Starting /dee2/code/volunteer_pipeline.sh SRR7172463 current disk space = 3110409310208 free memory = 1470235504 SRR7172463 SRAfilesize 9cb44062f01a92a28e37666b165d4caa SRR7172463.sra SRR7172463.sra file validated SRR7172463 is paired end SRR7172463 is conventional basespace SRR7172463 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172463_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96475 34.0 33.0 34.0 33.0 34.0 2 33.39675 34.0 34.0 34.0 33.0 34.0 3 33.40975 34.0 34.0 34.0 33.0 34.0 4 33.47925 34.0 34.0 34.0 33.0 34.0 5 33.4915 34.0 34.0 34.0 33.0 34.0 6 37.2985 38.0 38.0 38.0 36.0 38.0 7 37.44775 38.0 38.0 38.0 37.0 38.0 8 37.526 38.0 38.0 38.0 37.0 38.0 9 37.47425 38.0 38.0 38.0 38.0 38.0 10-14 37.502849999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.50509999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.5287 38.0 38.0 38.0 38.0 38.0 25-29 37.467200000000005 38.0 38.0 38.0 37.8 38.0 30-34 37.41935 38.0 38.0 38.0 37.4 38.0 35-39 37.37105 38.0 38.0 38.0 37.0 38.0 40-44 37.2382 38.0 38.0 38.0 37.0 38.0 45-49 37.17915 38.0 38.0 38.0 36.2 38.0 50-54 36.994949999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.9885 38.0 38.0 38.0 36.0 38.0 60-64 36.933049999999994 38.0 38.0 38.0 35.8 38.0 65-69 36.8144 38.0 38.0 38.0 35.4 38.0 70-74 36.79135 38.0 38.0 38.0 35.2 38.0 75-79 36.62275 38.0 38.0 38.0 34.6 38.0 80-84 36.51545 38.0 38.0 38.0 34.0 38.0 85-89 36.487750000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.27415 38.0 38.0 38.0 34.0 38.0 95-99 36.14905 38.0 37.6 38.0 33.6 38.0 100-104 35.9524 38.0 37.0 38.0 32.6 38.0 105-109 35.6449 38.0 37.0 38.0 30.2 38.0 110-114 35.276599999999995 38.0 36.0 38.0 28.8 38.0 115-119 35.3309 38.0 36.0 38.0 29.4 38.0 120-124 35.136849999999995 38.0 36.0 38.0 28.4 38.0 125-129 34.6683 38.0 35.2 38.0 26.2 38.0 130-134 34.3341 38.0 35.0 38.0 24.4 38.0 135-139 34.04299999999999 38.0 34.6 38.0 23.4 38.0 140-144 33.1131 38.0 33.6 38.0 17.4 38.0 145-149 32.265950000000004 38.0 32.8 38.0 11.4 38.0 150-151 27.996375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 1.0 10 0.0 11 0.0 12 4.0 13 0.0 14 1.0 15 1.0 16 1.0 17 3.0 18 10.0 19 2.0 20 6.0 21 6.0 22 12.0 23 19.0 24 7.0 25 19.0 26 23.0 27 32.0 28 26.0 29 52.0 30 44.0 31 67.0 32 99.0 33 111.0 34 150.0 35 324.0 36 735.0 37 2242.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.969527679024885 15.972574911122397 8.633824276282377 35.42407313357034 2 21.85 21.5 33.800000000000004 22.85 3 18.45 26.700000000000003 26.650000000000002 28.199999999999996 4 22.575 34.325 21.525 21.575 5 21.025 37.55 24.099999999999998 17.325 6 17.925 34.775 26.325 20.974999999999998 7 14.374999999999998 21.775 43.9 19.950000000000003 8 18.099999999999998 23.35 31.1 27.450000000000003 9 16.825000000000003 23.1 33.15 26.924999999999997 10-14 20.035 29.044999999999998 26.51 24.41 15-19 20.345 28.439999999999998 27.485 23.73 20-24 20.150000000000002 28.13 28.29 23.43 25-29 20.015 28.985 27.72 23.28 30-34 19.869999999999997 28.395 27.944999999999997 23.79 35-39 19.950000000000003 28.660000000000004 27.905 23.485 40-44 19.8 28.884999999999998 27.925 23.39 45-49 20.47 28.075 