Starting /dee2/code/volunteer_pipeline.sh SRR7172455 current disk space = 3116296040448 free memory = 1485495896 SRR7172455 SRAfilesize 34e0b6d8664b71f550035e4a68be4587 SRR7172455.sra SRR7172455.sra file validated SRR7172455 is paired end SRR7172455 is conventional basespace SRR7172455 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172455_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94325 34.0 33.0 34.0 33.0 34.0 2 33.44375 34.0 34.0 34.0 33.0 34.0 3 33.4665 34.0 34.0 34.0 33.0 34.0 4 33.49625 34.0 34.0 34.0 33.0 34.0 5 33.53325 34.0 34.0 34.0 33.0 34.0 6 37.2485 38.0 38.0 38.0 36.0 38.0 7 37.493 38.0 38.0 38.0 37.0 38.0 8 37.569 38.0 38.0 38.0 38.0 38.0 9 37.6465 38.0 38.0 38.0 38.0 38.0 10-14 37.60195 38.0 38.0 38.0 38.0 38.0 15-19 37.5774 38.0 38.0 38.0 38.0 38.0 20-24 37.56305 38.0 38.0 38.0 38.0 38.0 25-29 37.54774999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.55215 38.0 38.0 38.0 38.0 38.0 35-39 37.450450000000004 38.0 38.0 38.0 37.6 38.0 40-44 37.26635 38.0 38.0 38.0 37.0 38.0 45-49 37.1811 38.0 38.0 38.0 36.6 38.0 50-54 37.0434 38.0 38.0 38.0 36.0 38.0 55-59 37.0424 38.0 38.0 38.0 36.0 38.0 60-64 37.0187 38.0 38.0 38.0 36.0 38.0 65-69 36.949200000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.796350000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.675349999999995 38.0 38.0 38.0 34.6 38.0 80-84 36.5295 38.0 38.0 38.0 34.2 38.0 85-89 36.412099999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.347249999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.19655 38.0 37.4 38.0 33.4 38.0 100-104 35.942600000000006 38.0 37.0 38.0 33.0 38.0 105-109 35.7939 38.0 37.0 38.0 31.4 38.0 110-114 35.439949999999996 38.0 36.4 38.0 30.0 38.0 115-119 35.4806 38.0 36.2 38.0 31.0 38.0 120-124 35.1239 38.0 36.0 38.0 28.4 38.0 125-129 34.856449999999995 38.0 35.2 38.0 27.6 38.0 130-134 34.458749999999995 38.0 35.0 38.0 26.4 38.0 135-139 33.9321 38.0 34.2 38.0 23.2 38.0 140-144 33.20455 38.0 33.2 38.0 17.4 38.0 145-149 32.2279 38.0 32.4 38.0 11.2 38.0 150-151 27.675375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 5.0 17 6.0 18 2.0 19 5.0 20 5.0 21 8.0 22 8.0 23 10.0 24 8.0 25 18.0 26 22.0 27 26.0 28 37.0 29 42.0 30 43.0 31 63.0 32 88.0 33 116.0 34 164.0 35 300.0 36 806.0 37 2211.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.59775967413442 13.110997963340123 10.514256619144604 41.776985743380855 2 21.175 18.9 36.5 23.425 3 18.3 23.425 26.825 31.45 4 22.35 33.300000000000004 21.05 23.3 5 21.125 36.925000000000004 23.400000000000002 18.55 6 16.525000000000002 36.825 26.775 19.875 7 13.200000000000001 22.0 45.1 19.7 8 17.599999999999998 23.599999999999998 31.15 27.650000000000002 9 17.7 22.825 33.6 25.874999999999996 10-14 19.715 29.09 27.195000000000004 24.0 15-19 19.715 28.305000000000003 28.144999999999996 23.835 20-24 20.055 28.63 27.68 23.635 25-29 19.445 28.89 27.88 23.785 30-34 19.35 28.999999999999996 27.935 23.715 35-39 19.59 28.410000000000004 27.855 24.145 40-44 19.535 28.915000000000003 28.205000000000002 23.345 45-49 20.255000000000003 28.465 27.52 23.76 50-54 19.759999999999998 28.84 27.685 23.715 55-59 19.45 29.054999999999996 27.91 23.585 60-64 19.755 28.4 28.16 23.685000000000002 65-69 19.97 28.615000000000002 27.92 23.494999999999997 70-74 19.882982447367105 28.919337900685104 27.604140621093165 23.59353903085463 75-79 19.666966696669665 28.817881788178816 27.632763276327633 23.882388238823882 80-84 20.35305295794369 28.74431164674701 27.424113617042558 23.47852177826674 85-89 20.244999999999997 28.494999999999997 27.889999999999997 23.369999999999997 90-94 20.256012800640033 28.206410320516024 28.146407320366016 23.391169558477923 95-99 