Starting /dee2/code/volunteer_pipeline.sh SRR7172456 current disk space = 3114946359296 free memory = 1566943924 SRR7172456 SRAfilesize 2cb3ede4509458ce1bc37c773fb4f1ea SRR7172456.sra SRR7172456.sra file validated SRR7172456 is paired end SRR7172456 is conventional basespace SRR7172456 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172456_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15425 34.0 33.0 34.0 33.0 34.0 2 33.453 34.0 34.0 34.0 33.0 34.0 3 33.483 34.0 34.0 34.0 33.0 34.0 4 33.55475 34.0 34.0 34.0 33.0 34.0 5 33.553 34.0 34.0 34.0 33.0 34.0 6 37.29275 38.0 38.0 38.0 36.0 38.0 7 37.552 38.0 38.0 38.0 37.0 38.0 8 37.538 38.0 38.0 38.0 38.0 38.0 9 37.58675 38.0 38.0 38.0 38.0 38.0 10-14 37.5239 38.0 38.0 38.0 38.0 38.0 15-19 37.5733 38.0 38.0 38.0 38.0 38.0 20-24 37.55675 38.0 38.0 38.0 38.0 38.0 25-29 37.50125 38.0 38.0 38.0 37.8 38.0 30-34 37.456050000000005 38.0 38.0 38.0 37.8 38.0 35-39 37.425599999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.3129 38.0 38.0 38.0 37.0 38.0 45-49 37.1916 38.0 38.0 38.0 36.8 38.0 50-54 37.10085 38.0 38.0 38.0 36.0 38.0 55-59 37.1148 38.0 38.0 38.0 36.2 38.0 60-64 37.073249999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.95269999999999 38.0 38.0 38.0 35.8 38.0 70-74 36.92 38.0 38.0 38.0 35.8 38.0 75-79 36.7397 38.0 38.0 38.0 35.0 38.0 80-84 36.673350000000006 38.0 38.0 38.0 35.0 38.0 85-89 36.6688 38.0 38.0 38.0 34.8 38.0 90-94 36.42645 38.0 38.0 38.0 34.0 38.0 95-99 36.3001 38.0 38.0 38.0 34.0 38.0 100-104 36.04375 38.0 37.6 38.0 33.0 38.0 105-109 35.89325 38.0 37.0 38.0 32.2 38.0 110-114 35.635400000000004 38.0 37.0 38.0 31.0 38.0 115-119 35.727199999999996 38.0 37.0 38.0 31.0 38.0 120-124 35.49005 38.0 36.4 38.0 30.2 38.0 125-129 35.1009 38.0 36.0 38.0 28.6 38.0 130-134 34.85385 38.0 35.6 38.0 27.8 38.0 135-139 34.4643 38.0 35.2 38.0 25.2 38.0 140-144 33.86305 38.0 34.2 38.0 22.8 38.0 145-149 32.847699999999996 38.0 33.2 38.0 14.8 38.0 150-151 28.581 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 3.0 15 0.0 16 1.0 17 1.0 18 6.0 19 5.0 20 5.0 21 7.0 22 13.0 23 7.0 24 13.0 25 22.0 26 22.0 27 26.0 28 31.0 29 40.0 30 67.0 31 54.0 32 54.0 33 96.0 34 134.0 35 266.0 36 660.0 37 2464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.72187104930468 14.33628318584071 9.759797724399494 36.18204804045512 2 20.775 19.25 35.55 24.425 3 19.75 24.375 27.500000000000004 28.375 4 21.85 32.7 22.725 22.725 5 21.224999999999998 37.95 22.95 17.875 6 18.3 36.7 26.75 18.25 7 13.125 22.3 44.025 20.549999999999997 8 17.224999999999998 24.15 31.525 27.1 9 16.775000000000002 23.849999999999998 32.675 26.700000000000003 10-14 19.435 29.345 27.534999999999997 23.685000000000002 15-19 20.095 28.595 27.275 24.035 20-24 20.29 28.87 27.1 23.74 25-29 19.555 28.43 28.360000000000003 23.655 30-34 20.044999999999998 29.065 26.97 23.919999999999998 35-39 19.73 28.375 28.345 23.549999999999997 40-44 20.205000000000002 28.970000000000002 27.32 23.505000000000003 45-49 20.055 28.27 27.794999999999998 23.880000000000003 50-54 20.215 29.225 27.284999999999997 23.275000000000002 55-59 20.74 28.410000000000004 