28.144999999999996 23.31 50-54 19.805 28.54 28.03 23.625 55-59 20.599999999999998 28.645 26.845000000000002 23.91 60-64 19.665 29.095 27.275 23.965 65-69 20.785 28.815 27.005000000000003 23.395 70-74 19.88 28.64 27.715 23.765 75-79 19.925 28.560000000000002 27.665 23.849999999999998 80-84 19.81 28.244999999999997 28.09 23.855 85-89 20.794999999999998 28.765 27.384999999999998 23.055 90-94 20.215 27.500000000000004 28.21 24.075 95-99 20.435 28.189999999999998 27.534999999999997 23.84 100-104 20.331347915311078 28.990439961960057 27.293658341258322 23.384553781470544 105-109 20.61 28.110000000000003 27.63 23.65 110-114 21.096686882863015 28.795549095283445 26.920956343040448 23.186807678813093 115-119 21.14 28.515 27.224999999999998 23.119999999999997 120-124 20.46 28.57 27.265 23.705000000000002 125-129 21.240000000000002 27.855 27.105 23.799999999999997 130-134 22.13 27.83 27.005000000000003 23.035 135-139 21.615000000000002 27.805000000000003 26.86 23.72 140-144 20.96 28.660000000000004 26.740000000000002 23.64 145-149 21.47 28.425 26.405 23.7 150-151 21.4375 28.9125 25.637500000000003 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 1.0 19 1.5 20 1.5 21 1.0 22 1.5 23 2.5 24 3.0 25 6.0 26 7.5 27 7.0 28 11.0 29 18.0 30 23.5 31 29.5 32 32.5 33 44.5 34 71.5 35 85.5 36 99.0 37 109.5 38 126.0 39 161.0 40 199.0 41 228.0 42 244.5 43 250.5 44 252.0 45 240.5 46 233.5 47 223.5 48 201.0 49 198.0 50 179.0 51 143.0 52 120.5 53 99.5 54 75.0 55 62.0 56 54.0 57 39.5 58 28.0 59 25.0 60 19.0 61 11.0 62 8.0 63 8.5 64 4.5 65 0.5 66 0.0 67 0.0 68 0.5 69 1.5 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.105 105-109 0.0 110-114 0.245 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.40261701056869653 0.8 3 0.12581781580271767 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.0750000000000002 0.0 0.0 0.0 0.0 96-97 1.2375 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.0 114-115 3.5 0.0 0.0 0.0 0.0 116-117 3.8375000000000004 0.0 0.0 0.0 0.0 118-119 4.137499999999999 0.0 0.0 0.0 0.0 120-121 4.4625 0.0 0.0 0.0 0.0 122-123 4.8625 0.0 0.0 0.0 0.0 124-125 5.324999999999999 0.0 0.0 0.0 0.0 126-127 5.775 0.0 0.0 0.0 0.0 128-129 6.2125 0.0 0.0 0.0 0.0 130-131 6.637499999999999 0.0 0.0 0.0 0.0 132-133 7.275 0.0 0.0 0.0 0.0 134-135 7.95 0.0 0.0 0.0 0.0 136-137 8.475 0.0 0.0 0.0 0.0 138-139 8.962499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172463 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172463_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3595 33.0 33.0 34.0 31.0 34.0 2 32.50225 33.0 33.0 34.0 32.0 34.0 3 32.52175 33.0 33.0 34.0 31.0 34.0 4 32.302 34.0 33.0 34.0 32.0 34.0 5 32.4565 33.0 33.0 34.0 32.0 34.0 6 36.549 38.0 38.0 38.0 35.0 38.0 7 36.676 38.0 38.0 38.0 36.0 38.0 8 36.71725 38.0 38.0 38.0 36.0 38.0 9 36.66425 38.0 38.0 38.0 36.0 38.0 10-14 36.6628 38.0 38.0 38.0 36.0 38.0 15-19 36.63195 38.0 38.0 38.0 35.8 38.0 20-24 36.613600000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.634699999999995 38.0 38.0 38.0 36.0 38.0 30-34 36.6 38.0 38.0 38.0 36.0 38.0 35-39 36.531099999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.508050000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.48805 