Starting /dee2/code/volunteer_pipeline.sh SRR7172461 current disk space = 3110583869440 free memory = 1279760984 SRR7172461 SRAfilesize 7b394ee219aef683e3ff2bb40110328a SRR7172461.sra SRR7172461.sra file validated SRR7172461 is paired end SRR7172461 is conventional basespace SRR7172461 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172461_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.779 34.0 33.0 34.0 33.0 34.0 2 33.3545 34.0 34.0 34.0 33.0 34.0 3 33.40475 34.0 34.0 34.0 33.0 34.0 4 33.44725 34.0 34.0 34.0 33.0 34.0 5 33.506 34.0 34.0 34.0 33.0 34.0 6 37.1365 38.0 38.0 38.0 36.0 38.0 7 37.52425 38.0 38.0 38.0 37.0 38.0 8 37.53625 38.0 38.0 38.0 38.0 38.0 9 37.522 38.0 38.0 38.0 38.0 38.0 10-14 37.571099999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.562 38.0 38.0 38.0 38.0 38.0 20-24 37.55135 38.0 38.0 38.0 38.0 38.0 25-29 37.493449999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.45915 38.0 38.0 38.0 38.0 38.0 35-39 37.427099999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.2666 38.0 38.0 38.0 37.0 38.0 45-49 37.1627 38.0 38.0 38.0 36.2 38.0 50-54 37.1091 38.0 38.0 38.0 36.0 38.0 55-59 37.079350000000005 38.0 38.0 38.0 36.0 38.0 60-64 37.06505 38.0 38.0 38.0 36.0 38.0 65-69 36.9094 38.0 38.0 38.0 36.0 38.0 70-74 36.85365 38.0 38.0 38.0 35.4 38.0 75-79 36.72725 38.0 38.0 38.0 34.8 38.0 80-84 36.58225 38.0 38.0 38.0 34.4 38.0 85-89 36.489900000000006 38.0 38.0 38.0 34.2 38.0 90-94 36.421499999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.29205 38.0 38.0 38.0 34.0 38.0 100-104 36.074 38.0 37.0 38.0 33.2 38.0 105-109 35.86955 38.0 37.0 38.0 32.6 38.0 110-114 35.49675 38.0 36.8 38.0 30.4 38.0 115-119 35.51795 38.0 36.4 38.0 30.2 38.0 120-124 35.14965 38.0 36.0 38.0 28.6 38.0 125-129 34.83575 38.0 35.4 38.0 27.6 38.0 130-134 34.56 38.0 35.0 38.0 26.2 38.0 135-139 34.01065 38.0 34.6 38.0 23.4 38.0 140-144 33.250550000000004 38.0 33.2 38.0 17.4 38.0 145-149 32.3135 38.0 32.8 38.0 13.4 38.0 150-151 28.01925 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 2.0 16 2.0 17 3.0 18 5.0 19 3.0 20 3.0 21 17.0 22 9.0 23 9.0 24 10.0 25 18.0 26 28.0 27 27.0 28 43.0 29 41.0 30 41.0 31 56.0 32 61.0 33 108.0 34 173.0 35 285.0 36 793.0 37 2258.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.91517629024017 13.719979560551865 8.405723045477773 39.9591211037302 2 20.474999999999998 19.5 36.225 23.799999999999997 3 19.3 24.8 26.8 29.099999999999998 4 22.475 32.824999999999996 22.425 22.275 5 21.525 35.949999999999996 24.2 18.325 6 16.75 36.775000000000006 26.400000000000002 20.075000000000003 7 13.100000000000001 22.7 44.824999999999996 19.375 8 16.55 23.275000000000002 32.375 27.800000000000004 9 17.4 22.45 33.975 26.174999999999997 10-14 19.470000000000002 29.92 26.825 23.785 15-19 19.965 28.325 27.935 23.775 20-24 19.31 28.845 28.000000000000004 23.845 25-29 19.675 28.575 28.015 23.735 30-34 19.595000000000002 29.01 27.250000000000004 24.145 35-39 20.525 28.535 27.639999999999997 23.3 40-44 19.775000000000002 29.185 27.455000000000002 23.585 45-49 19.97 28.744999999999997 27.235 24.05 50-54 20.14 28.82 27.55 23.49 55-59 19.555 28.34 28.43 23.674999999999997 60-64 20.424999999999997 28.449999999999996 27.32 23.805 65-69 20.200000000000003 29.049999999999997 27.12 23.630000000000003 70-74 19.99199919991999 28.047804780478046 28.217821782178216 23.742374237423743 75-79 20.21 28.910000000000004 27.315 23.565 80-84 19.695 28.849999999999998 27.85 23.605 85-89 20.455000000000002 28.13 27.16 24.255 90-94 20.205000000000002 27.715 28.294999999999998 23.785 95-99 19.945 28.49 27.71 23.855 100-104 20.593682735145418 27.696851379085945 27.80697802472844 23.902487861040196 105-109 19.984996249062263 