Starting /dee2/code/volunteer_pipeline.sh SRR7172459 current disk space = 3116243783680 free memory = 1445792896 SRR7172459 SRAfilesize 3859dd452edc65acd9d26ea35dfe5bed SRR7172459.sra SRR7172459.sra file validated SRR7172459 is paired end SRR7172459 is conventional basespace SRR7172459 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172459_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.318 34.0 33.0 34.0 32.0 34.0 2 33.181 34.0 33.0 34.0 32.0 34.0 3 33.30275 34.0 33.0 34.0 32.0 34.0 4 33.42725 34.0 33.0 34.0 33.0 34.0 5 33.19425 34.0 33.0 34.0 33.0 34.0 6 37.09125 38.0 37.0 38.0 36.0 38.0 7 37.4055 38.0 38.0 38.0 37.0 38.0 8 37.45075 38.0 38.0 38.0 37.0 38.0 9 37.4835 38.0 38.0 38.0 37.0 38.0 10-14 37.34115 38.0 38.0 38.0 36.8 38.0 15-19 37.2127 38.0 38.0 38.0 36.8 38.0 20-24 37.0909 38.0 38.0 38.0 36.4 38.0 25-29 37.3196 38.0 38.0 38.0 37.0 38.0 30-34 37.15715 38.0 38.0 38.0 36.6 38.0 35-39 37.075500000000005 38.0 38.0 38.0 36.0 38.0 40-44 37.117450000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.7029 38.0 38.0 38.0 34.6 38.0 50-54 36.9692 38.0 38.0 38.0 36.0 38.0 55-59 37.021249999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.94330000000001 38.0 38.0 38.0 35.6 38.0 65-69 36.84955 38.0 38.0 38.0 35.0 38.0 70-74 36.544349999999994 38.0 38.0 38.0 34.2 38.0 75-79 36.5148 38.0 37.6 38.0 34.0 38.0 80-84 36.314750000000004 38.0 37.2 38.0 33.6 38.0 85-89 36.247749999999996 38.0 37.4 38.0 32.8 38.0 90-94 35.829750000000004 38.0 36.8 38.0 30.8 38.0 95-99 36.27139999999999 38.0 37.0 38.0 34.0 38.0 100-104 36.2341 38.0 37.0 38.0 33.8 38.0 105-109 35.69695 38.0 36.8 38.0 30.6 38.0 110-114 35.56105 38.0 36.0 38.0 30.6 38.0 115-119 35.3977 38.0 36.0 38.0 30.2 38.0 120-124 35.17195 38.0 35.8 38.0 28.4 38.0 125-129 34.910399999999996 38.0 35.4 38.0 28.2 38.0 130-134 34.4191 38.0 35.0 38.0 25.4 38.0 135-139 33.84054999999999 38.0 34.2 38.0 22.6 38.0 140-144 32.92795 38.0 33.6 38.0 15.6 38.0 145-149 31.391849999999998 36.4 31.4 38.0 11.4 38.0 150-151 28.285249999999998 35.0 23.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 3.0 17 4.0 18 1.0 19 6.0 20 6.0 21 6.0 22 11.0 23 8.0 24 5.0 25 18.0 26 22.0 27 24.0 28 28.0 29 36.0 30 61.0 31 96.0 32 108.0 33 158.0 34 202.0 35 390.0 36 890.0 37 1911.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.53705138135812 13.426284533953009 10.482829847663309 35.55383423702556 2 21.099999999999998 17.925 34.599999999999994 26.375 3 20.275000000000002 23.974999999999998 26.700000000000003 29.049999999999997 4 22.325 30.95 23.375 23.35 5 22.05 36.4 22.85 18.7 6 17.25 34.4 27.025 21.325 7 14.524999999999999 23.9 42.55 19.025 8 17.125 24.425 31.15 27.3 9 17.474999999999998 23.549999999999997 33.45 25.525 10-14 20.064999999999998 29.360000000000003 26.33 24.245 15-19 19.975 28.88 27.42 23.724999999999998 20-24 19.27 28.555000000000003 27.845 24.33 25-29 19.535 28.98 27.33 24.154999999999998 30-34 19.744999999999997 28.32 28.415000000000003 23.52 35-39 19.55 28.765 28.035 23.65 40-44 19.85 29.215000000000003 27.650000000000002 23.285 45-49 19.71 28.970000000000002 27.439999999999998 23.880000000000003 50-54 19.794999999999998 28.384999999999998 27.785 24.035 55-59 20.14 28.689999999999998 27.794999999999998 23.375 60-64 19.785 28.415000000000003 28.02 23.78 65-69 19.685 28.455000000000002 28.084999999999997 23.775 70-74 19.73 28.7 27.725 23.845 75-79 