38.0 38.0 38.0 35.6 38.0 50-54 36.4643 38.0 38.0 38.0 35.4 38.0 55-59 36.28745 38.0 38.0 38.0 34.6 38.0 60-64 36.326649999999994 38.0 38.0 38.0 34.6 38.0 65-69 36.2676 38.0 38.0 38.0 34.4 38.0 70-74 36.23025 38.0 38.0 38.0 34.0 38.0 75-79 35.93050000000001 38.0 38.0 38.0 33.0 38.0 80-84 35.958749999999995 38.0 38.0 38.0 33.6 38.0 85-89 36.013349999999996 38.0 38.0 38.0 34.0 38.0 90-94 35.62875 38.0 38.0 38.0 32.0 38.0 95-99 35.50095 38.0 37.6 38.0 31.0 38.0 100-104 35.4546 38.0 37.6 38.0 31.0 38.0 105-109 35.14575 38.0 37.0 38.0 29.0 38.0 110-114 35.028749999999995 38.0 37.0 38.0 28.6 38.0 115-119 34.780899999999995 38.0 36.4 38.0 27.4 38.0 120-124 34.47155 38.0 36.0 38.0 25.8 38.0 125-129 34.18535000000001 38.0 35.8 38.0 23.0 38.0 130-134 33.7441 38.0 35.0 38.0 19.0 38.0 135-139 33.19455000000001 38.0 34.4 38.0 14.4 38.0 140-144 32.3812 38.0 33.4 38.0 13.2 38.0 145-149 31.523649999999996 38.0 32.6 38.0 6.4 38.0 150-151 27.28575 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 5.0 4 3.0 5 4.0 6 0.0 7 3.0 8 2.0 9 2.0 10 6.0 11 5.0 12 5.0 13 6.0 14 4.0 15 8.0 16 5.0 17 11.0 18 7.0 19 10.0 20 15.0 21 15.0 22 11.0 23 12.0 24 23.0 25 30.0 26 25.0 27 41.0 28 37.0 29 35.0 30 49.0 31 67.0 32 70.0 33 98.0 34 147.0 35 228.0 36 611.0 37 2367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.418932527693855 20.26686807653575 13.24269889224572 28.07150050352467 2 24.85520020146059 27.977839335180054 31.50339964744397 15.663560815915387 3 19.969780911609167 28.75849911860992 30.24427096449257 21.02744900528834 4 23.910304862685816 36.306374401612494 21.415973796926178 18.367346938775512 5 23.633156966490297 38.29680020156211 21.66792642983119 16.402116402116402 6 18.028664822730704 37.289414131254716 25.49660548151873 19.18531556449585 7 19.51219512195122 18.707568518984157 40.60849886849384 21.171737490570784 8 20.271629778672033 24.220321931589535 28.948692152917506 26.559356136820927 9 22.1579476861167 24.270623742454728 28.87323943661972 24.698189134808853 10-14 23.63535744830709 28.117925240227397 26.32187955928963 21.924837752175883 15-19 23.023501585224697 28.36294096925167 27.592974686729406 21.020582758794223 20-24 22.71241008098999 27.63217465667287 28.648322350218823 21.007092912118317 25-29 22.906713603218506 28.28262509429218 27.89539854161428 20.91526276087503 30-34 22.16746291174252 27.462911742519484 29.05707819964797 21.312547146090015 35-39 22.76590394769927 27.94065878803118 27.739502137289413 21.553935126980136 40-44 22.50239065881524 28.32049927021994 28.204741053903064 20.972369017061755 45-49 22.299406020336253 28.148595590456054 28.103292056780425 21.44870633242726 50-54 22.954614068632385 28.02153567475093 27.94102847942035 21.082821777196337 55-59 22.788311622994517 27.636674546094653 28.481617462153597 21.09339636875723 60-64 22.76659959758551 27.73138832997988 28.601609657947684 20.900402414486923 65-69 23.43325621164873 27.66321295644301 27.4771149783724 21.426415853535865 70-74 23.134591194968554 27.29559748427673 28.181132075471698 21.38867924528302 75-79 23.36067636253837 27.270897287504404 