Starting /dee2/code/volunteer_pipeline.sh SRR7172457 current disk space = 3115232641024 free memory = 1572810504 SRR7172457 SRAfilesize c32c513fa49893dc448ffbe6c6ec1347 SRR7172457.sra SRR7172457.sra file validated SRR7172457 is paired end SRR7172457 is conventional basespace SRR7172457 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172457_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9765 34.0 34.0 34.0 33.0 34.0 2 33.44075 34.0 34.0 34.0 33.0 34.0 3 33.4235 34.0 34.0 34.0 33.0 34.0 4 33.50875 34.0 34.0 34.0 33.0 34.0 5 33.57525 34.0 34.0 34.0 33.0 34.0 6 37.254 38.0 38.0 38.0 36.0 38.0 7 37.505 38.0 38.0 38.0 37.0 38.0 8 37.53225 38.0 38.0 38.0 38.0 38.0 9 37.55675 38.0 38.0 38.0 38.0 38.0 10-14 37.5464 38.0 38.0 38.0 38.0 38.0 15-19 37.52605 38.0 38.0 38.0 38.0 38.0 20-24 37.57325 38.0 38.0 38.0 38.0 38.0 25-29 37.5388 38.0 38.0 38.0 38.0 38.0 30-34 37.52305 38.0 38.0 38.0 38.0 38.0 35-39 37.4832 38.0 38.0 38.0 37.6 38.0 40-44 37.3529 38.0 38.0 38.0 37.0 38.0 45-49 37.277750000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.1129 38.0 38.0 38.0 36.0 38.0 55-59 37.1198 38.0 38.0 38.0 36.0 38.0 60-64 37.1329 38.0 38.0 38.0 36.0 38.0 65-69 36.99979999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.97815 38.0 38.0 38.0 35.8 38.0 75-79 36.78375 38.0 38.0 38.0 35.2 38.0 80-84 36.73285 38.0 38.0 38.0 35.0 38.0 85-89 36.752250000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.5157 38.0 38.0 38.0 34.0 38.0 95-99 36.4196 38.0 37.8 38.0 33.8 38.0 100-104 36.245799999999996 38.0 37.6 38.0 33.8 38.0 105-109 36.01890000000001 38.0 37.2 38.0 33.2 38.0 110-114 35.686949999999996 38.0 37.0 38.0 31.0 38.0 115-119 35.7567 38.0 37.0 38.0 31.8 38.0 120-124 35.584649999999996 38.0 36.6 38.0 31.2 38.0 125-129 35.24525 38.0 36.0 38.0 28.8 38.0 130-134 35.0034 38.0 35.4 38.0 28.0 38.0 135-139 34.643350000000005 38.0 35.2 38.0 26.4 38.0 140-144 33.872299999999996 38.0 34.0 38.0 23.0 38.0 145-149 33.11825 38.0 33.2 38.0 19.4 38.0 150-151 28.711750000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 4.0 17 5.0 18 6.0 19 4.0 20 3.0 21 7.0 22 9.0 23 7.0 24 11.0 25 4.0 26 25.0 27 16.0 28 43.0 29 32.0 30 35.0 31 45.0 32 75.0 33 99.0 34 160.0 35 275.0 36 728.0 37 2403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.26429479034308 13.672172808132146 9.860228716645489 40.20330368487929 2 21.224999999999998 19.650000000000002 35.9 23.225 3 17.299999999999997 25.724999999999998 28.825 28.15 4 21.9 32.225 22.8 23.075000000000003 5 20.95 35.825 24.375 18.85 6 18.625 35.025 26.075 20.275000000000002 7 14.075 22.175 43.675000000000004 20.075000000000003 8 18.475 23.5 30.425 27.6 9 17.275 22.925 34.2 25.6 10-14 19.915 29.439999999999998 26.965 23.68 15-19 20.11 28.060000000000002 28.155 23.674999999999997 20-24 19.725 28.265 28.384999999999998 23.625 25-29 19.89 28.92 27.325 23.865 30-34 19.439999999999998 28.985 27.815 23.76 35-39 19.77 28.560000000000002 27.52 24.15 40-44 20.01 28.68 27.405 23.905 45-49 19.99 28.82 27.515 23.674999999999997 50-54 20.265 29.049999999999997 27.55 23.135 55-59 19.950000000000003 28.815 27.07 24.165 60-64 20.849999999999998 28.494999999999997 27.315 23.34 65-69 20.01 29.13 27.445000000000004 23.415 70-74 20.735 28.060000000000002 27.860000000000003 23.345 75-79 20.24 28.465 27.435 23.86 80-84 20.075000000000003 28.71 27.46 23.755000000000003 85-89 20.31 27.900000000000002 27.634999999999998 24.154999999999998 90-94 20.385 28.110000000000003 27.62 23.885 95-99 19.925 28.415000000000003 27.91 23.75 100-104 