20.044999999999998 28.835 27.334999999999997 23.785 80-84 20.200000000000003 29.220000000000002 26.87 23.71 85-89 20.23 28.310000000000002 28.310000000000002 23.150000000000002 90-94 19.950000000000003 28.134999999999998 27.815 24.099999999999998 95-99 20.395 28.03 28.095 23.48 100-104 20.630000000000003 28.939999999999998 27.175 23.255 105-109 20.48 28.355000000000004 26.93 24.235 110-114 21.095 28.065 27.395000000000003 23.445 115-119 20.244999999999997 28.494999999999997 27.279999999999998 23.98 120-124 20.805 28.325 26.905 23.965 125-129 20.615 28.055000000000003 27.265 24.065 130-134 20.93 28.345 27.075 23.65 135-139 20.7 28.13 27.255000000000003 23.915 140-144 20.200000000000003 28.59 27.21 24.0 145-149 21.085 28.42 26.69 23.805 150-151 21.45 28.1 26.700000000000003 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 3.5 25 4.5 26 5.0 27 10.5 28 15.5 29 18.0 30 15.5 31 24.0 32 40.5 33 50.0 34 68.5 35 87.0 36 97.5 37 115.0 38 138.5 39 161.5 40 174.0 41 199.5 42 228.0 43 256.0 44 279.0 45 273.0 46 259.5 47 256.0 48 239.5 49 196.0 50 159.5 51 134.5 52 100.5 53 70.5 54 62.0 55 55.0 56 48.5 57 37.0 58 27.5 59 21.5 60 16.5 61 12.5 62 8.0 63 7.5 64 6.0 65 2.5 66 0.0 67 0.0 68 2.0 69 2.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6048387096774194 1.2 3 0.10080645161290322 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.525 0.0 0.0 0.0 0.0 120-121 3.9 0.0 0.0 0.0 0.0 122-123 4.3125 0.0 0.0 0.0 0.0 124-125 4.5375 0.0 0.0 0.0 0.0 126-127 4.8 0.0 0.0 0.0 0.0 128-129 5.2 0.0 0.0 0.0 0.0 130-131 5.75 0.0 0.0 0.0 0.0 132-133 6.3625 0.0 0.0 0.0 0.0 134-135 7.0375 0.0 0.0 0.0 0.0 136-137 7.5 0.0 0.0 0.0 0.0 138-139 8.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172459 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172459_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91825 33.0 33.0 34.0 32.0 34.0 2 33.0755 34.0 33.0 34.0 32.0 34.0 3 33.07575 34.0 33.0 34.0 32.0 34.0 4 33.05075 34.0 33.0 34.0 33.0 34.0 5 33.05075 34.0 33.0 34.0 33.0 34.0 6 37.16775 38.0 38.0 38.0 37.0 38.0 7 37.18925 38.0 38.0 38.0 37.0 38.0 8 37.1175 38.0 38.0 38.0 37.0 38.0 9 36.966 38.0 38.0 38.0 37.0 38.0 10-14 36.9396 38.0 38.0 38.0 36.6 38.0 15-19 37.04845 38.0 38.0 38.0 37.0 38.0 20-24 36.78615 38.0 38.0 38.0 36.2 38.0 25-29 36.74955 38.0 38.0 38.0 36.0 38.0 30-34 36.860049999999994 38.0 38.0 38.0 36.6 38.0 35-39 36.90405 38.0 38.0 38.0 36.8 38.0 40-44 36.66035 38.0 38.0 38.0 35.6 38.0 45-49 36.74665 38.0 38.0 38.0 36.2 38.0 50-54 36.502449999999996 38.0 38.0 38.0 34.6 38.0 55-59 36.794500000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.78835 38.0 38.0 38.0 36.0 38.0 65-69 36.59505 38.0 38.0 38.0 35.2 38.0 70-74 36.601549999999996 38.0 38.0 38.0 35.6 38.0 75-79 36.69160000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.5887 38.0 38.0 38.0 35.6 38.0 85-89 35.941 38.0 37.4 38.0 32.2 38.0 90-94 36.2994 38.0 38.0 38.0 34.2 38.0 95-99 36.411 38.0 38.0 38.0 35.0 38.0 100-104 36.0034 38.0 37.6 38.0 33.0 38.0 105-109 36.0117 38.0 38.0 38.0 33.8 38.0 110-114 35.91905 38.0 37.8 38.0 33.4 38.0 115-119 35.76975 38.0 37.8 38.0 32.6 38.0 120-124 35.590700000000005 38.0 37.2 38.0 31.4 38.0 125-129 35.38935 38.0 36.6 38.0 31.0 38.0 130-134 34.84765 38.0 35.6 38.0 27.6 38.0 135-139 34.5514 38.0 35.0 38.0 26.4 38.0 140-144 34.294799999999995 38.0 35.0 38.0 24.6 38.0 145-149 33.6434 38.0 34.2 38.0 22.2 38.0 150-151 29.84375 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 10.0 4 6.0 5 2.0 6 2.0 7 2.0 8 1.0 9 1.0 10 1.0 11 1.0 12 3.0 13 8.0 14 0.0 15 4.0 16 6.0 17 5.0 18 6.0 19 4.0 20 5.0 21 5.0 22 8.0 23 9.0 24 9.0 25 17.0 26 19.0 27 21.0 28 32.0 29 28.0 30 36.0 31 49.0 32 76.0 33 101.0 34 163.0 35 225.0 36 549.0 37 2579.