27.72381863016456 21.644607719792663 80-84 23.628309674821303 27.156951575556228 28.42041679250982 20.794321957112654 85-89 23.628309674821303 27.458975133393736 28.052954797140845 20.859760394644116 90-94 23.733762964454737 28.028395931930316 27.308428154264426 20.929412949350517 95-99 22.843764160918383 27.858617390866524 28.296661799506573 21.000956648708524 100-104 24.032412300568726 27.47496099451407 27.5806532789773 20.911973425939905 105-109 23.513717593757868 28.06946891517745 27.83287188522527 20.583941605839414 110-114 23.94543441055069 27.609986912312497 27.806302224906876 20.63827645222994 115-119 23.689906871381826 28.401711552982633 27.22376038258243 20.68462119305311 120-124 24.42632850241546 27.566425120772948 27.65197262479871 20.35527375201288 125-129 24.827655613143463 27.600261661550846 27.710964625371105 19.861118099934586 130-134 24.65546725681521 28.568554471381148 26.99929584548838 19.776682426315258 135-139 25.106875220037217 28.08429311472112 27.19911482170699 19.609716843534677 140-144 25.236608940797424 27.99033427305679 26.95328231977447 19.819774466371324 145-149 25.0088094638812 27.707022401208153 27.30933803171407 19.974830103196577 150-151 24.930782783790587 28.53007802668009 27.573621948150013 18.96551724137931 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 23.0 1 11.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 2.5 19 1.0 20 1.5 21 1.5 22 1.0 23 3.5 24 4.0 25 5.5 26 7.0 27 7.0 28 10.5 29 13.0 30 15.5 31 22.0 32 28.0 33 34.5 34 51.5 35 67.5 36 78.5 37 95.5 38 137.5 39 165.5 40 180.5 41 224.5 42 242.0 43 254.5 44 269.5 45 262.5 46 257.5 47 234.0 48 215.5 49 212.5 50 178.5 51 138.5 52 117.5 53 86.5 54 76.0 55 70.5 56 48.5 57 35.0 58 30.0 59 24.5 60 15.5 61 12.0 62 9.5 63 9.0 64 6.0 65 2.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.7250000000000001 3 0.7250000000000001 4 0.775 5 0.775 6 0.575 7 0.575 8 0.6 9 0.6 10-14 0.615 15-19 0.645 20-24 0.605 25-29 0.575 30-34 0.575 35-39 0.575 40-44 0.655 45-49 0.67 50-54 0.63 55-59 0.585 60-64 0.6 65-69 0.59 70-74 0.625 75-79 0.645 80-84 0.67 85-89 0.67 90-94 0.69 95-99 0.695 100-104 0.655 105-109 0.675 110-114 0.67 115-119 0.675 120-124 0.64 125-129 0.635 130-134 0.59 135-139 0.585 140-144 0.6799999999999999 145-149 0.675 150-151 0.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.46848899012907 98.25 2 0.3796507213363705 0.75 3 0.07593014426727411 0.22499999999999998 4 0.05062009617818274 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02531004808909137 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 23 0.575 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0499999999999998 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.4749999999999996 0.0 0.0 0.0 0.0 110-111 2.75 0.0 0.0 0.0 0.0 112-113 3.15 0.0 0.0 0.0 0.0 114-115 3.4375 0.0 0.0 0.0 0.0 116-117 3.7375 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 4.825 0.0 0.0 0.0 0.0 124-125 5.237500000000001 0.0 0.0 0.0 0.0 126-127 5.6875 0.0 0.0 0.0 0.0 128-129 6.137499999999999 0.0 0.0 0.0 0.0 130-131 6.5625 0.0 0.0 0.0 0.0 132-133 7.225 0.0 0.0 0.0 0.0 134-135 7.9125 0.0 0.0 0.0 0.0 136-137 8.462499999999999 0.0 0.0 0.0 0.0 138-139 8.