27.450000000000003 23.400000000000002 60-64 19.78 28.544999999999998 27.529999999999998 24.145 65-69 19.85 28.615000000000002 27.76 23.775 70-74 20.305 28.575 27.544999999999998 23.575 75-79 20.575 28.18 27.694999999999997 23.549999999999997 80-84 20.62 28.53 27.075 23.775 85-89 20.74 28.37 26.729999999999997 24.16 90-94 20.72 28.335 27.35 23.595 95-99 20.645 28.365000000000002 27.08 23.91 100-104 20.722614222088776 28.64434769554121 26.597607966771758 24.03543011559826 105-109 20.955 28.634999999999998 26.784999999999997 23.625 110-114 20.623308948792467 27.893576510672414 27.487724220863814 23.99539031967131 115-119 21.235 28.895 26.590000000000003 23.28 120-124 21.05 29.035 26.345000000000002 23.57 125-129 21.43 28.26 26.435 23.875 130-134 21.215 28.655 26.515 23.615 135-139 21.54 27.915 26.055 24.490000000000002 140-144 21.085 28.115000000000002 26.435 24.365000000000002 145-149 21.025 28.15 25.91 24.915000000000003 150-151 20.849999999999998 27.975 27.0625 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 4.0 25 5.5 26 4.5 27 6.0 28 8.0 29 15.5 30 21.0 31 31.5 32 36.0 33 41.5 34 65.0 35 82.5 36 106.5 37 129.5 38 143.5 39 166.0 40 193.5 41 204.0 42 219.5 43 249.0 44 243.0 45 238.5 46 245.0 47 231.5 48 218.0 49 185.5 50 166.0 51 144.0 52 113.0 53 100.5 54 86.5 55 76.0 56 55.5 57 41.5 58 34.0 59 28.0 60 22.5 61 12.5 62 7.0 63 6.0 64 3.5 65 0.5 66 0.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08499999999999999 105-109 0.0 110-114 0.21 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11616161616162 98.125 2 0.7575757575757576 1.5 3 0.12626262626262627 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.23750000000000002 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9875 0.0 0.0 0.0 0.0 94-95 1.1749999999999998 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.5125 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.475 0.0 0.0 0.0 0.0 106-107 2.8375000000000004 0.0 0.0 0.0 0.0 108-109 3.175 0.0 0.0 0.0 0.0 110-111 3.6375 0.0 0.0 0.0 0.0 112-113 4.075 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 4.8875 0.0 0.0 0.0 0.0 118-119 5.3125 0.0 0.0 0.0 0.0 120-121 5.7625 0.0 0.0 0.0 0.0 122-123 6.262499999999999 0.0 0.0 0.0 0.0 124-125 6.925 0.0 0.0 0.0 0.0 126-127 7.574999999999999 0.0 0.0 0.0 0.0 128-129 8.125 0.0 0.0 0.0 0.0 130-131 8.8375 0.0 0.0 0.0 0.0 132-133 9.375 0.0 0.0 0.0 0.0 134-135 10.0 0.0 0.0 0.0 0.0 136-137 10.775 0.0 0.0 0.0 0.0 138-139 11.475000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172456 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172456_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60425 33.0 33.0 34.0 32.0 34.0 2 32.68475 34.0 33.0 34.0 32.0 34.0 3 32.764 34.0 33.0 34.0 32.0 34.0 4 32.60725 34.0 33.0 34.0 32.0 34.0 5 32.53575 34.0 33.0 34.0 32.0 34.0 6 36.72725 38.0 38.0 38.0 36.0 38.0 7 36.76325 38.0 38.0 38.0 36.0 38.0 8 36.78475 38.0 38.0 38.0 36.0 38.0 9 36.7785 38.0 38.0 38.0 36.0 38.0 10-14 36.75795000000001 38.0 38.0 38.0 36.8 38.0 15-19 36.766999999999996 38.0 38.0 38.0 37.0 38.0 20-24 36.71444999999999 38.0 38.0 38.0 36.6 38.0 25-29 36.74795 