20.4191886348857 28.137661947876545 27.39732879795908 24.045820619278675 105-109 20.45 28.494999999999997 27.515 23.54 110-114 20.246320216281166 28.21167517773105 27.110243316311205 24.43176128967658 115-119 20.990000000000002 28.335 26.955000000000002 23.72 120-124 20.155 29.095 26.900000000000002 23.849999999999998 125-129 20.895 28.46 26.810000000000002 23.835 130-134 20.62 28.744999999999997 27.07 23.565 135-139 21.025 27.98 27.32 23.674999999999997 140-144 21.279999999999998 28.835 27.29 22.595000000000002 145-149 20.43 29.15 26.555 23.865 150-151 21.4 27.825 26.337500000000002 24.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 2.0 23 2.5 24 2.5 25 4.5 26 5.5 27 7.0 28 11.0 29 13.5 30 21.0 31 29.5 32 37.0 33 52.0 34 70.5 35 85.0 36 88.5 37 102.5 38 131.0 39 147.0 40 183.5 41 213.5 42 234.5 43 246.5 44 251.0 45 265.5 46 258.5 47 257.5 48 235.5 49 196.5 50 172.5 51 139.5 52 114.0 53 103.5 54 77.5 55 61.5 56 51.5 57 33.5 58 23.5 59 17.0 60 14.5 61 11.5 62 7.0 63 3.0 64 1.0 65 0.5 66 0.5 67 1.0 68 2.5 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.045 105-109 0.0 110-114 0.13 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.9500000000000002 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.85 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 3.9 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.262499999999999 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 6.0 0.0 0.0 0.0 0.0 138-139 6.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGGGC 10 0.006882143 144.6375 2 >>END_MODULE SRR7172457 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172457_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6085 33.0 33.0 34.0 32.0 34.0 2 32.75175 33.0 33.0 34.0 32.0 34.0 3 32.82125 34.0 33.0 34.0 32.0 34.0 4 32.7715 34.0 33.0 34.0 32.0 34.0 5 32.6925 34.0 33.0 34.0 32.0 34.0 6 36.98575 38.0 38.0 38.0 36.0 38.0 7 36.94725 38.0 38.0 38.0 37.0 38.0 8 36.892 38.0 38.0 38.0 36.0 38.0 9 36.87125 38.0 38.0 38.0 36.0 38.0 10-14 36.9294 38.0 38.0 38.0 36.6 38.0 15-19 36.9725 38.0 38.0 38.0 37.0 38.0 20-24 37.00985 38.0 38.0 38.0 37.0 38.0 25-29 36.984 38.0 38.0 38.0 37.0 38.0 30-34 36.91760000000001 38.0 38.0 38.0 36.8 38.0 35-39 36.8722 38.0 38.0 38.0 36.2 38.0 40-44 36.89604999999999 38.0 38.0 38.0 36.8 38.0 45-49 36.91775 38.0 38.0 38.0 37.0 38.0 50-54 36.8668 38.0 38.0 38.0 36.4 38.0 55-59 36.79625 38.0 38.0 38.0 36.0 38.0 60-64 36.778150000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.734249999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.70975 38.0 38.0 38.0 36.0 38.0 75-79 36.44335 38.0 38.0 38.0 35.0 38.0 80-84 36.51735 38.0 38.0 38.0 35.0 38.0 85-89 36.476600000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.232299999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.04355 38.0 38.0 38.0 33.4 38.0 100-104 36.004 38.0 38.0 38.0 33.4 38.0 105-109 35.74059999999999 38.0 37.8 38.0 32.2 38.0 110-114 35.69235 38.0 37.6 38.0 31.8 38.0 115-119 35.577600000000004 38.0 37.2 38.0 31.2 38.0 120-124 35.335049999999995 38.0 37.0 38.0 29.8 38.0 125-129 35.08675 38.0 36.2 38.0 28.2 38.0 130-134 34.6635 38.0 36.0 38.0 26.2 38.0 135-139 34.1796 38.0 35.2 38.0 23.4 38.0 140-144 33.603899999999996 38.0 33.8 38.0 21.0 38.0 145-149 32.848650000000006 38.0 33.0 38.0 15.0 38.0 150-151 28.7265 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 1.0 4 0.0 5 1.0 6 1.0 7 2.0 8 1.0 9 1.0 10 1.0 11 3.0 12 2.0 13 3.0 14 2.0 15 2.0 16 5.0 17 5.0 18 6.0 19 11.0 20 6.0 21 10.0 22 11.0 23 11.0 24 19.0 25 20.0 26 25.0 27 32.0 28 22.0 29 47.0 30 51.0 31 49.0 32 59.0 33 95.0 34 138.0 35 212.0 36 502.0 37 2622.