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCTCT 10 0.006830828 145.0 1 >>END_MODULE Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801832 spots for SRR7172463.sra Written 801832 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra Read 801829 spots for SRR7172463.sra Written 801829 spots for SRR7172463.sra SRR ids: ['SRR7172463.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nmv0e4hf SRR7172463.sra spots: 16036583 blocks: [[1, 801829], [801830, 1603658], [1603659, 2405487], [2405488, 3207316], [3207317, 4009145], [4009146, 4810974], [4810975, 5612803], [5612804, 6414632], [6414633, 7216461], [7216462, 8018290], [8018291, 8820119], [8820120, 9621948], [9621949, 10423777], [10423778, 11225606], [11225607, 12027435], [12027436, 12829264], [12829265, 13631093], [13631094, 14432922], [14432923, 15234751], [15234752, 16036583]] SRR7172463 file size 5412571 SRR7172463 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172463 SRR7172463_1.fastq SRR7172463_2.fastq Input file: SRR7172463_1.fastq Paired file: SRR7172463_2.fastq trimmed: SRR7172463-trimmed-pair1.fastq, SRR7172463-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 19:24:06 2025 >> started Fri Feb 14 19:24:25 2025 >> done (19.414s) 16036583 read pairs processed; of these: 23809 ( 0.15%) short read pairs filtered out after trimming by size control 109316 ( 0.68%) empty read pairs filtered out after trimming by size control 15903458 (99.17%) read pairs available; of these: 8881451 (55.85%) trimmed read pairs available after processing 7022007 (44.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 4 0.00% 21 5 0.00% 22 12 0.00% 23 6 0.00% 24 6 0.00% 25 3 0.00% 26 6 0.00% 27 13 0.00% 28 10 0.00% 29 13 0.00% 30 11 0.00% 31 12 0.00% 32 7 0.00% 33 17 0.00% 34 10 0.00% 35 16 0.00% 36 21 0.00% 37 27 0.00% 38 20 0.00% 39 25 0.00% 40 22 0.00% 41 47 0.00% 42 37 0.00% 43 54 0.00% 44 58 0.00% 45 50 0.00% 46 58 0.00% 47 92 0.00% 48 89 0.00% 49 93 0.00% 50 110 0.00% 51 129 0.00% 52 153 0.00% 53 148 0.00% 54 182 0.00% 55 221 0.00% 56 198 0.00% 57 282 0.00% 58 309 0.00% 59 363 0.00% 60 434 0.00% 61 470 0.00% 62 539 0.00% 63 625 0.00% 64 636 0.00% 65 782 0.00% 66 860 0.01% 67 987 0.01% 68 1215 0.01% 69 1491 0.01% 70 1580 0.01% 71 1673 0.01% 72 1871 0.01% 73 2135 0.01% 74 2398 0.02% 75 2604 0.02% 76 2925 0.02% 77 3220 0.02% 78 3486 0.02% 79 3910 0.02% 80 4412 0.03% 81 5015 0.03% 82 5567 0.04% 83 6286 0.04% 84 7631 0.05% 85 8689 0.05% 86 9181 0.06% 87 9777 0.06% 88 10357 0.07% 89 10840 0.07% 90 11817 0.07% 91 12532 0.08% 92 13344 0.08% 93 14768 0.09% 94 15369 0.10% 95 16255 0.10% 96 16373 0.10% 97 17459 0.11% 98 17446 0.11% 99 18812 0.12% 100 20007 0.13% 101 20676 0.13% 102 21896 0.14% 103 23265 0.15% 104 24306 0.15% 105 25584 0.16% 106 26268 0.17% 107 27304 0.17% 108 28220 0.18% 109 29342 0.18% 110 30260 0.19% 111 31695 0.20% 112 33162 0.21% 113 34791 0.22% 114 36004 0.23% 115 37414 0.24% 116 38219 0.24% 117 39684 0.25% 118 41172 0.26% 119 41825 0.26% 120 43585 0.27% 121 45467 0.29% 122 46268 0.29% 123 48738 0.31% 124 50743 0.32% 125 53227 0.33% 126 54983 0.35% 127 56928 0.36% 