27.906976744186046 27.696924231057764 24.411102775693923 110-114 20.61034275405893 28.48767288033674 27.951493285227503 22.95049108037683 115-119 20.713106966044904 28.674301145171775 27.17407611141671 23.438515777366607 120-124 20.325 28.410000000000004 27.215 24.05 125-129 20.78 27.975 27.794999999999998 23.45 130-134 21.235 28.18 26.985 23.599999999999998 135-139 20.65 28.349999999999998 27.134999999999998 23.865 140-144 21.05 28.68 26.99 23.28 145-149 20.755000000000003 28.689999999999998 26.775 23.78 150-151 20.575 28.175 27.3875 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 3.0 24 4.5 25 5.5 26 6.5 27 11.0 28 12.5 29 12.0 30 17.5 31 24.5 32 31.0 33 45.5 34 56.5 35 75.0 36 97.5 37 107.5 38 136.5 39 171.0 40 194.0 41 223.5 42 235.0 43 244.0 44 255.0 45 262.0 46 264.0 47 251.0 48 238.0 49 205.0 50 179.0 51 152.5 52 115.0 53 95.0 54 71.5 55 49.0 56 40.5 57 31.0 58 18.0 59 15.5 60 16.0 61 8.5 62 4.0 63 3.0 64 2.0 65 1.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.11499999999999999 105-109 0.025 110-114 0.22 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5035246727089627 1.0 3 0.10070493454179255 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.6749999999999998 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.4625 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.475 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.3625 0.0 0.0 0.0 0.0 132-133 4.862500000000001 0.0 0.0 0.0 0.0 134-135 5.2125 0.0 0.0 0.0 0.0 136-137 5.637499999999999 0.0 0.0 0.0 0.0 138-139 5.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCACCT 20 0.005975278 28.960001 80-84 >>END_MODULE SRR7172461 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172461_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5355 33.0 33.0 34.0 32.0 34.0 2 32.60075 34.0 33.0 34.0 32.0 34.0 3 32.66625 34.0 33.0 34.0 32.0 34.0 4 32.50125 34.0 33.0 34.0 32.0 34.0 5 32.62 34.0 33.0 34.0 32.0 34.0 6 36.717 38.0 38.0 38.0 36.0 38.0 7 36.657 38.0 38.0 38.0 36.0 38.0 8 36.772 38.0 38.0 38.0 36.0 38.0 9 36.7245 38.0 38.0 38.0 36.0 38.0 10-14 36.748599999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.79495 38.0 38.0 38.0 36.6 38.0 20-24 36.739599999999996 38.0 38.0 38.0 36.6 38.0 25-29 36.7761 38.0 38.0 38.0 36.6 38.0 30-34 36.662400000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.6326 38.0 38.0 38.0 36.0 38.0 40-44 36.661300000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.64285 38.0 38.0 38.0 36.0 38.0 50-54 36.59695000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.5463 38.0 38.0 38.0 35.8 38.0 60-64 36.487049999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.409400000000005 38.0 38.0 38.0 35.2 38.0 70-74 36.362849999999995 38.0 38.0 38.0 35.0 38.0 75-79 36.239799999999995 38.0 38.0 38.0 34.2 38.0 80-84 36.148399999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.1393 38.0 38.0 38.0 34.0 38.0 90-94 35.927350000000004 38.0 38.0 38.0 33.2 38.0 95-99 35.768950000000004 38.0 38.0 38.0 33.2 38.0 100-104 35.62205 38.0 38.0 38.0 31.8 38.0 105-109 35.4745 38.0 37.4 38.0 30.6 38.0 110-114 35.3556 38.0 37.2 38.0 30.2 38.0 115-119 35.043549999999996 38.0 36.8 38.0 28.2 38.0 120-124 34.6828 38.0 36.0 38.0 26.6 38.0 125-129 34.482299999999995 38.0 36.0 38.0 25.0 38.0 130-134 34.13155 38.0 35.4 38.0 23.4 38.0 135-139 33.57195 38.0 33.8 38.0 20.6 38.0 140-144 32.78745 38.0 33.0 38.0 13.4 38.0 145-149 31.8658 38.0 33.0 38.0 8.6 38.0 150-151 27.451 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 5.0 4 3.0 5 1.0 6 0.0 7 3.0 8 1.0 9 5.0 10 3.0 11 4.0 12 5.0 13 4.0 14 5.0 15 3.0 16 6.0 17 6.0 18 11.0 19 4.0 20 8.0 21 8.0 22 20.0 23 12.0 24 16.0 25 26.0 26 30.0 27 36.0 28 49.0 29 27.0 30 47.0 31 51.0 32 61.0 33 96.0 34 136.0 35 221.0 36 556.0 37 2498.