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.126067302862886 19.964841788046208 13.987945755901556 26.92114515318935 2 26.098970108013063 24.717407686510928 33.98643556895252 15.197186636523485 3 20.62295905551369 27.20422004521477 31.32378799296659 20.84903290630495 4 23.51168048229088 36.54860587792012 22.38131122833459 17.558402411454406 5 24.717407686510928 36.47324792765637 21.97940216026124 16.829942225571465 6 19.27227101631117 37.84190715181932 23.337515683814303 19.548306148055207 7 18.72020075282309 20.476787954830613 40.35131744040151 20.451693851944793 8 20.326223337515685 25.06900878293601 27.97992471769134 26.624843161856965 9 22.258469259723963 24.24090338770389 29.962358845671268 23.538268506900877 10-14 23.031367628607278 28.777917189460478 26.73023839397742 21.46047678795483 15-19 22.409033877038894 28.41154328732748 28.20075282308657 20.978670012547052 20-24 23.242158092848182 27.924717691342533 27.819322459222086 21.013801756587203 25-29 23.051442910915934 28.01505646173149 27.814303638644915 21.119196988707653 30-34 22.810539523212046 28.37641154328733 27.809284818067752 21.003764115432872 35-39 22.775407779171893 28.11543287327478 28.25595984943538 20.85319949811794 40-44 22.489335006273524 28.090338770388957 28.190715181932248 21.22961104140527 45-49 23.016311166875784 28.37641154328733 27.854454203262236 20.752823086574654 50-54 23.121706398996235 27.7038895859473 27.904642409033876 21.269761606022584 55-59 23.15683814303639 27.59849435382685 27.974905897114176 21.269761606022584 60-64 23.513174404015054 26.956085319949814 28.34629861982434 21.18444165621079 65-69 23.39272271016311 27.83437892095358 27.76913425345044 21.003764115432872 70-74 23.37766624843162 27.498117942283564 28.135508155583437 20.98870765370138 75-79 23.121706398996235 27.844416562107906 27.909661229611043 21.12421580928482 80-84 23.498117942283564 27.774153074027602 27.814303638644915 20.913425345043915 85-89 23.919698870765373 27.196988707653702 28.27603513174404 20.60727728983689 90-94 23.493099121706397 28.456712672521956 27.693851944792975 20.35633626097867 95-99 23.914680050188206 27.949811794228356 27.909661229611043 20.225846925972395 100-104 24.100376411543287 27.36762860727729 28.210790464240905 20.321204516938522 105-109 24.075282308657467 27.548306148055207 28.17565872020075 20.200752823086574 110-114 23.899623588456713 28.336260978670012 27.658720200752825 20.10539523212045 115-119 24.095357590966124 28.4366373902133 27.774153074027602 19.69385194479297 120-124 24.30614805520703 28.326223337515682 27.43789209535759 19.9297365119197 125-129 24.366373902133 27.98996235884567 27.07151819322459 20.572145545796737 130-134 24.336260978670012 27.879548306148056 27.7038895859473 20.08030112923463 135-139 24.346298619824342 27.749058971141782 27.548306148055207 20.35633626097867 140-144 24.913425345043915 27.578419071518194 27.247176913425346 20.26097867001255 145-149 24.767879548306148 28.4366373902133 27.091593475533248 19.7038895859473 150-151 24.993726474278542 27.590966122961103 26.96361355081556 20.451693851944793 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 15.0 1 7.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.0 23 2.5 24 2.0 25 1.0 26 4.0 27 7.0 28 8.0 29 11.5 30 17.5 31 22.5 32 30.0 33 39.5 34 54.5 35 71.0 36 87.0 37 110.5 38 124.0 39 156.5 40 203.0 41 231.5 42 242.0 43 252.5 44 266.5 45 279.0 46 269.0 47 236.0 48 206.5 49 185.0 50 168.0 51 142.5 52 117.0 53 99.5 54 90.0 55 66.5 56 45.0 57 27.5 58 20.0 59 27.0 60 18.5 61 8.5 62 7.5 63 6.0 64 4.0 65 3.0 66 3.0 67 1.