Starting /dee2/code/volunteer_pipeline.sh SRR7172460 current disk space = 3110319087616 free memory = 1574215844 SRR7172460 SRAfilesize 7fa0b86a46ccd2ed2282682afdc7687a SRR7172460.sra SRR7172460.sra file validated SRR7172460 is paired end SRR7172460 is conventional basespace SRR7172460 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172460_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02275 34.0 33.0 34.0 33.0 34.0 2 33.4255 34.0 34.0 34.0 33.0 34.0 3 33.4215 34.0 34.0 34.0 33.0 34.0 4 33.5225 34.0 34.0 34.0 33.0 34.0 5 33.48425 34.0 34.0 34.0 33.0 34.0 6 37.15475 38.0 38.0 38.0 36.0 38.0 7 37.50925 38.0 38.0 38.0 37.0 38.0 8 37.47725 38.0 38.0 38.0 37.0 38.0 9 37.5445 38.0 38.0 38.0 38.0 38.0 10-14 37.5298 38.0 38.0 38.0 38.0 38.0 15-19 37.55265 38.0 38.0 38.0 38.0 38.0 20-24 37.56410000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.49739999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.479949999999995 38.0 38.0 38.0 37.8 38.0 35-39 37.441649999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.296299999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.2256 38.0 38.0 38.0 36.6 38.0 50-54 37.0322 38.0 38.0 38.0 36.0 38.0 55-59 37.09255 38.0 38.0 38.0 36.0 38.0 60-64 37.06230000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.9593 38.0 38.0 38.0 36.0 38.0 70-74 36.86925 38.0 38.0 38.0 35.6 38.0 75-79 36.70035 38.0 38.0 38.0 34.8 38.0 80-84 36.64775 38.0 38.0 38.0 34.4 38.0 85-89 36.58695 38.0 38.0 38.0 34.2 38.0 90-94 36.402049999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.34015000000001 38.0 37.8 38.0 33.8 38.0 100-104 36.1214 38.0 37.4 38.0 33.2 38.0 105-109 35.9098 38.0 37.0 38.0 31.8 38.0 110-114 35.45925 38.0 36.6 38.0 29.4 38.0 115-119 35.5739 38.0 36.6 38.0 30.6 38.0 120-124 35.41025 38.0 36.0 38.0 30.2 38.0 125-129 34.92125 38.0 35.6 38.0 27.8 38.0 130-134 34.6914 38.0 35.2 38.0 27.2 38.0 135-139 34.25885 38.0 34.8 38.0 24.8 38.0 140-144 33.61375 38.0 33.8 38.0 21.8 38.0 145-149 32.496300000000005 38.0 33.2 38.0 13.6 38.0 150-151 28.153125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 2.0 16 2.0 17 2.0 18 2.0 19 4.0 20 8.0 21 9.0 22 12.0 23 15.0 24 16.0 25 17.0 26 16.0 27 25.0 28 24.0 29 40.0 30 47.0 31 67.0 32 76.0 33 89.0 34 165.0 35 314.0 36 705.0 37 2339.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.9368501141263 15.850874968298251 8.724321582551358 32.487953335024095 2 21.525 19.1 35.0 24.375 3 18.925 26.125 27.3 27.650000000000002 4 22.900000000000002 32.35 22.675 22.075 5 21.85 36.0 22.575 19.575 6 17.275 37.225 25.35 20.150000000000002 7 13.025 23.625 44.95 18.4 8 18.05 24.55 29.049999999999997 28.349999999999998 9 17.2 24.575 32.15 26.075 10-14 20.325 29.12 26.505000000000003 24.05 15-19 20.015 28.23 27.85 23.905 20-24 20.54 28.189999999999998 28.1 23.169999999999998 25-29 20.150000000000002 28.395 27.634999999999998 23.82 30-34 19.935 28.945 27.565 23.555 35-39 19.84 28.835 27.339999999999996 23.985 40-44 20.165 28.189999999999998 27.544999999999998 24.099999999999998 45-49 20.794999999999998 28.389999999999997 27.139999999999997 23.674999999999997 50-54 20.345 28.49 27.72 23.445 55-59 19.994999999999997 27.800000000000004 28.095 24.11 60-64 20.119999999999997 27.625 27.96 24.295 65-69 20.169999999999998 27.860000000000003 27.800000000000004 24.169999999999998 70-74 20.665 27.755000000000003 27.63 23.95 75-79 20.105 28.205000000000002 27.935 23.755000000000003 80-84 20.22 28.444999999999997 27.29 24.044999999999998 85-89 20.325 28.165000000000003 27.725 23.785 90-94 20.755000000000003 27.62 27.675 23.95 95-99 20.375 28.015 27.55 24.060000000000002 100-104 