Starting /dee2/code/volunteer_pipeline.sh SRR7172458 current disk space = 3115757629440 free memory = 1578668992 SRR7172458 SRAfilesize 91e35deb5fcb587ed6af59089b6edd2f SRR7172458.sra SRR7172458.sra file validated SRR7172458 is paired end SRR7172458 is conventional basespace SRR7172458 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172458_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80125 34.0 33.0 34.0 33.0 34.0 2 33.339 34.0 33.0 34.0 33.0 34.0 3 33.3775 34.0 34.0 34.0 33.0 34.0 4 33.446 34.0 34.0 34.0 33.0 34.0 5 33.42525 34.0 34.0 34.0 33.0 34.0 6 37.137 38.0 37.0 38.0 36.0 38.0 7 37.46775 38.0 38.0 38.0 37.0 38.0 8 37.493 38.0 38.0 38.0 37.0 38.0 9 37.545 38.0 38.0 38.0 38.0 38.0 10-14 37.491150000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.50325 38.0 38.0 38.0 37.8 38.0 20-24 37.49759999999999 38.0 38.0 38.0 37.8 38.0 25-29 37.4686 38.0 38.0 38.0 38.0 38.0 30-34 37.4248 38.0 38.0 38.0 37.4 38.0 35-39 37.3463 38.0 38.0 38.0 37.0 38.0 40-44 37.195949999999996 38.0 38.0 38.0 36.4 38.0 45-49 37.090599999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.953199999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.9319 38.0 38.0 38.0 36.0 38.0 60-64 36.8685 38.0 38.0 38.0 35.4 38.0 65-69 36.737049999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.639 38.0 38.0 38.0 34.6 38.0 75-79 36.4835 38.0 38.0 38.0 34.0 38.0 80-84 36.3772 38.0 38.0 38.0 34.0 38.0 85-89 36.1848 38.0 37.6 38.0 33.6 38.0 90-94 36.12845 38.0 37.2 38.0 33.4 38.0 95-99 35.897749999999995 38.0 37.0 38.0 31.8 38.0 100-104 35.79175 38.0 37.0 38.0 31.8 38.0 105-109 35.55005 38.0 36.6 38.0 30.4 38.0 110-114 35.24035 38.0 36.2 38.0 28.6 38.0 115-119 35.164550000000006 38.0 36.0 38.0 28.4 38.0 120-124 34.90145 38.0 35.6 38.0 28.0 38.0 125-129 34.54825000000001 38.0 35.0 38.0 26.2 38.0 130-134 34.17425 38.0 34.6 38.0 23.8 38.0 135-139 33.573 38.0 33.8 38.0 21.8 38.0 140-144 32.848349999999996 38.0 33.0 38.0 14.6 38.0 145-149 31.631550000000004 37.6 31.2 38.0 10.8 38.0 150-151 27.241625 33.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 3.0 10 0.0 11 0.0 12 1.0 13 1.0 14 6.0 15 2.0 16 4.0 17 4.0 18 4.0 19 7.0 20 9.0 21 7.0 22 10.0 23 8.0 24 14.0 25 19.0 26 27.0 27 27.0 28 37.0 29 36.0 30 60.0 31 78.0 32 93.0 33 122.0 34 185.0 35 325.0 36 863.0 37 2047.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.43949044585987 14.038216560509554 8.86624203821656 37.65605095541401 2 20.125 19.725 37.15 23.0 3 18.925 24.175 26.875 30.025000000000002 4 21.8 33.6 22.85 21.75 5 21.9 35.875 24.15 18.075 6 16.8 36.025 26.825 20.349999999999998 7 13.975000000000001 21.925 43.8 20.3 8 16.175 23.35 32.550000000000004 27.925 9 16.625 23.425 33.75 26.200000000000003 10-14 20.035 29.145 26.775 24.044999999999998 15-19 20.155 28.43 27.860000000000003 23.555 20-24 19.46 28.499999999999996 27.794999999999998 24.245 25-29 19.89 28.7 28.34 23.07 30-34 20.73 28.33 27.325 23.615 35-39 19.785 28.384999999999998 27.944999999999997 23.885 40-44 20.445 28.285 27.700000000000003 23.57 45-49 19.72 29.28 27.05 23.95 50-54 20.52 28.675 27.16 23.645 55-59 20.14 28.27 27.779999999999998 23.810000000000002 60-64 19.735 28.48 28.144999999999996 23.64 65-69 20.419999999999998 28.754999999999995 27.295 23.53 70-74 20.330000000000002 28.99 27.200000000000003 23.48 75-79 20.525 28.12 28.01 23.345 80-84 20.73 28.095 27.33 23.845 85-89 20.22 28.689999999999998 27.794999999999998 23.294999999999998 90-94 21.395 27.725 27.68 23.200000000000003 95-99 20.79 28.470000000000002 27.46 23.28 100-104 20.789552686880818 28.189732812969076 27.394175923146204 23.626538577003902 105-109 20.77 28.705000000000002 27.325 