Starting /dee2/code/volunteer_pipeline.sh SRR7172454 current disk space = 3115182383104 free memory = 1567565228 SRR7172454 SRAfilesize c2a553bc72fc7e3acd7995805314b726 SRR7172454.sra SRR7172454.sra file validated SRR7172454 is paired end SRR7172454 is conventional basespace SRR7172454 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172454_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.27225 34.0 33.0 34.0 32.0 34.0 2 33.21625 34.0 33.0 34.0 32.0 34.0 3 33.30975 34.0 33.0 34.0 32.0 34.0 4 33.385 34.0 33.0 34.0 33.0 34.0 5 33.10525 34.0 33.0 34.0 32.0 34.0 6 37.02525 38.0 37.0 38.0 36.0 38.0 7 37.39725 38.0 38.0 38.0 37.0 38.0 8 37.40875 38.0 38.0 38.0 37.0 38.0 9 37.4145 38.0 38.0 38.0 37.0 38.0 10-14 37.2504 38.0 38.0 38.0 36.8 38.0 15-19 37.1172 38.0 38.0 38.0 36.2 38.0 20-24 37.0297 38.0 38.0 38.0 36.0 38.0 25-29 37.26495 38.0 38.0 38.0 36.8 38.0 30-34 37.11110000000001 38.0 38.0 38.0 36.2 38.0 35-39 36.97449999999999 38.0 38.0 38.0 35.8 38.0 40-44 37.02085 38.0 38.0 38.0 36.0 38.0 45-49 36.62545 38.0 37.8 38.0 34.4 38.0 50-54 36.928250000000006 38.0 38.0 38.0 35.8 38.0 55-59 36.931149999999995 38.0 38.0 38.0 35.6 38.0 60-64 36.821749999999994 38.0 38.0 38.0 35.0 38.0 65-69 36.78405 38.0 38.0 38.0 35.0 38.0 70-74 36.48105 38.0 37.6 38.0 34.2 38.0 75-79 36.43435 38.0 37.6 38.0 33.6 38.0 80-84 36.12075 38.0 37.0 38.0 32.8 38.0 85-89 36.0779 38.0 37.0 38.0 32.4 38.0 90-94 35.62910000000001 38.0 36.4 38.0 30.2 38.0 95-99 36.13825 38.0 37.0 38.0 33.2 38.0 100-104 36.009 38.0 37.0 38.0 32.6 38.0 105-109 35.6707 38.0 36.6 38.0 31.0 38.0 110-114 35.398649999999996 38.0 36.0 38.0 29.0 38.0 115-119 35.14855 38.0 35.8 38.0 28.4 38.0 120-124 34.9851 38.0 35.4 38.0 27.4 38.0 125-129 34.63295 38.0 35.0 38.0 26.4 38.0 130-134 34.21205 38.0 34.4 38.0 24.4 38.0 135-139 33.4201 38.0 33.8 38.0 19.0 38.0 140-144 32.43320000000001 37.2 32.6 38.0 14.2 38.0 145-149 30.9517 35.8 30.4 38.0 9.0 38.0 150-151 27.702624999999998 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 3.0 18 3.0 19 5.0 20 6.0 21 7.0 22 7.0 23 9.0 24 12.0 25 20.0 26 32.0 27 31.0 28 37.0 29 56.0 30 57.0 31 92.0 32 119.0 33 188.0 34 226.0 35 415.0 36 918.0 37 1755.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.167355371900825 14.617768595041323 8.806818181818182 35.40805785123967 2 22.675 19.5 35.325 22.5 3 18.025 24.675 28.499999999999996 28.799999999999997 4 21.6 33.125 23.799999999999997 21.475 5 22.05 36.7 23.799999999999997 17.45 6 18.125 36.15 25.374999999999996 20.349999999999998 7 14.524999999999999 23.35 44.35 17.775 8 16.55 23.724999999999998 32.525 27.200000000000003 9 18.025 22.725 33.050000000000004 26.200000000000003 10-14 19.99 29.475 26.615 23.919999999999998 15-19 19.74 28.705000000000002 27.35 24.205 20-24 19.525000000000002 28.43 28.485 23.56 25-29 19.89 28.945 27.83 23.335 30-34 20.4 28.485 28.325 22.79 35-39 20.05 29.42 27.375 23.155 40-44 20.22 28.575 27.555000000000003 23.65 45-49 20.215 28.410000000000004 27.900000000000002 23.474999999999998 50-54 19.96 28.754999999999995 27.425 23.86 55-59 19.8 28.884999999999998 