20.808727855069563 28.410569512561306 27.48974076669002 23.29096186567911 105-109 20.974999999999998 28.505000000000003 27.37 23.150000000000002 110-114 20.736472945891784 28.537074148296593 27.4749498997996 23.251503006012026 115-119 21.6 28.07 26.985 23.345 120-124 20.465 28.54 27.57 23.425 125-129 20.7 28.449999999999996 26.775 24.075 130-134 20.65 27.83 27.02 24.5 135-139 21.044999999999998 27.694999999999997 27.615000000000002 23.645 140-144 21.22 27.63 27.68 23.47 145-149 21.2 28.315 26.97 23.515 150-151 20.4625 28.249999999999996 27.075 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 1.5 18 1.0 19 1.0 20 1.0 21 1.0 22 0.5 23 1.0 24 1.0 25 2.0 26 4.5 27 8.5 28 11.5 29 15.0 30 20.0 31 24.5 32 31.0 33 43.0 34 57.5 35 66.0 36 81.5 37 110.5 38 141.0 39 169.0 40 181.0 41 189.0 42 211.5 43 243.5 44 270.0 45 264.0 46 258.0 47 264.0 48 244.0 49 208.0 50 171.0 51 142.5 52 121.5 53 99.0 54 77.5 55 62.5 56 46.0 57 40.0 58 37.5 59 22.5 60 16.5 61 12.5 62 8.0 63 7.0 64 3.0 65 1.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.09 105-109 0.0 110-114 0.2 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5542957923910304 1.0999999999999999 3 0.07558578987150416 0.22499999999999998 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.9249999999999998 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.4000000000000004 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.525 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.4375 0.0 0.0 0.0 0.0 130-131 4.9375 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.8875 0.0 0.0 0.0 0.0 136-137 6.375 0.0 0.0 0.0 0.0 138-139 7.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172460 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172460_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.594 33.0 33.0 34.0 32.0 34.0 2 32.65725 34.0 33.0 34.0 32.0 34.0 3 32.73475 34.0 33.0 34.0 32.0 34.0 4 32.58975 34.0 33.0 34.0 32.0 34.0 5 32.611 34.0 33.0 34.0 32.0 34.0 6 36.73625 38.0 38.0 38.0 36.0 38.0 7 36.769 38.0 38.0 38.0 36.0 38.0 8 36.77475 38.0 38.0 38.0 36.0 38.0 9 36.81475 38.0 38.0 38.0 36.0 38.0 10-14 36.77544999999999 38.0 38.0 38.0 36.2 38.0 15-19 36.75965 38.0 38.0 38.0 36.2 38.0 20-24 36.72860000000001 38.0 38.0 38.0 36.2 38.0 25-29 36.7076 38.0 38.0 38.0 36.2 38.0 30-34 36.656349999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.66485 38.0 38.0 38.0 36.0 38.0 40-44 36.63095 38.0 38.0 38.0 36.0 38.0 45-49 36.6108 38.0 38.0 38.0 36.0 38.0 50-54 36.544349999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.45005 38.0 38.0 38.0 35.4 38.0 60-64 36.4351 38.0 38.0 38.0 35.4 38.0 65-69 36.356500000000004 38.0 38.0 38.0 34.8 38.0 70-74 36.359 38.0 38.0 38.0 35.0 38.0 75-79 36.0042 38.0 38.0 38.0 33.8 38.0 80-84 36.057 38.0 38.0 38.0 34.0 38.0 85-89 36.060050000000004 38.0 38.0 38.0 34.0 38.0 90-94 35.8119 38.0 38.0 38.0 33.0 38.0 95-99 35.6147 38.0 38.0 38.0 31.8 38.0 100-104 35.606649999999995 38.0 38.0 38.0 31.8 38.0 105-109 35.2337 38.0 37.2 38.0 29.0 38.0 110-114 35.2808 38.0 37.6 38.0 31.0 38.0 115-119 35.04285 38.0 37.0 38.0 28.8 38.0 120-124 34.6528 38.0 36.0 38.0 26.4 38.0 125-129 34.44085 38.0 36.0 38.0 24.8 38.0 130-134 34.0058 38.0 35.4 38.0 23.2 38.0 135-139 33.5338 38.0 34.6 38.0 18.2 38.0 140-144 32.7885 38.0 33.4 38.0 13.4 38.0 145-149 32.2978 38.0 33.0 38.0 10.8 38.0 150-151 28.09275 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 3.0 4 2.0 5 3.0 6 3.0 7 3.0 8 5.0 9 3.0 10 6.0 11 5.0 12 7.0 13 6.0 14 5.0 15 5.0 16 7.0 17 10.0 18 9.0 19 13.0 20 14.0 21 8.0 22 16.0 23 16.0 24 21.0 25 17.0 26 17.0 27 24.0 28 29.0 29 48.0 30 38.0 31 63.0 32 75.0 33 84.0 34 132.0 35 220.0 36 535.0 37 2521.