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.7 20.5 14.35 25.45 2 27.474999999999998 25.974999999999998 30.775000000000002 15.775 3 21.525 27.525 31.374999999999996 19.575 4 23.849999999999998 34.975 22.425 18.75 5 24.2 36.825 22.675 16.3 6 19.55 38.15 24.175 18.125 7 19.3 20.05 41.05 19.6 8 21.425 23.875 29.15 25.55 9 22.825 24.675 29.7 22.8 10-14 24.065 28.439999999999998 26.650000000000002 20.845 15-19 22.994999999999997 28.194999999999997 28.17 20.64 20-24 24.16 27.985 27.150000000000002 20.705000000000002 25-29 23.845 27.939999999999998 28.165000000000003 20.05 30-34 23.105 28.310000000000002 27.725 20.86 35-39 22.770000000000003 28.73 27.88 20.62 40-44 23.56 28.439999999999998 27.685 20.315 45-49 23.375 28.249999999999996 27.67 20.705000000000002 50-54 23.18 28.115000000000002 27.834999999999997 20.87 55-59 23.625 27.22 28.345 20.810000000000002 60-64 24.01 28.185 27.21 20.595 65-69 23.44 27.58 28.345 20.635 70-74 23.630000000000003 28.599999999999998 27.57 20.200000000000003 75-79 23.345 27.905 27.825 20.925 80-84 23.580000000000002 28.134999999999998 27.165 21.12 85-89 23.47 27.485 28.285 20.76 90-94 23.345 27.860000000000003 27.744999999999997 21.05 95-99 23.974999999999998 27.79 27.755000000000003 20.48 100-104 23.985 27.925 27.68 20.41 105-109 23.865 27.565 27.884999999999998 20.685000000000002 110-114 23.89 28.455000000000002 27.3 20.355 115-119 24.22 28.15 27.27 20.36 120-124 24.115000000000002 27.37 28.525 19.99 125-129 24.43 27.72 27.38 20.47 130-134 24.95 27.91 27.815 19.325 135-139 24.335 27.87 27.51 20.285 140-144 24.8 28.12 26.965 20.115 145-149 25.55 28.255000000000003 26.634999999999998 19.56 150-151 25.5375 28.050000000000004 27.1 19.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 1.5 22 4.5 23 5.0 24 3.0 25 1.5 26 3.0 27 9.0 28 11.0 29 10.5 30 12.5 31 18.0 32 36.0 33 44.0 34 50.5 35 63.0 36 77.0 37 107.0 38 144.0 39 172.5 40 174.5 41 205.0 42 241.0 43 264.0 44 279.0 45 263.5 46 256.5 47 253.5 48 235.5 49 199.5 50 168.5 51 144.0 52 115.5 53 94.0 54 80.0 55 63.0 56 45.0 57 34.0 58 27.5 59 24.5 60 20.0 61 12.0 62 8.0 63 5.5 64 2.5 65 1.5 66 1.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34459289135367 98.52499999999999 2 0.5545752457776657 1.0999999999999999 3 0.050415931434333254 0.15 4 0.025207965717166627 0.1 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0125 0.0 0.025 0.0 0.0 66-67 0.037500000000000006 0.0 0.025 0.0 0.0 68-69 0.05 0.0 0.025 0.0 0.0 70-71 0.075 0.0 0.025 0.0 0.0 72-73 0.075 0.0 0.025 0.0 0.0 74-75 0.075 0.0 0.025 0.0 0.0 76-77 0.0875 0.0 0.025 0.0 0.0 78-79 0.1 0.0 0.025 0.0 0.0 80-81 0.125 0.0 0.025 0.0 0.0 82-83 0.1375 0.0 0.025 0.0 0.0 84-85 0.175 0.0 0.025 0.0 0.0 86-87 0.25 0.0 0.025 0.0 0.0 88-89 0.3375 0.0 0.025 0.0 0.0 90-91 0.4375 0.0 0.025 0.0 0.0 92-93 0.5 0.0 0.025 0.0 0.0 94-95 0.6 0.0 0.025 0.0 0.0 96-97 0.6875 0.0 0.025 0.0 0.0 98-99 0.775 0.0 0.025 0.0 0.0 100-101 0.8625 0.0 0.025 0.0 0.0 102-103 1.0875 0.0 0.025 0.0 0.0 104-105 1.3 0.0 0.025 0.0 0.0 106-107 1.45 0.0 0.025 0.0 0.0 108-109 1.675 