27.625 23.69 60-64 20.235 28.725 27.52 23.52 65-69 19.91 28.1 28.249999999999996 23.74 70-74 20.04 28.444999999999997 27.689999999999998 23.825 75-79 19.735 28.575 27.785 23.905 80-84 20.015 28.375 27.6 24.01 85-89 20.61 28.975 27.589999999999996 22.825 90-94 20.395 28.165000000000003 27.985 23.455000000000002 95-99 20.150000000000002 28.54 27.58 23.73 100-104 20.5 28.98 27.74 22.78 105-109 20.465 28.395 27.845 23.294999999999998 110-114 20.18 28.565 27.685 23.57 115-119 20.84 28.09 27.38 23.69 120-124 19.99 28.115000000000002 28.035 23.86 125-129 20.305 28.060000000000002 27.694999999999997 23.94 130-134 20.155 28.27 27.875 23.7 135-139 20.87 28.365000000000002 26.855 23.91 140-144 20.68 28.155 27.495000000000005 23.669999999999998 145-149 20.34 28.810000000000002 27.02 23.830000000000002 150-151 20.65 28.3625 27.6625 23.325000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 2.0 20 1.5 21 0.5 22 2.0 23 2.0 24 2.5 25 4.0 26 3.5 27 6.0 28 11.5 29 16.0 30 20.0 31 27.5 32 37.5 33 49.0 34 62.0 35 78.0 36 91.0 37 116.0 38 138.0 39 168.5 40 205.5 41 215.0 42 240.0 43 265.5 44 266.0 45 271.0 46 262.0 47 239.0 48 211.5 49 182.5 50 167.5 51 147.0 52 117.0 53 90.0 54 72.5 55 56.0 56 42.0 57 28.5 58 20.5 59 17.5 60 14.5 61 13.5 62 7.5 63 2.0 64 0.5 65 1.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.4874999999999998 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.9249999999999998 0.0 0.0 0.0 0.0 118-119 2.1624999999999996 0.0 0.0 0.0 0.0 120-121 2.2874999999999996 0.0 0.0 0.0 0.0 122-123 2.5250000000000004 0.0 0.0 0.0 0.0 124-125 2.7875 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.2625 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.2375 0.0 0.0 0.0 0.0 136-137 4.625 0.0 0.0 0.0 0.0 138-139 5.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGTAG 10 0.006832588 144.9875 5 TTGAGGT 10 0.006832588 144.9875 3 TGAGGTA 10 0.006832588 144.9875 4 GAGAGAG 20 0.0059376103 28.9975 15-19 >>END_MODULE SRR7172454 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172454_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93925 33.0 33.0 34.0 32.0 34.0 2 33.101 34.0 33.0 34.0 32.0 34.0 3 33.157 34.0 33.0 34.0 33.0 34.0 4 33.108 34.0 33.0 34.0 33.0 34.0 5 33.103 34.0 33.0 34.0 33.0 34.0 6 37.18375 38.0 38.0 38.0 37.0 38.0 7 37.199 38.0 38.0 38.0 37.0 38.0 8 37.1645 38.0 38.0 38.0 37.0 38.0 9 37.069 38.0 38.0 38.0 37.0 38.0 10-14 37.0793 38.0 38.0 38.0 36.8 38.0 15-19 37.189 38.0 38.0 38.0 37.0 38.0 20-24 36.87905 38.0 38.0 38.0 36.0 38.0 25-29 36.8407 38.0 38.0 38.0 36.0 38.0 30-34 36.9654 38.0 38.0 38.0 36.6 38.0 35-39 36.9822 38.0 38.0 38.0 36.4 38.0 40-44 36.75785 38.0 38.0 38.0 35.6 38.0 45-49 36.8154 38.0 38.0 38.0 35.8 38.0 50-54 36.52955 38.0 38.0 38.0 34.2 38.0 55-59 36.81935 38.0 38.0 38.0 36.0 38.0 60-64 36.81849999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.53195 38.0 38.0 38.0 34.8 38.0 70-74 36.6904 38.0 38.0 38.0 35.6 38.0 75-79 36.7924 38.0 38.0 38.0 36.0 38.0 80-84 36.6416 38.0 38.0 38.0 35.2 38.0 85-89 36.0271 38.0 37.6 38.0 32.6 38.0 90-94 