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.23510183555444 21.04601458385718 11.28991702288157 22.428966557706815 2 27.09433962264151 25.132075471698112 31.471698113207548 16.30188679245283 3 20.251572327044027 28.47798742138365 31.19496855345912 20.075471698113205 4 23.547169811320753 35.899371069182386 22.037735849056602 18.51572327044025 5 23.069182389937108 38.51572327044025 20.528301886792452 17.88679245283019 6 19.778838904247298 37.59738627795929 24.076401105805477 18.547373711987937 7 19.37672782106057 18.698165368182963 40.939934656948985 20.98517215380749 8 20.412267471091 24.43438914027149 29.688285570638513 25.465057817998993 9 21.97083961789844 25.314228255404725 28.934137757667173 23.78079436902966 10-14 23.338360985419808 29.12016088486677 26.0834590246355 21.458019105077927 15-19 22.75515334338864 27.978883861236802 27.86827551533434 21.39768728004022 20-24 23.34841628959276 27.621920563097035 27.828054298642535 21.20160884866767 25-29 22.680205086960893 27.983311551221473 28.37538956469287 20.96109379712476 30-34 22.583563709474742 28.439306358381504 27.614978637848708 21.36215129429505 35-39 22.87236716432916 27.96963756095109 28.110390589654656 21.0476046850651 40-44 22.85297666934835 28.077232502011263 27.91130329847144 21.158487530168944 45-49 23.33953441600885 27.371914123384784 28.221630046759515 21.06692141384685 50-54 22.81160440444467 28.11604404444668 27.935039469053248 21.137312082055406 55-59 23.799708410839074 27.454627721079884 28.0931074355236 20.652556432557436 60-64 23.07963000201086 27.63422481399558 27.855419264025738 21.430725919967827 65-69 23.080790307174098 27.721079885375293 27.997586848323365 21.200542959127244 70-74 23.2780291603821 27.621920563097035 27.561588738059328 21.53846153846154 75-79 23.147310206133735 28.230266465560582 27.50125691302162 21.121166415284062 80-84 22.675850972899593 27.638393081602896 28.191462617527275 21.494293327970233 85-89 23.359646035497008 28.25179747599175 27.080295640806472 21.30826084770476 90-94 23.11057474732237 28.058530698446223 27.731684014682962 21.099210539548448 95-99 23.500125722906713 26.985164697007797 28.187075685189843 21.32763389489565 100-104 23.4323930205662 28.314979634937398 27.128274752350784 21.124352592145623 105-109 23.823411102172166 27.961584875301686 27.84593724859212 20.36906677393403 110-114 23.611041279099 27.975262708029565 27.371914123384784 21.041781889486654 115-119 24.246995524714638 27.927792024940917 27.600945341177653 20.224267109166792 120-124 24.2885872297637 28.225238813474107 26.9482151835093 20.53795877325289 125-129 24.356395816572807 27.488938053097346 27.4788817377313 20.67578439259855 130-134 24.289951239129344 28.05006786306741 27.53229779319358 20.127683104609662 135-139 24.807721309003167 27.607701201427638 27.33624893178505 20.248328557784145 140-144 25.03393835788627 27.648448891346977 27.130574689526878 20.187038061239882 145-149 25.29538941123234 27.552918698778218 27.110463070038715 20.041228819950728 150-151 25.12569130216189 28.205128205128204 26.84766214177979 19.821518350930116 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 21.0 1 10.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 1.