Starting /dee2/code/volunteer_pipeline.sh SRR7172462 current disk space = 3109767380992 free memory = 1577736640 SRR7172462 SRAfilesize 31acda3b7ec1a59a3aff027c46bb9aa0 SRR7172462.sra SRR7172462.sra file validated SRR7172462 is paired end SRR7172462 is conventional basespace SRR7172462 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59825 34.0 33.0 34.0 33.0 34.0 2 33.367 34.0 33.0 34.0 33.0 34.0 3 33.39525 34.0 34.0 34.0 33.0 34.0 4 33.50075 34.0 34.0 34.0 33.0 34.0 5 33.487 34.0 34.0 34.0 33.0 34.0 6 37.183 38.0 38.0 38.0 36.0 38.0 7 37.405 38.0 38.0 38.0 37.0 38.0 8 37.495 38.0 38.0 38.0 37.0 38.0 9 37.4935 38.0 38.0 38.0 38.0 38.0 10-14 37.52925 38.0 38.0 38.0 38.0 38.0 15-19 37.446099999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.4575 38.0 38.0 38.0 37.8 38.0 25-29 37.46065 38.0 38.0 38.0 38.0 38.0 30-34 37.4492 38.0 38.0 38.0 37.6 38.0 35-39 37.3454 38.0 38.0 38.0 37.2 38.0 40-44 37.1472 38.0 38.0 38.0 36.4 38.0 45-49 37.046949999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.972649999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.9576 38.0 38.0 38.0 35.8 38.0 60-64 36.84275 38.0 38.0 38.0 35.2 38.0 65-69 36.77575 38.0 38.0 38.0 35.0 38.0 70-74 36.65075 38.0 38.0 38.0 34.4 38.0 75-79 36.56355 38.0 38.0 38.0 34.4 38.0 80-84 36.43825 38.0 38.0 38.0 34.0 38.0 85-89 36.338049999999996 38.0 37.8 38.0 34.0 38.0 90-94 36.154700000000005 38.0 37.4 38.0 33.2 38.0 95-99 35.97775 38.0 37.0 38.0 32.6 38.0 100-104 35.697799999999994 38.0 36.8 38.0 30.6 38.0 105-109 35.59805 38.0 36.6 38.0 30.6 38.0 110-114 35.39895 38.0 36.0 38.0 29.4 38.0 115-119 35.17385 38.0 35.8 38.0 28.6 38.0 120-124 34.8283 38.0 35.0 38.0 27.6 38.0 125-129 34.472750000000005 38.0 35.0 38.0 25.6 38.0 130-134 34.1064 38.0 34.4 38.0 23.8 38.0 135-139 33.667899999999996 38.0 34.0 38.0 22.2 38.0 140-144 32.918099999999995 38.0 33.4 38.0 15.8 38.0 145-149 31.9784 38.0 32.2 38.0 10.8 38.0 150-151 26.794125 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 3.0 9 1.0 10 1.0 11 2.0 12 1.0 13 1.0 14 0.0 15 5.0 16 1.0 17 3.0 18 3.0 19 7.0 20 3.0 21 5.0 22 13.0 23 8.0 24 14.0 25 23.0 26 18.0 27 29.0 28 32.0 29 39.0 30 57.0 31 67.0 32 94.0 33 144.0 34 187.0 35 377.0 36 857.0 37 2004.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.43827160493827 14.531893004115226 8.30761316872428 34.72222222222222 2 21.525 19.475 35.0 24.0 3 19.025 24.6 27.450000000000003 28.925 4 24.099999999999998 31.574999999999996 23.25 21.075 5 21.575 36.449999999999996 22.475 19.5 6 17.4 37.125 25.0 20.474999999999998 7 14.025000000000002 23.724999999999998 43.6 18.65 8 17.150000000000002 23.474999999999998 30.975 28.4 9 17.1 23.575 33.550000000000004 25.775 10-14 20.285 29.195 26.555 23.965 15-19 19.965 28.144999999999996 27.939999999999998 23.95 20-24 20.28 28.515 28.08 23.125 25-29 20.41102055102755 28.7764388219411 27.58137906895345 23.231161558077904 30-34 19.87298094714207 29.124368655298294 27.889183377506626 23.113467020053008 35-39 20.017010206123675 28.83730238142886 27.22633580148089 23.91935161096658 40-44 20.053047742968673 28.630767690921832 27.519767791011912 23.796416775097587 45-49 20.163146832148936 28.550695626063455 27.795015513962568 23.491142027825042 50-54 20.147125056297853 27.708552269429017 28.128909573137168 24.015413101135966 55-59 20.030045067601403 