20.705000000000002 28.715000000000003 27.66 22.919999999999998 100-104 20.739702717581704 28.442019918922977 27.396026224913665 23.42225113858165 105-109 20.11002750687672 28.322080520130033 27.71692923230808 23.850962740685173 110-114 20.293484249010866 28.662292783092102 28.011218510542395 23.033004457354636 115-119 20.37407481496299 28.540708141628322 27.770554110822165 23.314662932586515 120-124 20.345 28.999999999999996 26.96 23.695 125-129 20.555 29.035 26.91 23.5 130-134 20.84 29.07 26.900000000000002 23.189999999999998 135-139 20.36 29.020000000000003 26.88 23.74 140-144 20.735 28.38 27.22 23.665 145-149 20.8 29.160000000000004 26.86 23.18 150-151 21.65 28.075 26.487500000000004 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.5 20 2.5 21 3.0 22 2.0 23 1.5 24 3.5 25 6.0 26 7.0 27 9.0 28 14.0 29 16.5 30 20.5 31 24.5 32 36.0 33 52.0 34 67.0 35 70.5 36 75.5 37 117.0 38 153.5 39 159.0 40 186.0 41 234.5 42 260.5 43 262.0 44 269.5 45 272.0 46 248.0 47 226.0 48 221.0 49 202.0 50 170.5 51 140.5 52 106.5 53 83.0 54 71.5 55 57.5 56 37.0 57 26.0 58 20.5 59 17.5 60 13.5 61 10.5 62 7.5 63 2.5 64 1.0 65 1.0 66 1.5 67 1.0 68 0.0 69 1.5 70 1.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7999999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 0.01 80-84 0.015 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.095 105-109 0.025 110-114 0.165 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.8499999999999996 0.0 0.0 0.0 0.0 118-119 3.15 0.0 0.0 0.0 0.0 120-121 3.5374999999999996 0.0 0.0 0.0 0.0 122-123 3.9250000000000003 0.0 0.0 0.0 0.0 124-125 4.300000000000001 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.7625 0.0 0.0 0.0 0.0 132-133 6.2875 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.375 0.0 0.0 0.0 0.0 138-139 7.925000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172455 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172455_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6985 33.0 33.0 34.0 32.0 34.0 2 32.851 34.0 33.0 34.0 32.0 34.0 3 32.85075 34.0 33.0 34.0 32.0 34.0 4 32.7335 34.0 33.0 34.0 32.0 34.0 5 32.7965 34.0 33.0 34.0 32.0 34.0 6 36.945 38.0 38.0 38.0 36.0 38.0 7 36.966 38.0 38.0 38.0 37.0 38.0 8 37.02325 38.0 38.0 38.0 37.0 38.0 9 36.974 38.0 38.0 38.0 37.0 38.0 10-14 37.0564 38.0 38.0 38.0 37.0 38.0 15-19 37.06855 38.0 38.0 38.0 37.0 38.0 20-24 37.0685 38.0 38.0 38.0 37.0 38.0 25-29 37.015 38.0 38.0 38.0 37.0 38.0 30-34 37.003699999999995 38.0 38.0 38.0 37.0 38.0 35-39 36.920249999999996 38.0 38.0 38.0 37.0 38.0 40-44 36.94585 38.0 38.0 38.0 37.0 38.0 45-49 36.908699999999996 38.0 38.0 38.0 36.8 38.0 50-54 36.888549999999995 38.0 38.0 38.0 36.8 38.0 55-59 36.853500000000004 38.0 38.0 38.0 36.4 38.0 60-64 36.766 38.0 38.0 38.0 36.0 38.0 65-69 36.621 38.0 38.0 38.0 36.0 38.0 70-74 36.6217 38.0 38.0 38.0 36.0 38.0 75-79 36.524300000000004 38.0 38.0 38.0 35.6 38.0 80-84 36.4541 38.0 38.0 38.0 35.0 38.0 85-89 36.4062 38.0 38.0 38.0 34.6 38.0 90-94 36.2408 38.0 38.0 38.0 34.0 38.0 95-99 36.07625 38.0 38.0 38.0 33.8 38.0 100-104 35.936099999999996 38.0 38.0 38.0 33.4 38.0 105-109 35.80585 38.0 38.0 38.0 33.0 38.0 110-114 35.592349999999996 38.0 37.8 38.0 31.8 38.0 115-119 35.3195 38.0 37.0 38.0 30.4 38.0 120-124 35.01995 38.0 36.6 38.0 28.0 38.0 125-129 34.795500000000004 38.0 36.0 38.0 27.2 38.0 130-134 34.48605 38.0 35.6 38.0 25.6 38.0 135-139 33.90635 38.0 34.0 38.0 22.8 38.0 140-144 33.20435 38.0 33.0 38.0 15.0 38.0 145-149 32.1979 38.0 33.0 38.0 10.8 38.0 150-151 27.831375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 4.0 4 0.0 5 3.0 6 0.0 7 3.0 8 2.0 9 4.0 10 0.0 11 4.0 12 2.0 13 1.0 14 2.0 15 3.0 16 6.0 17 4.0 18 3.0 19 7.0 20 10.0 21 13.0 22 11.0 23 15.0 24 20.0 25 14.0 26 21.0 27 30.0 28 35.0 29 31.0 30 47.0 31 59.0 32 66.0 33 97.0 34 145.0 35 211.0 36 545.0 37 2560.