38.0 38.0 38.0 36.8 38.0 30-34 36.674099999999996 38.0 38.0 38.0 36.2 38.0 35-39 36.60875 38.0 38.0 38.0 36.0 38.0 40-44 36.660700000000006 38.0 38.0 38.0 36.0 38.0 45-49 36.62105 38.0 38.0 38.0 36.0 38.0 50-54 36.55185 38.0 38.0 38.0 36.0 38.0 55-59 36.43879999999999 38.0 38.0 38.0 35.8 38.0 60-64 36.387649999999994 38.0 38.0 38.0 35.4 38.0 65-69 36.3632 38.0 38.0 38.0 35.4 38.0 70-74 36.37545 38.0 38.0 38.0 35.6 38.0 75-79 36.072649999999996 38.0 38.0 38.0 34.2 38.0 80-84 36.1498 38.0 38.0 38.0 34.4 38.0 85-89 36.08315 38.0 38.0 38.0 34.0 38.0 90-94 35.8266 38.0 38.0 38.0 33.6 38.0 95-99 35.6885 38.0 38.0 38.0 32.6 38.0 100-104 35.62305 38.0 38.0 38.0 32.8 38.0 105-109 35.2884 38.0 37.6 38.0 29.8 38.0 110-114 35.2714 38.0 37.6 38.0 30.2 38.0 115-119 35.05235 38.0 37.0 38.0 28.6 38.0 120-124 34.8857 38.0 37.0 38.0 28.2 38.0 125-129 34.5952 38.0 36.2 38.0 26.8 38.0 130-134 34.16995 38.0 35.8 38.0 23.6 38.0 135-139 33.60145 38.0 34.8 38.0 19.6 38.0 140-144 32.78705 38.0 33.6 38.0 13.4 38.0 145-149 32.10165 38.0 33.0 38.0 6.4 38.0 150-151 27.8765 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 12.0 4 3.0 5 4.0 6 0.0 7 6.0 8 2.0 9 3.0 10 5.0 11 1.0 12 2.0 13 7.0 14 4.0 15 3.0 16 6.0 17 11.0 18 7.0 19 6.0 20 15.0 21 11.0 22 8.0 23 13.0 24 14.0 25 29.0 26 20.0 27 29.0 28 34.0 29 43.0 30 37.0 31 54.0 32 79.0 33 72.0 34 133.0 35 206.0 36 503.0 37 2584.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.8639798488665 20.503778337531486 13.85390428211587 23.778337531486144 2 26.82619647355164 24.911838790931988 30.982367758186395 17.279596977329977 3 21.486146095717885 27.68261964735516 31.46095717884131 19.370277078085643 4 23.645071842702293 34.73657675825561 23.266952356944795 18.351399042097302 5 24.32568691706579 35.845727249810935 22.23342576254096 17.595160070582306 6 19.491951710261567 37.726358148893354 24.295774647887324 18.485915492957748 7 19.693158953722335 18.259557344064387 41.398390342052316 20.648893360160965 8 21.151911468812877 24.72334004024145 27.515090543259557 26.609657947686117 9 22.56036217303823 24.119718309859156 29.904426559356136 23.41549295774648 10-14 23.805211791930777 28.53405775228896 26.295401951906634 21.36532850387363 15-19 23.10207777833677 27.826130703828543 27.98712079287619 21.084670724958496 20-24 23.703405603903615 27.939031138387243 27.420896423361334 20.936666834347804 25-29 23.70221327967807 27.847082494969822 27.540241448692154 20.910462776659962 30-34 23.264587525150908 27.711267605633804 27.977867203219315 21.046277665995976 35-39 23.470824949698187 27.655935613682093 27.449698189134807 21.42354124748491 40-44 23.27816068823263 27.951904210897016 28.127987120792874 20.641947980077475 45-49 22.740994163815657 27.691688468504726 28.41114912457235 21.156168243107267 50-54 23.181406580138848 28.43847469564342 27.306570077472582 21.073548646745145 55-59 23.787726358148895 27.44466800804829 28.169014084507044 20.598591549295776 60-64 23.445674044265594 28.52112676056338 27.354124748490943 20.67907444668008 65-69 23.163983903420522 27.66599597585513 27.847082494969822 21.322937625754527 70-74 