28.5728592889334 27.746619929894845 23.650475713570355 60-64 20.37871956717764 27.993187055405272 28.37391042981665 23.25418294760044 65-69 20.045090180360724 28.45190380761523 27.444889779559116 24.05811623246493 70-74 20.775706554419724 28.4225295650431 27.154740428943676 23.647023451593505 75-79 20.205462290152845 28.78476572287647 27.662240040090204 23.34753194688048 80-84 20.130260521042086 29.03807615230461 27.48496993987976 23.34669338677355 85-89 20.38057085628443 28.467701552328496 27.55132699048573 23.600400600901352 90-94 20.652337291447466 27.511398366651633 27.621624329876248 24.214640012024653 95-99 20.378624730805832 28.306706065007265 27.65062352882256 23.66404567536435 100-104 21.083462674610725 28.608621639212938 27.366945376257952 22.94097030991839 105-109 20.795950077690343 28.464738609593503 26.89088266252318 23.848428650192975 110-114 21.026000701367668 28.044687139922846 27.378387856319826 23.55092430238966 115-119 20.965883472771903 28.210009518561197 27.784179149341213 23.039927859325683 120-124 21.09 28.199999999999996 27.0 23.71 125-129 20.565 28.565 27.66 23.21 130-134 21.45 28.63 26.695 23.225 135-139 21.435000000000002 28.265 27.125 23.175 140-144 21.0 28.310000000000002 27.6 23.09 145-149 20.349999999999998 28.189999999999998 27.405 24.055 150-151 21.025 27.462500000000002 27.3625 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 1.5 21 2.5 22 1.5 23 2.5 24 6.0 25 6.0 26 4.5 27 9.0 28 15.0 29 15.5 30 18.0 31 26.5 32 35.5 33 45.5 34 52.5 35 66.0 36 90.5 37 117.5 38 145.5 39 170.0 40 201.0 41 216.0 42 232.5 43 245.5 44 244.5 45 259.5 46 251.0 47 229.5 48 222.5 49 203.0 50 171.0 51 140.5 52 121.0 53 98.5 54 76.0 55 62.5 56 46.5 57 42.0 58 33.5 59 20.5 60 16.5 61 12.0 62 6.0 63 3.0 64 1.0 65 1.5 66 2.5 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.8000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.015 35-39 0.06 40-44 0.09 45-49 0.09 50-54 0.08499999999999999 55-59 0.15 60-64 0.19 65-69 0.2 70-74 0.22 75-79 0.22499999999999998 80-84 0.2 85-89 0.15 90-94 0.20500000000000002 95-99 0.165 100-104 0.135 105-109 0.245 110-114 0.19499999999999998 115-119 0.19499999999999998 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.6375 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.8125 0.0 0.0 0.0 0.0 126-127 3.2249999999999996 0.0 0.0 0.0 0.0 128-129 3.5375 0.0 0.0 0.0 0.0 130-131 3.9875 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.9125 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172462 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172462_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5945 33.0 33.0 34.0 32.0 34.0 2 32.723 33.0 33.0 34.0 32.0 34.0 3 32.76975 34.0 33.0 34.0 32.0 34.0 4 32.60925 34.0 33.0 34.0 32.0 34.0 5 32.57125 34.0 33.0 34.0 32.0 34.0 6 36.7 38.0 38.0 38.0 36.0 38.0 7 36.88875 38.0 38.0 38.0 36.0 38.0 8 36.75525 38.0 38.0 38.0 36.0 38.0 9 36.92775 38.0 38.0 38.0 36.0 38.0 10-14 36.7195 38.0 38.0 38.0 35.8 38.0 15-19 36.763400000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.7918 38.0 38.0 38.0 36.2 38.0 25-29 36.75865 38.0 38.0 38.0 36.2 38.0 30-34 36.74655 38.0 38.0 38.0 36.0 38.0 35-39 36.603899999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.6257 38.0 38.0 38.0 36.0 38.0 45-49 36.6699 38.0 38.0 38.0 36.0 38.0 50-54 36.54635 38.0 38.0 38.0 