36.330349999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.385450000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.0978 38.0 37.6 38.0 32.8 38.0 105-109 36.00485 38.0 38.0 38.0 33.2 38.0 110-114 35.859049999999996 38.0 37.6 38.0 32.6 38.0 115-119 35.8019 38.0 37.2 38.0 32.4 38.0 120-124 35.69365 38.0 37.0 38.0 31.8 38.0 125-129 35.46395 38.0 36.8 38.0 31.0 38.0 130-134 34.7077 38.0 35.6 38.0 26.2 38.0 135-139 34.439949999999996 38.0 35.0 38.0 25.4 38.0 140-144 34.221 38.0 35.0 38.0 24.2 38.0 145-149 33.61185 38.0 34.2 38.0 21.4 38.0 150-151 29.725125 36.0 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 1.0 5 0.0 6 4.0 7 0.0 8 3.0 9 1.0 10 1.0 11 0.0 12 3.0 13 2.0 14 2.0 15 3.0 16 4.0 17 7.0 18 5.0 19 1.0 20 3.0 21 8.0 22 9.0 23 13.0 24 16.0 25 20.0 26 17.0 27 23.0 28 38.0 29 37.0 30 39.0 31 55.0 32 76.0 33 100.0 34 158.0 35 245.0 36 560.0 37 2535.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.225 21.2 11.55 27.025 2 27.025 25.224999999999998 32.800000000000004 14.95 3 20.125 28.525 31.775 19.575 4 22.650000000000002 36.25 22.650000000000002 18.45 5 24.6 37.775 21.025 16.6 6 19.0 38.1 23.95 18.95 7 18.075 19.425 42.525 19.975 8 19.3 24.075 29.5 27.125 9 21.8 23.974999999999998 29.575000000000003 24.65 10-14 23.185 28.935 26.22 21.66 15-19 21.92 28.199999999999996 28.825 21.055 20-24 22.605 28.249999999999996 28.33 20.815 25-29 22.61 28.32 28.62 20.45 30-34 22.525000000000002 27.98 28.389999999999997 21.105 35-39 22.759999999999998 28.32 27.955000000000002 20.965 40-44 23.06 28.415000000000003 27.91 20.615 45-49 22.59 28.13 28.005000000000003 21.275 50-54 23.305 27.62 28.345 20.73 55-59 22.365 28.044999999999998 28.694999999999997 20.895 60-64 22.975 27.37 28.565 21.09 65-69 22.79 28.04 28.075 21.095 70-74 22.95 27.325 28.444999999999997 21.279999999999998 75-79 22.82 27.839999999999996 28.395 20.945 80-84 23.200000000000003 27.750000000000004 28.125 20.925 85-89 22.735 27.825 28.7 20.74 90-94 23.474999999999998 27.275 27.965 21.285 95-99 23.215 28.285 27.905 20.595 100-104 22.93 28.625 27.79 20.655 105-109 22.955000000000002 27.625 28.735 20.685000000000002 110-114 23.31 28.560000000000002 27.389999999999997 20.74 115-119 23.52 28.544999999999998 27.365000000000002 20.57 120-124 23.880000000000003 27.950000000000003 27.85 20.32 125-129 23.630000000000003 27.834999999999997 28.07 20.465 130-134 24.27 28.065 27.450000000000003 20.215 135-139 24.365000000000002 28.12 27.305 20.21 140-144 24.2 28.384999999999998 27.139999999999997 20.275000000000002 145-149 24.834999999999997 27.605 27.750000000000004 19.81 150-151 25.362499999999997 27.0875 27.9375 19.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.5 17 1.5 18 1.0 19 0.5 20 0.5 21 2.0 22 3.5 23 2.0 24 2.0 25 3.0 26 6.0 27 8.5 28 10.0 29 11.5 30 15.5 31 20.0 32 29.5 33 38.0 34 42.5 35 60.5 36 86.0 37 113.5 38 142.0 39 169.0 40 203.0 41 245.0 42 268.0 43 273.5 44 279.5 45 270.5 46 259.0 47 256.5 48 219.0 49 179.5 50 170.5 51 149.5 52 111.5 53 84.5 54 74.0 55 56.0 56 37.5 57 31.0 58 20.5 59 11.0 60 8.5 61 6.0 62 4.0 63 2.0 64 2.0 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 3.925 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.6625 0.0 0.0 0.0 0.0 138-139 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra Read 968328 spots for SRR7172454.sra Written 968328 spots for SRR7172454.sra Read 968316 spots for SRR7172454.sra Written 968316 spots for SRR7172454.sra SRR ids: ['SRR7172454.