128 58401 0.37% 129 60979 0.38% 130 63721 0.40% 131 65425 0.41% 132 68666 0.43% 133 71824 0.45% 134 76560 0.48% 135 80231 0.50% 136 84855 0.53% 137 90143 0.57% 138 96217 0.61% 139 103510 0.65% 140 110186 0.69% 141 119181 0.75% 142 131859 0.83% 143 148696 0.93% 144 168692 1.06% 145 198489 1.25% 146 242720 1.53% 147 324813 2.04% 148 492858 3.10% 149 924421 5.81% 150 3819245 24.02% 151 7022007 44.15% 15903458 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=7.91 fanout-score-rank=14 prefix-density=0.62 prefix-fanout=2.2 sequence=CCAGCAGTGTCCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=350.90 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=6.69 fanout-score-rank=15 prefix-density=0.80 prefix-fanout=1.8 sequence=ATGGCTTCCTCCTCTATGATCTCATCGGCAGCCGTTGCCACCGTCAACCGCACCCCGGCACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=31.58 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.0 sequence=GAGAAAAGGAGTGAGATATTCAAGAGAAATACGTTTAGAAATCAAGAGAGAGAG SRR7172463 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 19:25:40 Started mapping on | Feb 14 19:25:41 Finished on | Feb 14 19:28:04 Mapping speed, Million of reads per hour | 400.37 Number of input reads | 15903458 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14699443 Uniquely mapped reads % | 92.43% Average mapped length | 290.72 Number of splices: Total | 13557872 Number of splices: Annotated (sjdb) | 13236664 Number of splices: GT/AG | 13297029 Number of splices: GC/AG | 204831 Number of splices: AT/AC | 8938 Number of splices: Non-canonical | 47074 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454426 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 61430 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.20% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 770159 770159 770159 N_multimapping 454426 454426 454426 N_noFeature 609238 14451394 726696 N_ambiguous 252893 1074 121573 UnstrandedReadsAssigned:13837312 PositiveStrandReadsAssigned:246975 NegativeStrandReadsAssigned:13851174 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172463 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172463-trimmed-pair1.fastq SRR7172463-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,903,458 reads, 13,869,927 reads pseudoaligned [quant] estimated average fragment length: 240.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,000 rounds 52401 SRR7172463.ke.tsv 34699 SRR7172463.se.tsv 87100 total ==> SRR7172463.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.53 1221 47.0283 Potri.005G024800.1.v4.1 1035 795.525 442 38.0603 Potri.004G059700.1.v4.1 961 721.624 20 1.89855 Potri.007G009000.2.v4.1 1416 1176.53 0 0 Potri.003G141000.2.v4.1 2943 2703.53 641.618 16.2574 Potri.016G087400.1.v4.1 270 87.7875 562.4 438.85 Potri.015G069301.1.v4.1 564 333.273 0 0 Potri.010G195200.1.v4.1 1773 1533.53 74 3.30556 Potri.012G127500.1.v4.1 977 737.59 286 26.5617 ==> SRR7172463.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 665 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 44 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7172463 completed mapping pipeline successfully