35.6 38.0 55-59 36.460750000000004 38.0 38.0 38.0 35.0 38.0 60-64 36.362649999999995 38.0 38.0 38.0 34.8 38.0 65-69 36.2734 38.0 38.0 38.0 34.2 38.0 70-74 36.186 38.0 38.0 38.0 34.0 38.0 75-79 36.1629 38.0 38.0 38.0 34.0 38.0 80-84 36.0741 38.0 38.0 38.0 34.0 38.0 85-89 36.00455 38.0 38.0 38.0 33.4 38.0 90-94 35.838699999999996 38.0 38.0 38.0 32.8 38.0 95-99 35.6065 38.0 37.6 38.0 32.0 38.0 100-104 35.52505 38.0 37.0 38.0 31.2 38.0 105-109 35.23635 38.0 37.0 38.0 29.0 38.0 110-114 35.1668 38.0 36.8 38.0 28.8 38.0 115-119 34.78375 38.0 36.2 38.0 27.2 38.0 120-124 34.64495 38.0 36.0 38.0 27.0 38.0 125-129 34.2011 38.0 35.4 38.0 23.4 38.0 130-134 33.59095000000001 38.0 34.4 38.0 17.8 38.0 135-139 32.968900000000005 38.0 33.0 38.0 14.2 38.0 140-144 32.42195 38.0 33.0 38.0 13.4 38.0 145-149 31.315150000000006 38.0 32.0 38.0 6.2 38.0 150-151 26.215875 33.5 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 9.0 4 5.0 5 1.0 6 2.0 7 1.0 8 5.0 9 3.0 10 1.0 11 4.0 12 9.0 13 1.0 14 8.0 15 4.0 16 5.0 17 10.0 18 7.0 19 5.0 20 7.0 21 17.0 22 16.0 23 18.0 24 16.0 25 26.0 26 27.0 27 33.0 28 28.0 29 42.0 30 63.0 31 63.0 32 88.0 33 116.0 34 147.0 35 283.0 36 650.0 37 2260.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1 21.425 13.125 26.35 2 27.35683920980245 24.656164041010253 32.38309577394349 15.603900975243812 3 19.579894973743436 27.33183295823956 34.28357089272318 18.804701175293822 4 22.336168084042022 34.61730865432716 23.43671835917959 19.609804902451224 5 23.36168084042021 37.24362181090545 22.086043021510758 17.30865432716358 6 19.025 37.45 24.525 19.0 7 18.65 18.95 42.35 20.05 8 19.400000000000002 24.575 27.55 28.475 9 20.1 25.650000000000002 30.5 23.75 10-14 23.305 28.265 26.77 21.66 15-19 22.98 28.305000000000003 28.244999999999997 20.47 20-24 22.14 27.76 28.46 21.64 25-29 22.835 28.610000000000003 27.855 20.7 30-34 22.435 28.515 28.12 20.93 35-39 22.64 27.565 28.415000000000003 21.38 40-44 22.68 27.67 28.46 21.19 45-49 22.835 28.415000000000003 27.805000000000003 20.945 50-54 22.814999999999998 28.134999999999998 27.905 21.145 55-59 23.22 27.85 27.675 21.255 60-64 22.905 27.13 28.494999999999997 21.47 65-69 23.25 27.565 28.12 21.065 70-74 23.015 27.66 28.205000000000002 21.12 75-79 22.735 27.485 28.425 21.355 80-84 23.215 27.625 27.93 21.23 85-89 23.474999999999998 27.529999999999998 27.400000000000002 21.595 90-94 23.711185559277965 27.66638331916596 27.92639631981599 20.696034801740087 95-99 23.474999999999998 27.705000000000002 27.92 20.9 100-104 23.345 27.38 28.125 21.15 105-109 23.46 27.115000000000002 28.68 20.745 110-114 23.25 27.800000000000004 27.97 20.979999999999997 115-119 24.445 27.279999999999998 27.834999999999997 20.44 120-124 24.060000000000002 27.839999999999996 27.51 20.59 125-129 23.51 28.970000000000002 27.565 19.955000000000002 130-134 24.21 28.115000000000002 27.339999999999996 20.335 135-139 24.665 27.534999999999997 27.515 20.285 140-144 25.11 27.169999999999998 27.310000000000002 20.41 145-149 24.845 27.67 27.275 20.21 150-151 24.975 27.0625 28.050000000000004 19.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.5 20 0.5 21 1.0 22 2.5 23 2.5 24 2.5 25 5.0 26 5.0 27 4.5 28 9.5 29 12.5 30 17.5 31 27.5 32 36.0 33 42.0 34 45.5 35 58.5 36 82.0 37 110.5 38 143.0 39 164.0 40 188.0 41 231.5 42 253.5 43 253.5 44 261.5 45 264.0 46 259.5 47 245.5 48 227.5 49 199.0 50 151.0 51 138.5 52 136.0 53 98.0 54 72.5 55 58.5 56 48.5 57 43.5 58 30.5 59 21.5 60 15.0 61 11.0 62 6.5 63 2.0 64 2.0 65 1.