0.0 0.025 0.0 0.0 110-111 1.8125 0.0 0.025 0.0 0.0 112-113 2.3 0.0 0.025 0.0 0.0 114-115 2.5999999999999996 0.0 0.025 0.0 0.0 116-117 2.875 0.0 0.025 0.0 0.0 118-119 3.35 0.0 0.025 0.0 0.0 120-121 3.75 0.0 0.025 0.0 0.0 122-123 4.1875 0.0 0.025 0.0 0.0 124-125 4.4125 0.0 0.025 0.0 0.0 126-127 4.6625 0.0 0.025 0.0 0.0 128-129 5.0125 0.0 0.025 0.0 0.0 130-131 5.550000000000001 0.0 0.025 0.0 0.0 132-133 6.175000000000001 0.0 0.025 0.0 0.0 134-135 6.862500000000001 0.0 0.025 0.0 0.0 136-137 7.35 0.0 0.025 0.0 0.0 138-139 7.9375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGAGG 10 0.006830828 145.0 145 >>END_MODULE Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908014 spots for SRR7172459.sra Written 908014 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra Read 908002 spots for SRR7172459.sra Written 908002 spots for SRR7172459.sra SRR ids: ['SRR7172459.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_34goa1rp SRR7172459.sra spots: 18160052 blocks: [[1, 908002], [908003, 1816004], [1816005, 2724006], [2724007, 3632008], [3632009, 4540010], [4540011, 5448012], [5448013, 6356014], [6356015, 7264016], [7264017, 8172018], [8172019, 9080020], [9080021, 9988022], [9988023, 10896024], [10896025, 11804026], [11804027, 12712028], [12712029, 13620030], [13620031, 14528032], [14528033, 15436034], [15436035, 16344036], [16344037, 17252038], [17252039, 18160052]] SRR7172459 file size 6132145 SRR7172459 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172459 SRR7172459_1.fastq SRR7172459_2.fastq Input file: SRR7172459_1.fastq Paired file: SRR7172459_2.fastq trimmed: SRR7172459-trimmed-pair1.fastq, SRR7172459-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:56:20 2025 >> started Fri Feb 14 09:56:40 2025 >> done (19.569s) 18160052 read pairs processed; of these: 17227 ( 0.09%) short read pairs filtered out after trimming by size control 12074 ( 0.07%) empty read pairs filtered out after trimming by size control 18130751 (99.84%) read pairs available; of these: 8689074 (47.92%) trimmed read pairs available after processing 9441677 (52.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 10 0.00% 21 11 0.00% 22 15 0.00% 23 5 0.00% 24 24 0.00% 25 10 0.00% 26 5 0.00% 27 13 0.00% 28 6 0.00% 29 12 0.00% 30 13 0.00% 31 14 0.00% 32 15 0.00% 33 16 0.00% 34 8 0.00% 35 13 0.00% 36 23 0.00% 37 17 0.00% 38 16 0.00% 39 16 0.00% 40 29 0.00% 41 27 0.00% 42 26 0.00% 43 35 0.00% 44 49 0.00% 45 51 0.00% 46 62 0.00% 47 52 0.00% 48 77 0.00% 49 73 0.00% 50 91 0.00% 51 88 0.00% 52 97 0.00% 53 114 0.00% 54 135 0.00% 55 165 0.00% 56 167 0.00% 57 189 0.00% 58 213 0.00% 59 250 0.00% 60 304 0.00% 61 332 0.00% 62 372 0.00% 63 448 0.00% 64 458 0.00% 65 552 0.00% 66 643 0.00% 67 771 0.00% 68 1197 0.01% 69 2262 0.01% 70 1749 0.01% 71 1283 0.01% 72 1389 0.01% 73 1487 0.01% 74 1595 0.01% 75 1751 0.01% 76 1959 0.01% 77 2183 0.01% 78 2416 0.01% 79 2798 0.02% 80 2962 0.02% 81 3413 0.02% 82 3893 0.02% 83 4309 0.02% 84 5761 0.03% 85 6658 0.04% 86 6948 0.04% 87 7486 0.04% 88 8081 0.04% 89 8513 0.05% 90 9087 0.05% 91 10173 0.06% 92 10635 0.06% 93 11688 0.06% 94 12594 0.07% 95 13617 0.08% 96 14316 0.08% 97 14820 0.08% 98 15523 0.09% 99 16302 0.09% 100 17526 0.10% 101 18364 0.10% 102 19489 0.11% 103 20621 0.11% 104 21919 0.12% 105 23754 0.13% 106 24553 0.14% 107 25358 0.14% 108 26013 0.14% 109 27684 0.15% 110 29021 0.16% 111 