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.475 3 0.475 4 0.475 5 0.475 6 0.375 7 0.375 8 0.375 9 0.375 10-14 0.375 15-19 0.375 20-24 0.375 25-29 0.375 30-34 0.375 35-39 0.375 40-44 0.375 45-49 0.375 50-54 0.375 55-59 0.375 60-64 0.375 65-69 0.375 70-74 0.375 75-79 0.375 80-84 0.375 85-89 0.375 90-94 0.375 95-99 0.375 100-104 0.375 105-109 0.375 110-114 0.375 115-119 0.375 120-124 0.375 125-129 0.375 130-134 0.375 135-139 0.375 140-144 0.375 145-149 0.375 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11302584896097 97.775 2 0.7349214394323366 1.4500000000000002 3 0.10136847440446022 0.3 4 0.025342118601115054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025342118601115054 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 15 0.375 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 3.85 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.4875 0.0 0.0 0.0 0.0 130-131 4.85 0.0 0.0 0.0 0.0 132-133 5.237500000000001 0.0 0.0 0.0 0.0 134-135 5.6125 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAAAT 10 0.00682074 145.0 145 >>END_MODULE Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757598 spots for SRR7172457.sra Written 757598 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra Read 757581 spots for SRR7172457.sra Written 757581 spots for SRR7172457.sra SRR ids: ['SRR7172457.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qpuub5cm SRR7172457.sra spots: 15151637 blocks: [[1, 757581], [757582, 1515162], [1515163, 2272743], [2272744, 3030324], [3030325, 3787905], [3787906, 4545486], [4545487, 5303067], [5303068, 6060648], [6060649, 6818229], [6818230, 7575810], [7575811, 8333391], [8333392, 9090972], [9090973, 9848553], [9848554, 10606134], [10606135, 11363715], [11363716, 12121296], [12121297, 12878877], [12878878, 13636458], [13636459, 14394039], [14394040, 15151637]] SRR7172457 file size 5112692 SRR7172457 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172457 SRR7172457_1.fastq SRR7172457_2.fastq Input file: SRR7172457_1.fastq Paired file: SRR7172457_2.fastq trimmed: SRR7172457-trimmed-pair1.fastq, SRR7172457-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:59:22 2025 >> started Fri Feb 14 10:59:38 2025 >> done (16.151s) 15151637 read pairs processed; of these: 13115 ( 0.09%) short read pairs filtered out after trimming by size control 94222 ( 0.62%) empty read pairs filtered out after trimming by size control 15044300 (99.29%) read pairs available; of these: 7932950 (52.73%) trimmed read pairs available after processing 7111350 (47.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 4 0.00% 21 3 0.00% 22 6 0.00% 23 1 0.00% 24 10 0.00% 25 5 0.00% 26 8 0.00% 27 7 0.00% 28 8 0.00% 29 11 0.00% 30 12 0.00% 31 8 0.00% 32 7 0.00% 33 12 0.00% 34 9 0.00% 35 14 0.00% 36 7 0.00% 37 18 0.00% 38 24 0.00% 39 18 0.00% 40 18 0.00% 41 33 0.00% 42 23 0.00% 43 34 0.00% 44 36 0.00% 45 32 0.00% 46 28 0.00% 47 61 0.00% 48 64 0.00% 49 67 0.00% 50 84 0.00% 51 101 0.00% 52 81 0.00% 53 114 0.00% 54 105 0.00% 55 134 0.00% 56 154 0.00% 57 170 0.00% 58 175 0.00% 59 233 0.00% 60 249 0.00% 61 322 0.00% 62 343 0.00% 63 401 0.00% 64 434 0.00% 65 496 0.00% 66 492 0.00% 67 585 0.00% 68 638 0.00% 69 795 0.01% 70 869 0.01% 71 930 0.01% 72 1038 0.01% 73 1247 0.01% 74 1438 0.01% 75 1461 0.01% 76 1685 0.01% 77 1840 0.01% 78 2052 0.01% 79 2217 0.01% 80 2630 0.02% 