23.200000000000003 110-114 20.548013825577318 28.883434353554076 27.535941491759758 23.032610329108852 115-119 21.560000000000002 28.384999999999998 26.740000000000002 23.315 120-124 20.580000000000002 28.975 26.39 24.055 125-129 21.055 28.595 26.71 23.64 130-134 21.4 27.83 27.134999999999998 23.635 135-139 21.45 28.375 26.534999999999997 23.64 140-144 20.72 28.475 26.474999999999998 24.33 145-149 21.23 28.74 26.35 23.68 150-151 20.575 28.5625 26.387500000000003 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 2.5 25 7.0 26 9.0 27 10.5 28 16.5 29 15.5 30 18.0 31 30.5 32 35.5 33 48.5 34 66.0 35 70.5 36 85.0 37 105.0 38 130.0 39 168.5 40 190.5 41 209.5 42 244.0 43 255.5 44 246.5 45 253.0 46 263.0 47 237.5 48 220.0 49 207.0 50 164.0 51 139.0 52 109.5 53 96.0 54 85.0 55 54.5 56 46.5 57 44.0 58 36.0 59 26.0 60 18.5 61 10.0 62 6.5 63 5.5 64 2.0 65 1.0 66 0.5 67 1.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 0.0 110-114 0.185 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.7750000000000004 0.0 0.0 0.0 0.0 114-115 3.2625 0.0 0.0 0.0 0.0 116-117 3.5875000000000004 0.0 0.0 0.0 0.0 118-119 3.9625 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 4.8375 0.0 0.0 0.0 0.0 124-125 5.325 0.0 0.0 0.0 0.0 126-127 5.6875 0.0 0.0 0.0 0.0 128-129 6.1875 0.0 0.0 0.0 0.0 130-131 6.6625 0.0 0.0 0.0 0.0 132-133 7.2875 0.0 0.0 0.0 0.0 134-135 7.7875 0.0 0.0 0.0 0.0 136-137 8.4125 0.0 0.0 0.0 0.0 138-139 9.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTATTC 10 0.006832588 144.9875 7 >>END_MODULE SRR7172458 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172458_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5385 33.0 33.0 34.0 32.0 34.0 2 32.6865 33.0 33.0 34.0 32.0 34.0 3 32.6805 34.0 33.0 34.0 32.0 34.0 4 32.6215 34.0 33.0 34.0 32.0 34.0 5 32.58025 34.0 33.0 34.0 32.0 34.0 6 36.77625 38.0 38.0 38.0 36.0 38.0 7 36.77625 38.0 38.0 38.0 36.0 38.0 8 36.76575 38.0 38.0 38.0 36.0 38.0 9 36.7175 38.0 38.0 38.0 36.0 38.0 10-14 36.75415 38.0 38.0 38.0 36.0 38.0 15-19 36.745000000000005 38.0 38.0 38.0 36.4 38.0 20-24 36.76305 38.0 38.0 38.0 36.4 38.0 25-29 36.7701 38.0 38.0 38.0 36.4 38.0 30-34 36.70695 38.0 38.0 38.0 36.2 38.0 35-39 36.578250000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.6473 38.0 38.0 38.0 36.0 38.0 45-49 36.609249999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.6186 38.0 38.0 38.0 36.0 38.0 55-59 36.5942 38.0 38.0 38.0 35.8 38.0 60-64 36.50435 38.0 38.0 38.0 35.6 38.0 65-69 36.37825 38.0 38.0 38.0 35.2 38.0 70-74 36.38325 38.0 38.0 38.0 35.0 38.0 75-79 36.2023 38.0 38.0 38.0 34.2 38.0 80-84 36.09445 38.0 38.0 38.0 34.0 38.0 85-89 35.99825 38.0 38.0 38.0 34.0 38.0 90-94 35.783249999999995 38.0 38.0 38.0 33.4 38.0 95-99 35.63305 38.0 38.0 38.0 32.2 38.0 100-104 35.4784 38.0 37.8 38.0 31.4 38.0 105-109 35.391749999999995 38.0 37.4 38.0 30.6 38.0 110-114 35.1648 38.0 37.0 38.0 29.2 38.0 115-119 34.90560000000001 38.0 36.8 38.0 28.0 38.0 120-124 34.59965 38.0 36.0 38.0 26.0 38.0 125-129 34.3217 38.0 36.0 38.0 23.6 38.0 130-134 33.852850000000004 38.0 35.2 38.0 22.2 38.0 135-139 33.3441 38.0 33.8 38.0 15.8 38.0 140-144 32.5874 38.0 33.0 38.0 13.0 38.0 145-149 31.58825 38.0 31.8 38.0 8.6 38.0 150-151 27.026249999999997 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 9.0 4 2.0 5 5.0 6 1.0 7 2.0 8 0.0 9 5.0 10 3.0 11 3.0 12 11.0 13 7.0 14 8.0 15 4.0 16 8.0 17 11.0 18 7.0 19 7.0 20 7.0 21 12.0 22 8.0 23 16.0 24 20.0 25 14.0 26 24.0 27 25.0 28 36.0 29 39.0 30 54.0 31 45.0 32 77.0 33 104.0 34 152.0 35 240.0 36 629.0 37 2378.