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eg6r5yki SRR7172454.sra spots: 19366332 blocks: [[1, 968316], [968317, 1936632], [1936633, 2904948], [2904949, 3873264], [3873265, 4841580], [4841581, 5809896], [5809897, 6778212], [6778213, 7746528], [7746529, 8714844], [8714845, 9683160], [9683161, 10651476], [10651477, 11619792], [11619793, 12588108], [12588109, 13556424], [13556425, 14524740], [14524741, 15493056], [15493057, 16461372], [16461373, 17429688], [17429689, 18398004], [18398005, 19366332]] SRR7172454 file size 6540914 SRR7172454 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172454 SRR7172454_1.fastq SRR7172454_2.fastq Input file: SRR7172454_1.fastq Paired file: SRR7172454_2.fastq trimmed: SRR7172454-trimmed-pair1.fastq, SRR7172454-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:03:58 2025 >> started Fri Feb 14 11:04:19 2025 >> done (20.983s) 19366332 read pairs processed; of these: 15985 ( 0.08%) short read pairs filtered out after trimming by size control 14585 ( 0.08%) empty read pairs filtered out after trimming by size control 19335762 (99.84%) read pairs available; of these: 9044096 (46.77%) trimmed read pairs available after processing 10291666 (53.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 13 0.00% 21 13 0.00% 22 6 0.00% 23 5 0.00% 24 13 0.00% 25 14 0.00% 26 7 0.00% 27 8 0.00% 28 10 0.00% 29 9 0.00% 30 17 0.00% 31 7 0.00% 32 6 0.00% 33 17 0.00% 34 17 0.00% 35 12 0.00% 36 16 0.00% 37 20 0.00% 38 25 0.00% 39 20 0.00% 40 21 0.00% 41 23 0.00% 42 28 0.00% 43 25 0.00% 44 34 0.00% 45 28 0.00% 46 22 0.00% 47 55 0.00% 48 44 0.00% 49 58 0.00% 50 62 0.00% 51 71 0.00% 52 89 0.00% 53 87 0.00% 54 95 0.00% 55 93 0.00% 56 122 0.00% 57 152 0.00% 58 148 0.00% 59 131 0.00% 60 215 0.00% 61 253 0.00% 62 280 0.00% 63 282 0.00% 64 343 0.00% 65 383 0.00% 66 423 0.00% 67 435 0.00% 68 584 0.00% 69 721 0.00% 70 801 0.00% 71 795 0.00% 72 923 0.00% 73 1022 0.01% 74 1090 0.01% 75 1234 0.01% 76 1425 0.01% 77 1582 0.01% 78 1672 0.01% 79 1892 0.01% 80 2136 0.01% 81 2482 0.01% 82 2741 0.01% 83 3146 0.02% 84 4182 0.02% 85 4923 0.03% 86 5199 0.03% 87 5498 0.03% 88 5845 0.03% 89 6365 0.03% 90 6759 0.03% 91 7186 0.04% 92 7737 0.04% 93 8406 0.04% 94 9055 0.05% 95 9499 0.05% 96 10241 0.05% 97 10751 0.06% 98 11218 0.06% 99 11799 0.06% 100 12723 0.07% 101 13203 0.07% 102 14283 0.07% 103 15129 0.08% 104 15506 0.08% 105 16707 0.09% 106 17718 0.09% 107 18436 0.10% 108 19362 0.10% 109 19979 0.10% 110 21290 0.11% 111 22596 0.12% 112 23661 0.12% 113 25137 0.13% 114 26431 0.14% 115 27880 0.14% 116 29486 0.15% 117 30736 0.16% 118 31812 0.16% 119 32946 0.17% 120 34321 0.18% 121 35965 0.19% 122 37117 0.19% 123 39243 0.20% 124 41618 0.22% 125 43041 0.22% 126 45589 