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.02640181040986 17.9029419160171 14.734724666834298 32.33593160673875 2 25.427565392354122 25.352112676056336 34.6327967806841 14.587525150905433 3 20.855345911949684 28.0251572327044 30.968553459119498 20.150943396226413 4 23.458343820790333 35.615403976843695 22.52705763906368 18.39919456330229 5 23.33249433677322 38.00654417316889 22.09916939340549 16.561792096652404 6 19.728575018848957 37.79844181955265 24.528776074390553 17.944207087207843 7 19.3815987933635 18.677727501256914 42.00603318250377 19.934640522875817 8 21.015585721468074 23.604826546003014 29.21065862242333 26.168929110105584 9 21.669180492709906 23.730517848164904 31.096028154851684 23.504273504273502 10-14 22.575780425275223 28.814155733172477 26.808425074146687 21.80163876740562 15-19 22.45010807821847 28.306439451063188 28.72869853717388 20.514753933544462 20-24 22.690258369357597 28.249723534734088 28.305016587915954 20.75500150799236 25-29 22.663985926112087 28.53983412917819 28.333752199044987 20.46242774566474 30-34 22.53103482937126 28.054480574961048 28.54199125496306 20.87249334070463 35-39 22.513194269917065 27.941693892937923 28.776074390550388 20.76903744659462 40-44 22.375829479187615 28.232455258395333 28.51397546752463 20.87773979489242 45-49 22.67471091000503 27.817998994469583 28.49673202614379 21.0105580693816 50-54 22.951231774761187 28.270487682252387 28.21015585721468 20.568124685771743 55-59 22.980648404121638 28.102538326212617 28.052274440814273 20.86453882885147 60-64 23.373881572333367 27.405247813411076 28.546295365436812 20.674575248818737 65-69 23.30082445204102 27.558817615121654 28.388296802734768 20.752061130102554 70-74 23.175145787251157 27.694550573094713 28.373215362959986 20.757088276694148 75-79 23.132602794812506 27.882778727254447 28.2899366643209 20.694681813612146 80-84 23.227752639517345 28.13976872800402 28.3911513323278 20.24132730015083 85-89 22.531671023527046 27.93585360949125 28.57932837321536 20.95314699376634 90-94 23.479135243841124 27.62694821518351 28.41628959276018 20.477626948215182 95-99 23.127199597787833 28.21015585721468 28.1649069884364 20.497737556561084 100-104 23.417626062038106 28.002614247649692 28.31431300588206 20.265446684430145 105-109 23.493037051933037 27.71102508672264 28.32939520386104 20.466542657483284 110-114 22.99416850995375 28.418459682284336 27.96601648904082 20.621355318721093 115-119 23.849982404102356 28.269066411945097 27.992559448997035 19.88839173495551 120-124 23.983310712310864 28.42708490423767 27.62780877695672 19.961795606494746 125-129 24.282338746166605 28.057915640239305 27.705997687396312 19.953747926197778 130-134 24.650648436714587 27.80737910927918 27.52588720217151 20.016085251834724 135-139 24.910781603417945 28.14274943453129 27.42397587333501 19.52249308871576 140-144 25.206113010255375 27.719686306052683 27.337623165091497 19.73657751860044 145-149 25.44494720965309 28.134741075917546 27.229763700351935 19.19054801407743 150-151 24.87430869783811 28.720462543991953 27.023629964806435 19.3815987933635 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 20.0 1 10.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 2.5 22 2.0 23 2.0 24 3.0 25 6.5 26 10.5 27 10.0 28 10.0 29 13.5 30 21.0 31 27.5 32 26.5 33 40.5 34 58.0 35 73.5 36 94.0 37 120.5 38 143.0 39 164.0 40 196.0 41 227.5 42 261.5 43 286.0 44 275.5 45 257.0 46 252.5 47 238.0 48 216.5 49 197.5 50 158.5 51 117.5 52 91.5 53 81.0 54 79.5 55 59.5 56 44.0 57 31.0 58 16.5 59 12.5 60 14.0 61 11.5 62 7.0 63 3.5 64 2.5 65 2.