29957 0.17% 112 31428 0.17% 113 33288 0.18% 114 34573 0.19% 115 36808 0.20% 116 37947 0.21% 117 39391 0.22% 118 40774 0.22% 119 41875 0.23% 120 43406 0.24% 121 44813 0.25% 122 45929 0.25% 123 48056 0.27% 124 50761 0.28% 125 52603 0.29% 126 54895 0.30% 127 57244 0.32% 128 58972 0.33% 129 61219 0.34% 130 63307 0.35% 131 65185 0.36% 132 67601 0.37% 133 71236 0.39% 134 74434 0.41% 135 79224 0.44% 136 83530 0.46% 137 88945 0.49% 138 94162 0.52% 139 100193 0.55% 140 105331 0.58% 141 113824 0.63% 142 124448 0.69% 143 137470 0.76% 144 156324 0.86% 145 182437 1.01% 146 223352 1.23% 147 295846 1.63% 148 437796 2.41% 149 835278 4.61% 150 3975915 21.93% 151 9441677 52.08% 18130751 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=17 prefix-density=0.50 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=17.40 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.7 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGA criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=16 prefix-density=0.40 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=42.54 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.8 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7172459 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:58:10 Started mapping on | Feb 14 09:58:16 Finished on | Feb 14 10:00:21 Mapping speed, Million of reads per hour | 522.17 Number of input reads | 18130751 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16809056 Uniquely mapped reads % | 92.71% Average mapped length | 292.82 Number of splices: Total | 15671679 Number of splices: Annotated (sjdb) | 15287477 Number of splices: GT/AG | 15364426 Number of splices: GC/AG | 245712 Number of splices: AT/AC | 9254 Number of splices: Non-canonical | 52287 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 425983 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 258020 % of reads mapped to too many loci | 1.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 914262 914262 914262 N_multimapping 425983 425983 425983 N_noFeature 732481 16465181 892984 N_ambiguous 302921 1728 118373 UnstrandedReadsAssigned:15773654 PositiveStrandReadsAssigned:342147 NegativeStrandReadsAssigned:15797699 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172459 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172459-trimmed-pair1.fastq SRR7172459-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,130,751 reads, 15,977,245 reads pseudoaligned [quant] estimated average fragment length: 238.286 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,004 rounds 52401 SRR7172459.ke.tsv 34699 SRR7172459.se.tsv 87100 total ==> SRR7172459.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.71 1113 34.8444 Potri.005G024800.1.v4.1 1035 797.714 402 28.0938 Potri.004G059700.1.v4.1 961 723.8 17 1.30937 Potri.007G009000.2.v4.1 1416 1178.71 0 0 Potri.003G141000.2.v4.1 2943 2705.71 705.388 14.5338 Potri.016G087400.1.v4.1 270 84.6125 898 591.662 Potri.015G069301.1.v4.1 564 332.753 0 0 Potri.010G195200.1.v4.1 1773 1535.71 134 4.86437 Potri.012G127500.1.v4.1 977 739.745 158 11.9071 ==> SRR7172459.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1065 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 360 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 49 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7172459 completed mapping pipeline successfully