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.80634600856207 20.825988416016116 12.440191387559809 27.927474187862 2 24.049357844371695 26.290606900025182 33.316544950893984 16.343490304709142 3 20.503778337531486 27.38035264483627 31.788413098236777 20.327455919395465 4 24.83627204030227 34.987405541561714 22.241813602015114 17.934508816120907 5 23.35012594458438 36.5743073047859 22.493702770780857 17.581863979848865 6 18.195526514199546 36.793164111585824 25.785373209349082 19.225936164865544 7 19.03923541247485 19.94466800804829 41.398390342052316 19.61770623742455 8 19.054801407742584 24.912016088486677 29.512317747611867 26.520864756158876 9 21.367521367521366 25.037707390648567 30.21618903971845 23.378582202111613 10-14 23.311711168099762 28.475888771559312 26.26841655352743 21.943983506813495 15-19 22.770236299648065 27.561588738059328 28.481649069884362 21.186525892408245 20-24 22.453494218200102 28.21015585721468 27.62694821518351 21.70940170940171 25-29 22.626049364097923 28.66334891670437 28.236062936711402 20.474538782486302 30-34 22.36015479720561 28.215308840528724 27.974066442177214 21.450469920088455 35-39 22.3858837723708 28.267645284536496 27.99617936859039 21.35029157450231 40-44 22.91949514758385 28.06355910896566 28.32000804545683 20.696937697993665 45-49 22.864902927270897 27.56764912986621 28.03540891258425 21.532039030278643 50-54 22.891626854412873 27.719386472215234 28.654764898164448 20.73422177520744 55-59 23.126036901111053 27.565230506259113 28.233874616660803 21.07485797596903 60-64 22.912582315387322 27.401598552254562 28.58291861458805 21.10290051777007 65-69 22.92609351432881 27.19959778783308 28.411261940673704 21.463046757164403 70-74 23.38596138374899 27.770514883346742 27.755430410297667 21.088093322606596 75-79 23.171283495048012 28.012669046302346 27.761299079985925 21.054748378663717 80-84 23.43592838463086 27.625226312613155 27.595051297525647 21.343794005230336 85-89 23.127199597787833 27.576671694318755 28.34590246354952 20.95022624434389 90-94 23.43325621164873 27.537471079368274 27.87948898501157 21.14978372397143 95-99 24.142440398350267 27.492204003621367 27.919726385675485 20.44562921235288 100-104 23.53029922051798 27.498114156399296 28.051294945939148 20.920291677143577 105-109 23.81215747398059 26.944542209261403 28.17135099803912 21.07194931871889 110-114 24.02192497234235 27.919139092829127 28.009655033692045 20.04928090113648 115-119 24.314672300186107 28.021729289271164 27.191791157386447 20.47180725315628 120-124 23.971845148315737 28.45148315736551 27.541478129713425 20.03519356460533 125-129 24.69079939668175 28.109602815485168 27.405731523378584 19.7938662644545 130-134 24.875571866673372 27.66075109345935 27.504901714343173 19.958775325524105 135-139 24.825297873410086 27.726107284701623 27.323915338595345 20.124679503292946 140-144 25.369532428355956 27.370537958773255 27.275012569130215 19.984917043740573 145-149 25.81212913607563 27.728049884340745 26.777632505280096 19.68218847430353 150-151 25.924063364344985 28.0739250691476 26.57782247925572 19.424189087251698 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 20.0 1 10.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.5 22 3.5 23 3.0 24 2.5 25 3.0 26 5.0 27 7.5 28 8.0 29 13.5 30 18.0 31 18.5 32 28.0 33 47.0 34 58.5 35 59.5 36 74.5 37 99.0 38 128.5 39 156.0 40 185.0 41 215.0 42 240.0 43 266.0 44 284.0 45 282.5 46 263.5 47 254.5 48 238.0 49 202.0 50 167.0 51 132.5 52 107.0 53 91.5 54 74.5 55 55.5 56 41.5 57 36.0 58 30.0 59 24.0 60 18.0 61 9.0 62 6.0 63 6.5 64 4.5 65 1.5 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.7250000000000001 3 0.75 4 0.75 5 0.75 6 0.525 7 0.6 8 0.5499999999999999 9 0.5499999999999999 10-14 0.565 