23.060670087533957 27.784485360700273 27.49270550357179 21.662139048193986 75-79 23.504553000955877 27.307943854706444 27.7556975398702 21.431805604467474 80-84 23.572327044025158 27.46666666666667 27.361006289308175 21.6 85-89 23.390018112296236 27.43006641175287 27.777218756288992 21.402696719661904 90-94 24.003623188405797 27.727455716586153 27.465780998389693 20.803140096618357 95-99 24.066243833685693 27.08647941206081 28.19893285009564 20.648343904157855 100-104 23.893137452203664 26.896759911450996 28.385993157576976 20.824109478768364 105-109 24.18616352201258 27.29559748427673 28.196226415094337 20.322012578616352 110-114 24.627691688468506 27.877842624270478 27.842624270476957 19.65184141678406 115-119 24.443997182248165 27.81020428700815 27.73976049109389 20.00603803964979 120-124 24.66670020626855 27.51421240629874 27.97705891231071 19.842028475122 125-129 25.264111077573197 27.20595633363517 27.512828252339272 20.01710433645236 130-134 25.387323943661972 27.78672032193159 26.94164989939638 19.88430583501006 135-139 25.603621730382294 27.27364185110664 27.30885311871227 19.813883299798793 140-144 25.734702093397743 27.747584541062803 27.133655394524958 19.384057971014492 145-149 25.896855345911952 28.357232704402513 26.70691823899371 19.038993710691823 150-151 25.484276729559745 28.125786163522015 27.59748427672956 18.79245283018868 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 24.0 1 12.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 1.0 22 0.5 23 3.0 24 4.0 25 5.0 26 5.0 27 5.5 28 11.5 29 15.0 30 17.5 31 20.5 32 25.5 33 33.5 34 48.0 35 72.5 36 84.0 37 94.5 38 109.5 39 142.5 40 184.5 41 207.0 42 223.5 43 234.5 44 260.0 45 276.5 46 267.5 47 239.0 48 212.0 49 213.5 50 191.0 51 146.5 52 121.5 53 108.5 54 97.5 55 74.0 56 54.0 57 39.0 58 22.5 59 23.0 60 26.5 61 17.0 62 10.5 63 8.0 64 3.5 65 3.0 66 2.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.75 3 0.75 4 0.8250000000000001 5 0.8250000000000001 6 0.6 7 0.6 8 0.6 9 0.6 10-14 0.61 15-19 0.615 20-24 0.605 25-29 0.6 30-34 0.6 35-39 0.6 40-44 0.615 45-49 0.62 50-54 0.61 55-59 0.6 60-64 0.6 65-69 0.6 70-74 0.61 75-79 0.615 80-84 0.625 85-89 0.62 90-94 0.64 95-99 0.67 100-104 0.62 105-109 0.625 110-114 0.62 115-119 0.63 120-124 0.615 125-129 0.61 130-134 0.6 135-139 0.6 140-144 0.64 145-149 0.625 150-151 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98322318251144 97.35000000000001 2 0.9150991357397051 1.7999999999999998 3 0.05083884087442806 0.15 4 0.02541942043721403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02541942043721403 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 24 0.6 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.9624999999999999 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.4375 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.425 0.0 0.0 0.0 0.0 106-107 2.7874999999999996 0.0 0.0 0.0 0.0 108-109 3.125 0.0 0.0 0.0 0.0 110-111 3.5875000000000004 0.0 0.0 0.0 0.0 112-113 4.0375 0.0 0.0 0.0 0.0 114-115 4.6 0.0 0.0 0.0 0.0 116-117 4.8875 0.0 0.0 0.0 0.0 118-119 5.275 0.0 0.0 0.0 0.0 120-121 5.7625 0.0 0.0 0.0 0.0 122-123 6.2875 0.0 0.0 0.0 0.0 124-125 6.9125 0.0 0.0 0.0 0.0 126-127 7.625 0.0 0.0 0.0 0.0 128-129 8.2 0.0 0.0 0.0 0.0 130-131 8.8875 0.0 0.0 0.0 0.0 132-133 9.375 0.0 0.0 0.0 0.0 134-135 9.9375 0.0 0.0 0.0 0.0 136-137 10.75 0.0 0.0 0.0 0.0 138-139 11.