 19207 0.12% 107 19787 0.13% 108 20360 0.13% 109 21595 0.14% 110 22123 0.14% 111 23748 0.15% 112 24288 0.15% 113 26296 0.17% 114 27250 0.17% 115 28246 0.18% 116 29439 0.19% 117 30782 0.20% 118 31480 0.20% 119 32803 0.21% 120 33770 0.22% 121 35276 0.22% 122 37092 0.24% 123 38707 0.25% 124 40788 0.26% 125 42532 0.27% 126 44955 0.29% 127 45504 0.29% 128 48048 0.31% 129 50054 0.32% 130 51936 0.33% 131 54484 0.35% 132 57311 0.36% 133 60607 0.39% 134 64787 0.41% 135 68608 0.44% 136 72073 0.46% 137 77475 0.49% 138 83389 0.53% 139 89803 0.57% 140 97605 0.62% 141 105376 0.67% 142 117459 0.75% 143 132572 0.84% 144 154376 0.98% 145 181750 1.16% 146 225398 1.44% 147 304484 1.94% 148 467243 2.98% 149 891290 5.68% 150 3882670 24.73% 151 7418965 47.25% 15702452 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.59 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=305.61 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=17 prefix-density=0.61 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.18 sequence-density-rank=21 fanout-score=14.95 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=5.7 sequence=AGCAATGGCAGCA SRR7172453 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:30:27 Started mapping on | Feb 14 09:30:27 Finished on | Feb 14 09:32:21 Mapping speed, Million of reads per hour | 495.87 Number of input reads | 15702452 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14657968 Uniquely mapped reads % | 93.35% Average mapped length | 293.01 Number of splices: Total | 14284473 Number of splices: Annotated (sjdb) | 13961123 Number of splices: GT/AG | 14003566 Number of splices: GC/AG | 228953 Number of splices: AT/AC | 7844 Number of splices: Non-canonical | 44110 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385734 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 137523 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 681159 681159 681159 N_multimapping 385734 385734 385734 N_noFeature 640322 14385753 753129 N_ambiguous 265582 1129 105437 UnstrandedReadsAssigned:13752064 PositiveStrandReadsAssigned:271086 NegativeStrandReadsAssigned:13799402 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172453 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172453-trimmed-pair1.fastq SRR7172453-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,702,452 reads, 13,882,443 reads pseudoaligned [quant] estimated average fragment length: 248.459 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,254 rounds 52401 SRR7172453.ke.tsv 34699 SRR7172453.se.tsv 87100 total ==> SRR7172453.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.54 461.51 16.5256 Potri.005G024800.1.v4.1 1035 787.541 136 10.9484 Potri.004G059700.1.v4.1 961 713.634 17 1.51028 Potri.007G009000.2.v4.1 1416 1168.54 0 0 Potri.003G141000.2.v4.1 2943 2695.54 800.973 18.8389 Potri.016G087400.1.v4.1 270 81.8849 740 572.942 Potri.015G069301.1.v4.1 564 324.907 0 0 Potri.010G195200.1.v4.1 1773 1525.54 44 1.82857 Potri.012G127500.1.v4.1 977 729.583 92 7.99459 ==> SRR7172453.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 698 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7172453 completed mapping pipeline successfully