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.07157258064516 20.161290322580644 12.75201612903226 30.015120967741936 2 24.880262162843458 26.59440383161079 33.324930678094276 15.200403327451475 3 20.832282471626733 28.14627994955864 31.223203026481716 19.798234552332914 4 24.161412358133667 35.40983606557377 22.06809583858764 18.360655737704917 5 23.505674653215635 36.948297604035304 23.329129886506937 16.21689785624212 6 18.550213944122827 38.96300025169897 24.540649383337527 17.946136420840674 7 19.234642497482376 17.82477341389728 42.11983887210473 20.82074521651561 8 19.859048577900833 24.339290208910143 29.34809967279134 26.453561540397686 9 20.76516486282406 25.220236597029956 30.002516989680345 24.012081550465645 10-14 23.028899405900717 28.637599436109152 26.79991944416474 21.533581713825395 15-19 22.996375352396296 27.406363270237616 28.38803866290777 21.209222714458317 20-24 22.547193556506418 28.396677573621947 28.265794110244148 20.790334759627484 25-29 22.832980972515855 27.609986912312497 28.641900734923993 20.915131380247658 30-34 22.586814292903874 28.152994464016107 28.359335681932563 20.90085556114746 35-39 22.45041779925501 28.4103493405819 28.505990133897114 20.633242726265983 40-44 22.363187836681266 28.384433368574737 27.89608820419876 21.356290590545235 45-49 22.824773413897283 28.35850956696878 28.157099697885197 20.659617321248742 50-54 22.934394038568048 27.92910729570515 28.19092694224863 20.945571723478174 55-59 23.029296285110238 28.19893285009564 27.549582200744993 21.22218866404913 60-64 22.886047916247232 27.954499698006845 28.211193879605396 20.948258506140526 65-69 22.894538132393656 27.51573118550214 28.43191542914674 21.157815252957462 70-74 23.464559001208215 27.471808296415627 28.096053161498187 20.96757954087797 75-79 23.18147495595268 27.480493329977346 28.356405738736473 20.9816259753335 80-84 23.5448136958711 27.633434038267872 27.829808660624373 20.991943605236656 85-89 23.065693430656932 28.250692172162097 27.676818525044045 21.006795872136923 90-94 23.029662083899886 28.015309462658006 28.18149770861661 20.773530744825504 95-99 23.299259781459288 28.133340047333704 27.48376051160683 21.08363965960018 100-104 23.22021951465109 28.018326452522402 28.06363910985802 20.697814922968483 105-109 23.524969794603305 27.512082158679018 28.564236810310106 20.39871123640757 110-114 23.765167917023312 28.029807159760335 28.150646996626556 20.0543779265898 115-119 23.610271903323262 27.83484390735146 27.819738167170193 20.735146022155085 120-124 24.545683362698213 27.676818525044045 27.39491568084571 20.38258243141203 125-129 23.66977095393909 27.81273596778253 27.858041782028693 20.659451296249685 130-134 24.08134501157757 27.609986912312497 28.193899124131683 20.114768951978252 135-139 24.8666062619551 27.896909292258133 27.524413570925198 19.712070874861574 140-144 24.424867858041782 27.908381575635538 27.72715831865089 19.939592247671783 145-149 25.178733259490482 27.927701137851173 27.172490182257576 19.721075420400766 150-151 25.588420390182502 27.891755821271243 27.300188797986152 19.2196349905601 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 26.0 1 13.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 3.0 22 3.5 23 2.0 24 3.5 25 6.0 26 6.5 27 6.0 28 8.0 29 12.5 30 16.0 31 21.5 32 31.0 33 37.5 34 55.5 35 72.5 36 87.0 37 108.5 38 136.0 39 174.5 40 196.5 41 215.0 42 242.5 43 256.0 44 275.5 45 299.5 46 271.0 47 231.5 48 215.0 49 182.5 50 165.0 51 152.5 52 112.0 53 86.0 54 74.5 55 52.5 56 42.0 57 39.5 58 25.0 59 14.0 60 9.5 61 6.5 62 5.0 63 2.5 64 2.5 65 2.