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.86018237082067 97.575 2 0.9878419452887538 1.95 3 0.12664640324214793 0.375 4 0.025329280648429587 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.3624999999999998 0.0 0.0 0.0 0.0 114-115 1.4874999999999998 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 4.987500000000001 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138-139 5.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797320 spots for SRR7172462.sra Written 797320 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra Read 797313 spots for SRR7172462.sra Written 797313 spots for SRR7172462.sra SRR ids: ['SRR7172462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n56gbhrw SRR7172462.sra spots: 15946267 blocks: [[1, 797313], [797314, 1594626], [1594627, 2391939], [2391940, 3189252], [3189253, 3986565], [3986566, 4783878], [4783879, 5581191], [5581192, 6378504], [6378505, 7175817], [7175818, 7973130], [7973131, 8770443], [8770444, 9567756], [9567757, 10365069], [10365070, 11162382], [11162383, 11959695], [11959696, 12757008], [12757009, 13554321], [13554322, 14351634], [14351635, 15148947], [15148948, 15946267]] SRR7172462 file size 5381966 SRR7172462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172462 SRR7172462_1.fastq SRR7172462_2.fastq Input file: SRR7172462_1.fastq Paired file: SRR7172462_2.fastq trimmed: SRR7172462-trimmed-pair1.fastq, SRR7172462-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 20:24:37 2025 >> started Fri Feb 14 20:24:55 2025 >> done (17.842s) 15946267 read pairs processed; of these: 39300 ( 0.25%) short read pairs filtered out after trimming by size control 97070 ( 0.61%) empty read pairs filtered out after trimming by size control 15809897 (99.14%) read pairs available; of these: 8226549 (52.03%) trimmed read pairs available after processing 7583348 (47.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 9 0.00% 20 6 0.00% 21 9 0.00% 22 12 0.00% 23 7 0.00% 24 7 0.00% 25 10 0.00% 26 6 0.00% 27 10 0.00% 28 15 0.00% 29 14 0.00% 30 19 0.00% 31 18 0.00% 32 12 0.00% 33 16 0.00% 34 15 0.00% 35 21 0.00% 36 13 0.00% 37 34 0.00% 38 30 0.00% 39 27 0.00% 40 29 0.00% 41 35 0.00% 42 37 0.00% 43 37 0.00% 44 38 0.00% 45 60 0.00% 46 62 0.00% 47 47 0.00% 48 78 0.00% 49 86 0.00% 50 91 0.00% 51 91 0.00% 52 103 0.00% 53 106 0.00% 54 126 0.00% 55 112 0.00% 56 146 0.00% 57 158 0.00% 58 201 0.00% 59 228 0.00% 60 230 0.00% 61 264 0.00% 62 284 0.00% 63 362 0.00% 64 344 0.00% 65 457 0.00% 66 506 0.00% 67 582 0.00% 68 645 0.00% 69 736 0.00% 70 877 0.01% 71 950 0.01% 72 1015 0.01% 73 1161 0.01% 74 1253 0.01% 75 1310 0.01% 76 1507 0.01% 77 1681 0.01% 78 1932 0.01% 79 2220 0.01% 80 2374 0.02% 81 2754 0.02% 82 3093 0.02% 83 3674 0.02% 84 5337 0.03% 85 6249 0.04% 86 6360 0.04% 87 6722 0.04% 88 7005 0.04% 89 7222 0.05% 90 7974 0.05% 91 8435 0.05% 92 9167 0.06% 93 10022 0.06% 94 10349 0.07% 95 10922 0.07% 96 11167 0.07% 97 11692 0.07% 98 12012 0.08% 99 12620 0.08% 100 13573 0.09% 101 14325 0.09% 102 15614 0.10% 103 16478 0.10% 104 16951 0.11% 105 18112 0.11% 106 18785 0.12% 107 19344 0.12% 108 20411 0.13% 109 20759 0.13% 110 21857 0.14% 111 