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704332 spots for SRR7172456.sra Written 704332 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra Read 704323 spots for SRR7172456.sra Written 704323 spots for SRR7172456.sra SRR ids: ['SRR7172456.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kgbe4yy4 SRR7172456.sra spots: 14086469 blocks: [[1, 704323], [704324, 1408646], [1408647, 2112969], [2112970, 2817292], [2817293, 3521615], [3521616, 4225938], [4225939, 4930261], [4930262, 5634584], [5634585, 6338907], [6338908, 7043230], [7043231, 7747553], [7747554, 8451876], [8451877, 9156199], [9156200, 9860522], [9860523, 10564845], [10564846, 11269168], [11269169, 11973491], [11973492, 12677814], [12677815, 13382137], [13382138, 14086469]] SRR7172456 file size 4751741 SRR7172456 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172456 SRR7172456_1.fastq SRR7172456_2.fastq Input file: SRR7172456_1.fastq Paired file: SRR7172456_2.fastq trimmed: SRR7172456-trimmed-pair1.fastq, SRR7172456-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:52:38 2025 >> started Fri Feb 14 10:52:53 2025 >> done (14.942s) 14086469 read pairs processed; of these: 25096 ( 0.18%) short read pairs filtered out after trimming by size control 108957 ( 0.77%) empty read pairs filtered out after trimming by size control 13952416 (99.05%) read pairs available; of these: 7803776 (55.93%) trimmed read pairs available after processing 6148640 (44.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 8 0.00% 21 3 0.00% 22 7 0.00% 23 13 0.00% 24 7 0.00% 25 8 0.00% 26 9 0.00% 27 13 0.00% 28 7 0.00% 29 8 0.00% 30 16 0.00% 31 14 0.00% 32 16 0.00% 33 21 0.00% 34 8 0.00% 35 26 0.00% 36 16 0.00% 37 30 0.00% 38 35 0.00% 39 41 0.00% 40 39 0.00% 41 54 0.00% 42 66 0.00% 43 58 0.00% 44 61 0.00% 45 69 0.00% 46 92 0.00% 47 122 0.00% 48 118 0.00% 49 145 0.00% 50 177 0.00% 51 191 0.00% 52 242 0.00% 53 230 0.00% 54 271 0.00% 55 321 0.00% 56 296 0.00% 57 373 0.00% 58 405 0.00% 59 505 0.00% 60 594 0.00% 61 713 0.01% 62 807 0.01% 63 884 0.01% 64 1032 0.01% 65 1159 0.01% 66 1433 0.01% 67 1947 0.01% 68 2266 0.02% 69 2723 0.02% 70 2952 0.02% 71 2694 0.02% 72 2982 0.02% 73 3229 0.02% 74 3523 0.03% 75 3715 0.03% 76 4122 0.03% 77 4481 0.03% 78 4890 0.04% 79 5616 0.04% 80 6126 0.04% 81 6797 0.05% 82 7693 0.06% 83 8543 0.06% 84 10384 0.07% 85 11470 0.08% 86 11807 0.08% 87 12235 0.09% 88 13250 0.09% 89 13815 0.10% 90 14649 0.10% 91 15887 0.11% 92 16763 0.12% 93 18778 0.13% 94 19295 0.14% 95 20354 0.15% 96 20426 0.15% 97 21225 0.15% 98 21298 0.15% 99 22437 0.16% 100 23777 0.17% 101 23922 0.17% 102 25855 0.19% 103 27263 0.20% 104 28478 0.20% 105 30472 0.22% 106 30719 0.22% 107 31203 0.22% 108 32037 0.23% 109 33852 0.24% 110 34492 0.25% 111 34878 0.25% 112 36618 0.26% 113 38799 0.28% 114 39892 0.29% 115 41799 0.30% 116 43001 0.31% 117 43054 0.31% 118 