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.6 3 0.625 4 0.675 5 0.675 6 0.525 7 0.5499999999999999 8 0.5499999999999999 9 0.5499999999999999 10-14 0.5349999999999999 15-19 0.5349999999999999 20-24 0.53 25-29 0.525 30-34 0.515 35-39 0.525 40-44 0.54 45-49 0.5499999999999999 50-54 0.5499999999999999 55-59 0.525 60-64 0.53 65-69 0.54 70-74 0.54 75-79 0.53 80-84 0.5499999999999999 85-89 0.54 90-94 0.5499999999999999 95-99 0.5499999999999999 100-104 0.545 105-109 0.545 110-114 0.54 115-119 0.545 120-124 0.5349999999999999 125-129 0.545 130-134 0.53 135-139 0.525 140-144 0.54 145-149 0.5499999999999999 150-151 0.5499999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44430411720131 98.425 2 0.5051780752715332 1.0 3 0.0 0.0 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025258903763576663 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 19 0.475 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.8375 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.5 0.0 0.0 0.0 0.0 128-129 5.1 0.0 0.0 0.0 0.0 130-131 5.6125 0.0 0.0 0.0 0.0 132-133 6.1625 0.0 0.0 0.0 0.0 134-135 6.85 0.0 0.0 0.0 0.0 136-137 7.25 0.0 0.0 0.0 0.0 138-139 7.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCTCAC 10 0.006830828 145.0 3 ACAATCT 10 0.006830828 145.0 3 >>END_MODULE Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834071 spots for SRR7172455.sra Written 834071 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra Read 834064 spots for SRR7172455.sra Written 834064 spots for SRR7172455.sra SRR ids: ['SRR7172455.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uafg04ve SRR7172455.sra spots: 16681287 blocks: [[1, 834064], [834065, 1668128], [1668129, 2502192], [2502193, 3336256], [3336257, 4170320], [4170321, 5004384], [5004385, 5838448], [5838449, 6672512], [6672513, 7506576], [7506577, 8340640], [8340641, 9174704], [9174705, 10008768], [10008769, 10842832], [10842833, 11676896], [11676897, 12510960], [12510961, 13345024], [13345025, 14179088], [14179089, 15013152], [15013153, 15847216], [15847217, 16681287]] SRR7172455 file size 5631040 SRR7172455 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172455 SRR7172455_1.fastq SRR7172455_2.fastq Input file: SRR7172455_1.fastq Paired file: SRR7172455_2.fastq trimmed: SRR7172455-trimmed-pair1.fastq, SRR7172455-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:46:54 2025 >> started Fri Feb 14 09:47:14 2025 >> done (19.951s) 16681287 read pairs processed; of these: 16106 ( 0.10%) short read pairs filtered out after trimming by size control 103840 ( 0.62%) empty read pairs filtered out after trimming by size control 16561341 (99.28%) read pairs available; of these: 8769898 (52.95%) trimmed read pairs available after processing 7791443 (47.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 7 0.00% 21 4 0.00% 22 6 0.00% 23 4 0.00% 24 5 0.00% 25 4 0.00% 26 8 0.00% 27 6 0.00% 28 7 0.00% 29 9 0.00% 30 9 0.00% 31 5 0.00% 32 13 0.00% 33 7 0.00% 34 14 0.00% 35 13 0.00% 36 14 0.00% 37 16 0.00% 38 23 0.00% 39 18 0.00% 40 13 0.00% 41 30 0.00% 42 25 0.00% 43 29 0.00% 44 29 0.00% 45 32 0.00% 46 42 0.00% 47 56 0.00% 48 61 0.00% 49 64 0.00% 50 76 0.00% 51 100 0.00% 52 106 0.00% 53 100 0.00% 54 126 0.00% 55 159 0.00% 56 180 0.00% 57 163 0.00% 58 191 0.00% 59 228 0.00% 60 294 0.00% 61 335 0.00% 62 348 0.00% 63 413 0.00% 64 432 0.00% 65 507 0.00% 66 578 0.00% 67 646 0.00% 68 817 0.00% 69 927 0.01% 70 1109 0.01% 71 1153 0.01% 72 1213 0.01% 73 1400 0.01% 74 1606 0.01% 75 1714 0.01% 76 1953 0.01% 77 2126 0.01% 78 2337 0.01% 79 2639 0.02% 80 2990 0.02% 81 3354 0.02% 82 3886 0.02% 83 4429 0.03% 84 5465 0.03% 85 6194 