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.8250000000000001 3 0.8750000000000001 4 0.8750000000000001 5 0.8750000000000001 6 0.675 7 0.7000000000000001 8 0.675 9 0.675 10-14 0.69 15-19 0.6799999999999999 20-24 0.675 25-29 0.67 30-34 0.65 35-39 0.67 40-44 0.685 45-49 0.7000000000000001 50-54 0.695 55-59 0.67 60-64 0.66 65-69 0.675 70-74 0.6799999999999999 75-79 0.675 80-84 0.7000000000000001 85-89 0.675 90-94 0.715 95-99 0.705 100-104 0.69 105-109 0.6799999999999999 110-114 0.695 115-119 0.7000000000000001 120-124 0.675 125-129 0.675 130-134 0.67 135-139 0.67 140-144 0.675 145-149 0.69 150-151 0.6875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34026896726719 97.875 2 0.5074854097944683 1.0 3 0.07612281146917026 0.22499999999999998 4 0.0 0.0 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.025374270489723422 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025374270489723422 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 24 0.6 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.6749999999999998 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.5999999999999996 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.4124999999999996 0.0 0.0 0.0 0.0 128-129 3.8375 0.0 0.0 0.0 0.0 130-131 4.3 0.0 0.0 0.0 0.0 132-133 4.775 0.0 0.0 0.0 0.0 134-135 5.1625 0.0 0.0 0.0 0.0 136-137 5.612500000000001 0.0 0.0 0.0 0.0 138-139 5.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTTT 10 0.00682755 145.0 2 >>END_MODULE Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra Read 827602 spots for SRR7172461.sra Written 827602 spots for SRR7172461.sra Read 827597 spots for SRR7172461.sra Written 827597 spots for SRR7172461.sra SRR ids: ['SRR7172461.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vnf5v1ek SRR7172461.sra spots: 16551945 blocks: [[1, 827597], [827598, 1655194], [1655195, 2482791], [2482792, 3310388], [3310389, 4137985], [4137986, 4965582], [4965583, 5793179], [5793180, 6620776], [6620777, 7448373], [7448374, 8275970], [8275971, 9103567], [9103568, 9931164], [9931165, 10758761], [10758762, 11586358], [11586359, 12413955], [12413956, 13241552], [13241553, 14069149], [14069150, 14896746], [14896747, 15724343], [15724344, 16551945]] SRR7172461 file size 5587210 SRR7172461 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172461 SRR7172461_1.fastq SRR7172461_2.fastq Input file: SRR7172461_1.fastq Paired file: SRR7172461_2.fastq trimmed: SRR7172461-trimmed-pair1.fastq, SRR7172461-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 18:15:57 2025 >> started Fri Feb 14 18:16:45 2025 >> done (47.871s) 16551945 read pairs processed; of these: 17251 ( 0.10%) short read pairs filtered out after trimming by size control 106641 ( 0.64%) empty read pairs filtered out after trimming by size control 16428053 (99.25%) read pairs available; of these: 8533813 (51.95%) trimmed read pairs available after processing 7894240 (48.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 2 0.00% 20 5 0.00% 21 5 0.00% 22 8 0.00% 23 10 0.00% 24 5 0.00% 25 6 0.00% 26 14 0.00% 27 7 0.00% 28 11 0.00% 29 12 0.00% 30 10 0.00% 31 5 0.00% 32 11 0.00% 33 8 0.00% 34 6 0.00% 35 7 0.00% 36 12 0.00% 37 15 0.00% 38 22 0.00% 39 23 0.00% 40 28 0.00% 41 23 0.00% 42 29 0.00% 43 38 0.00% 44 37 0.00% 45 46 0.00% 46 43 0.00% 47 64 0.00% 48 63 0.00% 49 64 0.00% 50 88 0.00% 51 95 0.00% 52 102 0.00% 53 127 0.00% 54 117 0.00% 55 131 0.00% 56 130 0.00% 57 181 0.00% 58 206 0.00% 59 228 0.00% 60 257 0.00% 61 319 0.00% 62 349 0.00% 63 388 0.00% 64 481 0.00% 65 472 0.00% 66 564 0.00% 67 575 0.00% 68 682 0.00% 69 948 0.01% 70 1013 0.01% 71 1070 0.01% 72 1131 0.01% 73 1295 0.01% 74 1555 0.01% 75 1717 0.01% 76 1695 0.01% 77 1957 0.01% 78 2203 0.01% 79 2442 0.01% 80 2759 0.02% 81 3051 0.02% 82 3522 0.02% 83 3997 0.02% 84 4994 