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 5.0 24 6.0 25 3.5 26 5.0 27 8.0 28 10.5 29 14.0 30 16.5 31 23.0 32 30.5 33 36.0 34 45.5 35 62.5 36 78.5 37 92.5 38 130.0 39 164.5 40 184.5 41 210.5 42 228.0 43 246.0 44 266.0 45 277.5 46 279.0 47 252.5 48 213.0 49 201.5 50 177.5 51 135.5 52 116.0 53 97.5 54 79.5 55 60.0 56 52.5 57 48.0 58 33.0 59 26.0 60 16.0 61 8.5 62 10.0 63 5.5 64 2.0 65 2.0 66 0.0 67 1.5 68 2.5 69 1.5 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.625 3 0.625 4 0.625 5 0.625 6 0.525 7 0.525 8 0.5499999999999999 9 0.5499999999999999 10-14 0.5499999999999999 15-19 0.5499999999999999 20-24 0.5499999999999999 25-29 0.53 30-34 0.525 35-39 0.5349999999999999 40-44 0.5599999999999999 45-49 0.555 50-54 0.555 55-59 0.545 60-64 0.54 65-69 0.545 70-74 0.5499999999999999 75-79 0.5499999999999999 80-84 0.555 85-89 0.555 90-94 0.565 95-99 0.575 100-104 0.565 105-109 0.5599999999999999 110-114 0.555 115-119 0.565 120-124 0.5499999999999999 125-129 0.5599999999999999 130-134 0.5349999999999999 135-139 0.5349999999999999 140-144 0.555 145-149 0.555 150-151 0.5499999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2137966015724 97.8 2 0.6593963986812071 1.3 3 0.050722799898554397 0.15 4 0.025361399949277198 0.1 5 0.025361399949277198 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025361399949277198 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 21 0.525 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 2.9749999999999996 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.2625 0.0 0.0 0.0 0.0 130-131 4.725 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.6875 0.0 0.0 0.0 0.0 136-137 6.15 0.0 0.0 0.0 0.0 138-139 6.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758374 spots for SRR7172460.sra Written 758374 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra Read 758368 spots for SRR7172460.sra Written 758368 spots for SRR7172460.sra SRR ids: ['SRR7172460.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3uz8_1qz SRR7172460.sra spots: 15167366 blocks: [[1, 758368], [758369, 1516736], [1516737, 2275104], [2275105, 3033472], [3033473, 3791840], [3791841, 4550208], [4550209, 5308576], [5308577, 6066944], [6066945, 6825312], [6825313, 7583680], [7583681, 8342048], [8342049, 9100416], [9100417, 9858784], [9858785, 10617152], [10617153, 11375520], [11375521, 12133888], [12133889, 12892256], [12892257, 13650624], [13650625, 14408992], [14408993, 15167366]] SRR7172460 file size 5118022 SRR7172460 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172460 SRR7172460_1.fastq SRR7172460_2.fastq Input file: SRR7172460_1.fastq Paired file: SRR7172460_2.fastq trimmed: SRR7172460-trimmed-pair1.fastq, SRR7172460-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 19:30:46 2025 >> started Fri Feb 14 19:31:01 2025 >> done (15.885s) 15167366 read pairs processed; of these: 23473 ( 0.15%) short read pairs filtered out after trimming by size control 104923 ( 0.69%) empty read pairs filtered out after trimming by size control 15038970 (99.15%) read pairs available; of these: 8022382 (53.34%) trimmed read pairs available after processing 7016588 (46.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 6 0.00% 21 9 0.00% 22 3 0.00% 23 8 0.00% 24 6 0.00% 25 9 0.00% 26 10 0.00% 27 14 0.00% 28 8 0.00% 29 14 0.00% 30 12 0.00% 31 12 0.00% 32 11 0.00% 33 7 0.00% 34 13 0.00% 35 19 0.00% 36 17 0.00% 37 15 0.00% 38 25 0.00% 39 24 0.00% 40 23 0.00% 41 20 0.00% 42 32 0.00% 43 47 0.00% 44 43 0.00% 45 45 0.00% 46 41 0.00% 47 48 0.00% 48 64 0.00% 49 61 0.00% 50 62 0.00% 51 91 0.00% 52 117 0.00% 53 106 0.00% 54 125 0.00% 55 122 0.00% 56 156 0.00% 57 171 0.00% 58 198 0.00% 59 249 0.00% 60 252 0.00% 61 308 0.00% 62 358 0.00% 63 365 0.00% 64 439 0.00% 65 444 0.00% 66 524 0.00% 67 613 0.00% 68 720 0.00% 69 873 0.01% 70 1014 0.01% 71 934 0.01% 72 1129 0.01% 73 1226 0.01% 74 1360 0.01% 75 1586 0.01% 76 1622 0.01% 77 1844 0.01% 78 2038 0.01% 79 2338 0.02% 80 2507 0.02% 81 2867 0.02% 82 3371 