81 2922 0.02% 82 3325 0.02% 83 3899 0.03% 84 4752 0.03% 85 5358 0.04% 86 5491 0.04% 87 5888 0.04% 88 6532 0.04% 89 6936 0.05% 90 7604 0.05% 91 8231 0.05% 92 8725 0.06% 93 9959 0.07% 94 10362 0.07% 95 11261 0.07% 96 11195 0.07% 97 12088 0.08% 98 12567 0.08% 99 13092 0.09% 100 13759 0.09% 101 14676 0.10% 102 15748 0.10% 103 16898 0.11% 104 17507 0.12% 105 18668 0.12% 106 19647 0.13% 107 20196 0.13% 108 20871 0.14% 109 21811 0.14% 110 22689 0.15% 111 23416 0.16% 112 24886 0.17% 113 26056 0.17% 114 27088 0.18% 115 28601 0.19% 116 29683 0.20% 117 30637 0.20% 118 31398 0.21% 119 32202 0.21% 120 33364 0.22% 121 34268 0.23% 122 36419 0.24% 123 38392 0.26% 124 40157 0.27% 125 41873 0.28% 126 43596 0.29% 127 45212 0.30% 128 47003 0.31% 129 48663 0.32% 130 50329 0.33% 131 52324 0.35% 132 55039 0.37% 133 58616 0.39% 134 61488 0.41% 135 65398 0.43% 136 68773 0.46% 137 74388 0.49% 138 79153 0.53% 139 85404 0.57% 140 91074 0.61% 141 99648 0.66% 142 110422 0.73% 143 124539 0.83% 144 144102 0.96% 145 169807 1.13% 146 212461 1.41% 147 285599 1.90% 148 440108 2.93% 149 845736 5.62% 150 3718864 24.72% 151 7111350 47.27% 15044300 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=14 prefix-density=0.55 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=379.56 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=25.17 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7172457 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:00:39 Started mapping on | Feb 14 11:00:39 Finished on | Feb 14 11:02:36 Mapping speed, Million of reads per hour | 462.90 Number of input reads | 15044300 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14004177 Uniquely mapped reads % | 93.09% Average mapped length | 292.75 Number of splices: Total | 13358832 Number of splices: Annotated (sjdb) | 13068479 Number of splices: GT/AG | 13084247 Number of splices: GC/AG | 225856 Number of splices: AT/AC | 7585 Number of splices: Non-canonical | 41144 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 424475 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 56770 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.62% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 627388 627388 627388 N_multimapping 424475 424475 424475 N_noFeature 523275 13778163 616590 N_ambiguous 237424 904 104168 UnstrandedReadsAssigned:13243478 PositiveStrandReadsAssigned:225110 NegativeStrandReadsAssigned:13283419 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172457 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172457-trimmed-pair1.fastq SRR7172457-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,044,300 reads, 13,317,196 reads pseudoaligned [quant] estimated average fragment length: 248.929 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52401 SRR7172457.ke.tsv 34699 SRR7172457.se.tsv 87100 total ==> SRR7172457.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.07 555 21.707 Potri.005G024800.1.v4.1 1035 787.071 140 12.3144 Potri.004G059700.1.v4.1 961 713.18 8 0.776585 Potri.007G009000.2.v4.1 1416 1168.07 0 0 Potri.003G141000.2.v4.1 2943 2695.07 692 17.776 Potri.016G087400.1.v4.1 270 82.53 895 750.774 Potri.015G069301.1.v4.1 564 324.409 0 0 Potri.010G195200.1.v4.1 1773 1525.07 12 0.54474 Potri.012G127500.1.v4.1 977 729.129 122 11.5839 ==> SRR7172457.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 786 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 27 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7172457 completed mapping pipeline successfully