0.03% 85 5780 0.04% 86 5993 0.04% 87 6526 0.04% 88 6946 0.04% 89 7380 0.04% 90 7995 0.05% 91 8689 0.05% 92 9134 0.06% 93 10410 0.06% 94 11237 0.07% 95 11123 0.07% 96 11842 0.07% 97 12545 0.08% 98 12976 0.08% 99 13762 0.08% 100 14499 0.09% 101 14912 0.09% 102 16050 0.10% 103 16874 0.10% 104 17752 0.11% 105 19256 0.12% 106 20320 0.12% 107 20750 0.13% 108 22046 0.13% 109 22940 0.14% 110 23529 0.14% 111 24526 0.15% 112 25593 0.16% 113 27220 0.17% 114 28259 0.17% 115 29991 0.18% 116 31093 0.19% 117 32152 0.20% 118 33389 0.20% 119 34270 0.21% 120 35423 0.22% 121 36754 0.22% 122 38510 0.23% 123 40883 0.25% 124 42303 0.26% 125 44088 0.27% 126 46500 0.28% 127 48467 0.30% 128 50312 0.31% 129 52909 0.32% 130 54681 0.33% 131 56811 0.35% 132 59550 0.36% 133 63228 0.38% 134 66371 0.40% 135 70647 0.43% 136 74889 0.46% 137 80798 0.49% 138 85592 0.52% 139 92707 0.56% 140 99892 0.61% 141 108847 0.66% 142 119590 0.73% 143 135703 0.83% 144 159368 0.97% 145 187914 1.14% 146 233623 1.42% 147 314451 1.91% 148 471031 2.87% 149 911735 5.55% 150 3990985 24.29% 151 7894240 48.05% 16428053 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=11 prefix-density=0.46 prefix-fanout=2.4 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=11.25 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.5 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=18 prefix-density=0.56 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=55.04 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.1 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7172461 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:17:33 Started mapping on | Feb 14 18:17:33 Finished on | Feb 14 18:19:49 Mapping speed, Million of reads per hour | 434.86 Number of input reads | 16428053 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15374719 Uniquely mapped reads % | 93.59% Average mapped length | 292.98 Number of splices: Total | 14742820 Number of splices: Annotated (sjdb) | 14411764 Number of splices: GT/AG | 14453703 Number of splices: GC/AG | 234030 Number of splices: AT/AC | 8250 Number of splices: Non-canonical | 46837 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 467004 % of reads mapped to multiple loci | 2.84% Number of reads mapped to too many loci | 40713 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 601555 601555 601555 N_multimapping 467004 467004 467004 N_noFeature 597421 15118644 729485 N_ambiguous 239661 1206 114804 UnstrandedReadsAssigned:14537637 PositiveStrandReadsAssigned:254869 NegativeStrandReadsAssigned:14530430 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172461 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172461-trimmed-pair1.fastq SRR7172461-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,428,053 reads, 14,524,415 reads pseudoaligned [quant] estimated average fragment length: 247.955 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR7172461.ke.tsv 34699 SRR7172461.se.tsv 87100 total ==> SRR7172461.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.04 1076 40.8519 Potri.005G024800.1.v4.1 1035 788.045 370 31.5704 Potri.004G059700.1.v4.1 961 714.185 7 0.659048 Potri.007G009000.2.v4.1 1416 1169.04 0 0 Potri.003G141000.2.v4.1 2943 2696.04 831 20.7254 Potri.016G087400.1.v4.1 270 82.1125 835 683.765 Potri.015G069301.1.v4.1 564 325.849 0 0 Potri.010G195200.1.v4.1 1773 1526.04 637.978 28.1105 Potri.012G127500.1.v4.1 977 730.119 71 6.53875 ==> SRR7172461.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1052 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 257 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 37 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR7172461 completed mapping pipeline successfully