0.02% 83 3758 0.02% 84 4964 0.03% 85 5812 0.04% 86 6201 0.04% 87 6481 0.04% 88 6983 0.05% 89 7334 0.05% 90 7884 0.05% 91 8503 0.06% 92 9356 0.06% 93 10204 0.07% 94 10722 0.07% 95 11651 0.08% 96 11871 0.08% 97 12227 0.08% 98 12705 0.08% 99 13417 0.09% 100 14393 0.10% 101 15051 0.10% 102 15925 0.11% 103 16965 0.11% 104 17931 0.12% 105 19051 0.13% 106 19821 0.13% 107 20577 0.14% 108 21838 0.15% 109 22745 0.15% 110 23487 0.16% 111 24649 0.16% 112 25490 0.17% 113 27179 0.18% 114 28256 0.19% 115 29816 0.20% 116 30683 0.20% 117 31863 0.21% 118 32771 0.22% 119 33497 0.22% 120 35431 0.24% 121 35781 0.24% 122 37844 0.25% 123 40122 0.27% 124 41715 0.28% 125 43515 0.29% 126 45751 0.30% 127 47276 0.31% 128 49183 0.33% 129 51356 0.34% 130 52873 0.35% 131 55415 0.37% 132 57998 0.39% 133 61631 0.41% 134 64412 0.43% 135 69230 0.46% 136 72641 0.48% 137 77058 0.51% 138 82487 0.55% 139 88818 0.59% 140 96095 0.64% 141 104186 0.69% 142 115458 0.77% 143 129975 0.86% 144 149594 0.99% 145 177616 1.18% 146 218819 1.46% 147 292860 1.95% 148 446343 2.97% 149 848703 5.64% 150 3679323 24.47% 151 7016588 46.66% 15038970 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=15 prefix-density=0.49 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=386.39 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.63 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=33.98 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7172460 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 19:32:34 Started mapping on | Feb 14 19:32:34 Finished on | Feb 14 19:34:30 Mapping speed, Million of reads per hour | 466.73 Number of input reads | 15038970 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13930642 Uniquely mapped reads % | 92.63% Average mapped length | 292.41 Number of splices: Total | 13290652 Number of splices: Annotated (sjdb) | 12982488 Number of splices: GT/AG | 13018176 Number of splices: GC/AG | 221654 Number of splices: AT/AC | 7999 Number of splices: Non-canonical | 42823 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404124 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 171804 % of reads mapped to too many loci | 1.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 724823 724823 724823 N_multimapping 404124 404124 404124 N_noFeature 612742 13695999 714227 N_ambiguous 235728 1047 101902 UnstrandedReadsAssigned:13082172 PositiveStrandReadsAssigned:233596 NegativeStrandReadsAssigned:13114513 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172460 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172460-trimmed-pair1.fastq SRR7172460-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,038,970 reads, 13,190,794 reads pseudoaligned [quant] estimated average fragment length: 248.093 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 993 rounds 52401 SRR7172460.ke.tsv 34699 SRR7172460.se.tsv 87100 total ==> SRR7172460.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.91 463 18.3036 Potri.005G024800.1.v4.1 1035 787.907 166 14.7498 Potri.004G059700.1.v4.1 961 714.012 17 1.66685 Potri.007G009000.2.v4.1 1416 1168.91 0 0 Potri.003G141000.2.v4.1 2943 2695.91 843.434 21.9028 Potri.016G087400.1.v4.1 270 83.035 667 562.363 Potri.015G069301.1.v4.1 564 325.886 0 0 Potri.010G195200.1.v4.1 1773 1525.91 54 2.47753 Potri.012G127500.1.v4.1 977 729.97 123 11.7965 ==> SRR7172460.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 809 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 207 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 33 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7172460 completed mapping pipeline successfully