0.04% 86 6712 0.04% 87 7069 0.04% 88 7676 0.05% 89 8386 0.05% 90 8917 0.05% 91 9741 0.06% 92 10491 0.06% 93 11918 0.07% 94 12536 0.08% 95 13322 0.08% 96 13697 0.08% 97 14767 0.09% 98 15257 0.09% 99 16022 0.10% 100 17081 0.10% 101 18000 0.11% 102 19040 0.11% 103 20407 0.12% 104 21437 0.13% 105 22974 0.14% 106 23872 0.14% 107 25128 0.15% 108 26137 0.16% 109 27349 0.17% 110 28517 0.17% 111 29447 0.18% 112 31140 0.19% 113 32675 0.20% 114 34328 0.21% 115 35493 0.21% 116 37420 0.23% 117 38175 0.23% 118 40080 0.24% 119 40727 0.25% 120 42344 0.26% 121 44059 0.27% 122 45324 0.27% 123 47779 0.29% 124 49765 0.30% 125 51342 0.31% 126 53734 0.32% 127 55831 0.34% 128 57627 0.35% 129 59473 0.36% 130 61956 0.37% 131 64073 0.39% 132 66995 0.40% 133 70112 0.42% 134 73937 0.45% 135 77921 0.47% 136 82249 0.50% 137 87149 0.53% 138 91277 0.55% 139 98855 0.60% 140 104285 0.63% 141 112792 0.68% 142 124191 0.75% 143 139327 0.84% 144 162062 0.98% 145 189930 1.15% 146 235057 1.42% 147 313965 1.90% 148 468741 2.83% 149 906131 5.47% 150 3954804 23.88% 151 7791443 47.05% 16561341 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=35 prefix-density=0.25 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=478.26 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=19.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=27 prefix-density=0.42 prefix-fanout=2.0 sequence=TTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=26.13 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.7 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7172455 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:48:23 Started mapping on | Feb 14 09:48:23 Finished on | Feb 14 09:51:22 Mapping speed, Million of reads per hour | 333.08 Number of input reads | 16561341 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15507736 Uniquely mapped reads % | 93.64% Average mapped length | 291.97 Number of splices: Total | 14332577 Number of splices: Annotated (sjdb) | 13964754 Number of splices: GT/AG | 14060900 Number of splices: GC/AG | 207842 Number of splices: AT/AC | 8915 Number of splices: Non-canonical | 54920 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505840 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 99618 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.55% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 561245 561245 561245 N_multimapping 505840 505840 505840 N_noFeature 676344 15227549 829258 N_ambiguous 266063 1340 137865 UnstrandedReadsAssigned:14565329 PositiveStrandReadsAssigned:278847 NegativeStrandReadsAssigned:14540613 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172455 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172455-trimmed-pair1.fastq SRR7172455-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,561,341 reads, 14,585,547 reads pseudoaligned [quant] estimated average fragment length: 238.304 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR7172455.ke.tsv 34699 SRR7172455.se.tsv 87100 total ==> SRR7172455.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.7 1672 63.4872 Potri.005G024800.1.v4.1 1035 797.696 601 50.9421 Potri.004G059700.1.v4.1 961 723.79 5 0.467086 Potri.007G009000.2.v4.1 1416 1178.7 0 0 Potri.003G141000.2.v4.1 2943 2705.7 730.373 18.2518 Potri.016G087400.1.v4.1 270 86.3588 841 658.459 Potri.015G069301.1.v4.1 564 334.055 0 0 Potri.010G195200.1.v4.1 1773 1535.7 1230.97 54.198 Potri.012G127500.1.v4.1 977 739.744 136 12.4307 ==> SRR7172455.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 592 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 321 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7172455 completed mapping pipeline successfully