15-19 0.5499999999999999 20-24 0.5499999999999999 25-29 0.5349999999999999 30-34 0.515 35-39 0.54 40-44 0.565 45-49 0.59 50-54 0.575 55-59 0.545 60-64 0.5349999999999999 65-69 0.5499999999999999 70-74 0.5599999999999999 75-79 0.545 80-84 0.58 85-89 0.5499999999999999 90-94 0.59 95-99 0.59 100-104 0.575 105-109 0.555 110-114 0.5700000000000001 115-119 0.5950000000000001 120-124 0.5499999999999999 125-129 0.5499999999999999 130-134 0.545 135-139 0.545 140-144 0.5499999999999999 145-149 0.5700000000000001 150-151 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29078014184397 98.0 2 0.5572441742654508 1.0999999999999999 3 0.07598784194528875 0.22499999999999998 4 0.050658561296859174 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025329280648429587 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 19 0.475 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.6749999999999998 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.2875 0.0 0.0 0.0 0.0 116-117 3.6 0.0 0.0 0.0 0.0 118-119 3.9625 0.0 0.0 0.0 0.0 120-121 4.3875 0.0 0.0 0.0 0.0 122-123 4.8 0.0 0.0 0.0 0.0 124-125 5.275 0.0 0.0 0.0 0.0 126-127 5.65 0.0 0.0 0.0 0.0 128-129 6.15 0.0 0.0 0.0 0.0 130-131 6.6125 0.0 0.0 0.0 0.0 132-133 7.2125 0.0 0.0 0.0 0.0 134-135 7.7125 0.0 0.0 0.0 0.0 136-137 8.3125 0.0 0.0 0.0 0.0 138-139 9.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCAGA 10 0.006830828 145.0 6 AAGTCAA 10 0.006830828 145.0 5 >>END_MODULE Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797642 spots for SRR7172458.sra Written 797642 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra Read 797634 spots for SRR7172458.sra Written 797634 spots for SRR7172458.sra SRR ids: ['SRR7172458.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ks5bv1z5 SRR7172458.sra spots: 15952688 blocks: [[1, 797634], [797635, 1595268], [1595269, 2392902], [2392903, 3190536], [3190537, 3988170], [3988171, 4785804], [4785805, 5583438], [5583439, 6381072], [6381073, 7178706], [7178707, 7976340], [7976341, 8773974], [8773975, 9571608], [9571609, 10369242], [10369243, 11166876], [11166877, 11964510], [11964511, 12762144], [12762145, 13559778], [13559779, 14357412], [14357413, 15155046], [15155047, 15952688]] SRR7172458 file size 5384142 SRR7172458 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172458 SRR7172458_1.fastq SRR7172458_2.fastq Input file: SRR7172458_1.fastq Paired file: SRR7172458_2.fastq trimmed: SRR7172458-trimmed-pair1.fastq, SRR7172458-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:12:43 2025 >> started Fri Feb 14 10:13:01 2025 >> done (18.574s) 15952688 read pairs processed; of these: 24811 ( 0.16%) short read pairs filtered out after trimming by size control 108673 ( 0.68%) empty read pairs filtered out after trimming by size control 15819204 (99.16%) read pairs available; of these: 8830840 (55.82%) trimmed read pairs available after processing 6988364 (44.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 7 0.00% 22 3 0.00% 23 1 0.00% 24 4 0.00% 25 9 0.00% 26 5 0.00% 27 8 0.00% 28 6 0.00% 29 7 0.00% 30 10 0.00% 31 5 0.00% 32 11 0.00% 33 16 0.00% 34 14 0.00% 35 25 0.00% 36 11 0.00% 37 22 0.00% 38 18 0.00% 39 24 0.00% 40 31 0.00% 41 30 0.00% 42 28 0.00% 43 40 0.00% 44 44 0.00% 45 40 0.00% 46 54 0.00% 47 69 0.00% 48 65 0.00% 49 84 0.00% 50 106 0.00% 51 144 0.00% 52 134 0.00% 53 146 0.00% 54 171 0.00% 55 157 0.00% 56 219 0.00% 57 223 0.00% 58 289 0.00% 59 312 0.00% 60 391 0.00% 61 423 0.00% 62 465 0.00% 63 517 0.00% 64 584 0.00% 65 678 0.00% 66 737 0.00% 67 915 0.01% 68 1223 0.01% 69 1436 0.01% 70 1525 0.01% 71 1508 0.01% 72 1617 0.01% 73 1813 0.01% 74 2013 0.01% 75 2233 