0.24% 127 47506 0.25% 128 49382 0.26% 129 51711 0.27% 130 53739 0.28% 131 56749 0.29% 132 59799 0.31% 133 62792 0.32% 134 67262 0.35% 135 72017 0.37% 136 76626 0.40% 137 81956 0.42% 138 88128 0.46% 139 95982 0.50% 140 102921 0.53% 141 112564 0.58% 142 124156 0.64% 143 141305 0.73% 144 163114 0.84% 145 194310 1.00% 146 243575 1.26% 147 330593 1.71% 148 497154 2.57% 149 958203 4.96% 150 4447462 23.00% 151 10291666 53.23% 19335762 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=0.45 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=48.10 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.6 sequence=ACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=18 prefix-density=0.40 prefix-fanout=2.3 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=87.70 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.3 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATGTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7172454 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:05:39 Started mapping on | Feb 14 11:05:39 Finished on | Feb 14 11:07:37 Mapping speed, Million of reads per hour | 589.90 Number of input reads | 19335762 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18151174 Uniquely mapped reads % | 93.87% Average mapped length | 294.38 Number of splices: Total | 17523850 Number of splices: Annotated (sjdb) | 17119582 Number of splices: GT/AG | 17176069 Number of splices: GC/AG | 281455 Number of splices: AT/AC | 9448 Number of splices: Non-canonical | 56878 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 527579 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 60655 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.01% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 675180 675180 675180 N_multimapping 527579 527579 527579 N_noFeature 745900 17833526 917229 N_ambiguous 268802 1295 121648 UnstrandedReadsAssigned:17136472 PositiveStrandReadsAssigned:316353 NegativeStrandReadsAssigned:17112297 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172454 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172454-trimmed-pair1.fastq SRR7172454-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,335,762 reads, 17,069,171 reads pseudoaligned [quant] estimated average fragment length: 260.99 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR7172454.ke.tsv 34699 SRR7172454.se.tsv 87100 total ==> SRR7172454.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.01 600 19.9607 Potri.005G024800.1.v4.1 1035 775.01 102 7.6973 Potri.004G059700.1.v4.1 961 701.191 13 1.08431 Potri.007G009000.2.v4.1 1416 1156.01 0 0 Potri.003G141000.2.v4.1 2943 2683.01 1144.91 24.9571 Potri.016G087400.1.v4.1 270 78.2583 1001 748.082 Potri.015G069301.1.v4.1 564 315.393 0 0 Potri.010G195200.1.v4.1 1773 1513.01 66 2.55122 Potri.012G127500.1.v4.1 977 717.113 78 6.3614 ==> SRR7172454.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1025 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 278 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7172454 completed mapping pipeline successfully