44494 0.32% 119 45232 0.32% 120 46336 0.33% 121 47159 0.34% 122 49005 0.35% 123 50988 0.37% 124 53670 0.38% 125 54788 0.39% 126 56555 0.41% 127 57828 0.41% 128 59397 0.43% 129 61456 0.44% 130 62938 0.45% 131 63866 0.46% 132 66860 0.48% 133 69709 0.50% 134 73022 0.52% 135 76702 0.55% 136 79630 0.57% 137 84309 0.60% 138 88606 0.64% 139 93844 0.67% 140 97405 0.70% 141 105448 0.76% 142 113138 0.81% 143 125103 0.90% 144 141763 1.02% 145 162973 1.17% 146 196609 1.41% 147 257598 1.85% 148 382640 2.74% 149 717358 5.14% 150 3168086 22.71% 151 6148640 44.07% 13952416 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=16 prefix-density=0.55 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=58.32 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=31 prefix-density=0.41 prefix-fanout=1.9 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=86.58 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=3.8 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR7172456 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:53:58 Started mapping on | Feb 14 10:53:59 Finished on | Feb 14 10:56:12 Mapping speed, Million of reads per hour | 377.66 Number of input reads | 13952416 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12766532 Uniquely mapped reads % | 91.50% Average mapped length | 288.90 Number of splices: Total | 11346778 Number of splices: Annotated (sjdb) | 11080761 Number of splices: GT/AG | 11105064 Number of splices: GC/AG | 198909 Number of splices: AT/AC | 7605 Number of splices: Non-canonical | 35200 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 345722 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 78189 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.29% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 860127 860127 860127 N_multimapping 345722 345722 345722 N_noFeature 507165 12539211 613224 N_ambiguous 215028 1011 93148 UnstrandedReadsAssigned:12044339 PositiveStrandReadsAssigned:226310 NegativeStrandReadsAssigned:12060160 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7172456 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172456-trimmed-pair1.fastq SRR7172456-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,952,416 reads, 12,100,750 reads pseudoaligned [quant] estimated average fragment length: 224.759 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR7172456.ke.tsv 34699 SRR7172456.se.tsv 87100 total ==> SRR7172456.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.24 590 26.1831 Potri.005G024800.1.v4.1 1035 811.241 157 15.4099 Potri.004G059700.1.v4.1 961 737.353 17 1.83579 Potri.007G009000.2.v4.1 1416 1192.24 0 0 Potri.003G141000.2.v4.1 2943 2719.24 910.108 26.6498 Potri.016G087400.1.v4.1 270 93.0584 645 551.891 Potri.015G069301.1.v4.1 564 345.85 0 0 Potri.010G195200.1.v4.1 1773 1549.24 21 1.07932 Potri.012G127500.1.v4.1 977 753.313 133 14.0581 ==> SRR7172456.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 853 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 252 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR7172456 completed mapping pipeline successfully