0.01% 76 2434 0.02% 77 2698 0.02% 78 3043 0.02% 79 3413 0.02% 80 3754 0.02% 81 4360 0.03% 82 4971 0.03% 83 5579 0.04% 84 6817 0.04% 85 8003 0.05% 86 8347 0.05% 87 8902 0.06% 88 9582 0.06% 89 9974 0.06% 90 11024 0.07% 91 11870 0.08% 92 12497 0.08% 93 14073 0.09% 94 15079 0.10% 95 15524 0.10% 96 16038 0.10% 97 17031 0.11% 98 17534 0.11% 99 18914 0.12% 100 19861 0.13% 101 20915 0.13% 102 22256 0.14% 103 23621 0.15% 104 24368 0.15% 105 25928 0.16% 106 27032 0.17% 107 27794 0.18% 108 28947 0.18% 109 30483 0.19% 110 31631 0.20% 111 32793 0.21% 112 34037 0.22% 113 35707 0.23% 114 37569 0.24% 115 39499 0.25% 116 40624 0.26% 117 42269 0.27% 118 43562 0.28% 119 44466 0.28% 120 46187 0.29% 121 47973 0.30% 122 49196 0.31% 123 51787 0.33% 124 53607 0.34% 125 55781 0.35% 126 58397 0.37% 127 60498 0.38% 128 61461 0.39% 129 64639 0.41% 130 66650 0.42% 131 69011 0.44% 132 72473 0.46% 133 75823 0.48% 134 79706 0.50% 135 83898 0.53% 136 88017 0.56% 137 94138 0.60% 138 97810 0.62% 139 105515 0.67% 140 112563 0.71% 141 121946 0.77% 142 132539 0.84% 143 149389 0.94% 144 173332 1.10% 145 202595 1.28% 146 249370 1.58% 147 327893 2.07% 148 481383 3.04% 149 906858 5.73% 150 3704902 23.42% 151 6988364 44.18% 15819204 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=8 prefix-density=0.41 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=388.46 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=18.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=27 prefix-density=0.50 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=53.45 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7172458 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:15:11 Started mapping on | Feb 14 10:15:11 Finished on | Feb 14 10:16:55 Mapping speed, Million of reads per hour | 547.59 Number of input reads | 15819204 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14878638 Uniquely mapped reads % | 94.05% Average mapped length | 290.64 Number of splices: Total | 13931022 Number of splices: Annotated (sjdb) | 13622133 Number of splices: GT/AG | 13668802 Number of splices: GC/AG | 213270 Number of splices: AT/AC | 8101 Number of splices: Non-canonical | 40849 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418784 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 63511 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 542767 542767 542767 N_multimapping 418784 418784 418784 N_noFeature 661233 14623700 781138 N_ambiguous 217329 969 81690 UnstrandedReadsAssigned:14000076 PositiveStrandReadsAssigned:253969 NegativeStrandReadsAssigned:14015810 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7172458 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172458-trimmed-pair1.fastq SRR7172458-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,819,204 reads, 14,042,417 reads pseudoaligned [quant] estimated average fragment length: 230.812 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 987 rounds 52401 SRR7172458.ke.tsv 34699 SRR7172458.se.tsv 87100 total ==> SRR7172458.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.19 473 18.1066 Potri.005G024800.1.v4.1 1035 805.188 146 12.4121 Potri.004G059700.1.v4.1 961 731.249 13 1.21693 Potri.007G009000.2.v4.1 1416 1186.19 0 0 Potri.003G141000.2.v4.1 2943 2713.19 743.121 18.7486 Potri.016G087400.1.v4.1 270 88.4736 833 644.496 Potri.015G069301.1.v4.1 564 340.296 0 0 Potri.010G195200.1.v4.1 1773 1543.19 34 1.50816 Potri.012G127500.1.v4.1 977 747.214 181 16.5814 ==> SRR7172458.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1026 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7172458 completed mapping pipeline successfully