22958 0.15% 112 23911 0.15% 113 25673 0.16% 114 26899 0.17% 115 28300 0.18% 116 29614 0.19% 117 30331 0.19% 118 31487 0.20% 119 32929 0.21% 120 33835 0.21% 121 35169 0.22% 122 36557 0.23% 123 38934 0.25% 124 40516 0.26% 125 42649 0.27% 126 44412 0.28% 127 46562 0.29% 128 47987 0.30% 129 49886 0.32% 130 52526 0.33% 131 54813 0.35% 132 57369 0.36% 133 60979 0.39% 134 63590 0.40% 135 68522 0.43% 136 72725 0.46% 137 78269 0.50% 138 84112 0.53% 139 89223 0.56% 140 96138 0.61% 141 105704 0.67% 142 116468 0.74% 143 132343 0.84% 144 154163 0.98% 145 187100 1.18% 146 228264 1.44% 147 311453 1.97% 148 462027 2.92% 149 892109 5.64% 150 3818176 24.15% 151 7583348 47.97% 15809897 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=25 prefix-density=0.43 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=33.26 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=11.2 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=30 prefix-density=0.32 prefix-fanout=2.2 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=49.46 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.3 sequence=GGAGAAAAGGAGTGAGATATTCAAGAGAAATACGTTTAGAAATCAAGAGAGAGAG SRR7172462 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 20:25:43 Started mapping on | Feb 14 20:25:43 Finished on | Feb 14 20:27:44 Mapping speed, Million of reads per hour | 470.38 Number of input reads | 15809897 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14651856 Uniquely mapped reads % | 92.68% Average mapped length | 292.91 Number of splices: Total | 13630157 Number of splices: Annotated (sjdb) | 13340652 Number of splices: GT/AG | 13361635 Number of splices: GC/AG | 221178 Number of splices: AT/AC | 7404 Number of splices: Non-canonical | 39940 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 476887 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 38416 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 709817 709817 709817 N_multimapping 476887 476887 476887 N_noFeature 565472 14414807 687813 N_ambiguous 218432 1048 103059 UnstrandedReadsAssigned:13867952 PositiveStrandReadsAssigned:236001 NegativeStrandReadsAssigned:13860984 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172462 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172462-trimmed-pair1.fastq SRR7172462-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,809,897 reads, 13,918,948 reads pseudoaligned [quant] estimated average fragment length: 255.476 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7172462.ke.tsv 34699 SRR7172462.se.tsv 87100 total ==> SRR7172462.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.52 496 19.5035 Potri.005G024800.1.v4.1 1035 780.524 166 14.748 Potri.004G059700.1.v4.1 961 706.682 3 0.294381 Potri.007G009000.2.v4.1 1416 1161.52 0 0 Potri.003G141000.2.v4.1 2943 2688.52 573 14.7793 Potri.016G087400.1.v4.1 270 80.3482 571 492.802 Potri.015G069301.1.v4.1 564 318.963 0 0 Potri.010G195200.1.v4.1 1773 1518.52 40.7179 1.85941 Potri.012G127500.1.v4.1 977 722.591 314 30.1335 ==> SRR7172462.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1112 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 209 Potri.001G212900.v4.1 562 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 36 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7172462 completed mapping pipeline successfully