Starting /dee2/code/volunteer_pipeline.sh SRR7172464 current disk space = 3110115631104 free memory = 1574640740 SRR7172464 SRAfilesize 60f9a433035735b3b66f5017aaa2960f SRR7172464.sra SRR7172464.sra file validated SRR7172464 is paired end SRR7172464 is conventional basespace SRR7172464 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172464_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50425 34.0 33.0 34.0 32.0 34.0 2 33.2655 34.0 33.0 34.0 33.0 34.0 3 33.33925 34.0 33.0 34.0 33.0 34.0 4 33.44925 34.0 34.0 34.0 33.0 34.0 5 33.43775 34.0 34.0 34.0 33.0 34.0 6 37.179 38.0 38.0 38.0 36.0 38.0 7 37.343 38.0 38.0 38.0 37.0 38.0 8 37.5025 38.0 38.0 38.0 37.0 38.0 9 37.48325 38.0 38.0 38.0 38.0 38.0 10-14 37.461299999999994 38.0 38.0 38.0 37.6 38.0 15-19 37.4067 38.0 38.0 38.0 37.4 38.0 20-24 37.42345 38.0 38.0 38.0 38.0 38.0 25-29 37.36645 38.0 38.0 38.0 37.2 38.0 30-34 37.3649 38.0 38.0 38.0 37.0 38.0 35-39 37.2739 38.0 38.0 38.0 37.0 38.0 40-44 37.070100000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.96175 38.0 38.0 38.0 36.0 38.0 50-54 36.778650000000006 38.0 38.0 38.0 35.4 38.0 55-59 36.80905 38.0 38.0 38.0 35.4 38.0 60-64 36.793549999999996 38.0 38.0 38.0 35.4 38.0 65-69 36.70700000000001 38.0 38.0 38.0 35.0 38.0 70-74 36.550399999999996 38.0 38.0 38.0 34.2 38.0 75-79 36.3754 38.0 38.0 38.0 34.0 38.0 80-84 36.260749999999994 38.0 38.0 38.0 33.8 38.0 85-89 36.24855 38.0 38.0 38.0 33.6 38.0 90-94 36.04775 38.0 37.0 38.0 33.0 38.0 95-99 35.7957 38.0 37.0 38.0 31.4 38.0 100-104 35.5244 38.0 36.6 38.0 29.8 38.0 105-109 35.55285 38.0 36.8 38.0 30.6 38.0 110-114 35.15455 38.0 36.0 38.0 28.6 38.0 115-119 34.8889 38.0 35.6 38.0 27.8 38.0 120-124 34.5817 38.0 35.0 38.0 26.4 38.0 125-129 34.25195000000001 38.0 34.8 38.0 24.6 38.0 130-134 33.80795 38.0 34.4 38.0 21.2 38.0 135-139 33.29735 38.0 34.0 38.0 16.2 38.0 140-144 32.6234 38.0 33.0 38.0 14.4 38.0 145-149 31.59495 38.0 31.2 38.0 8.6 38.0 150-151 26.382875 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 2.0 6 0.0 7 2.0 8 0.0 9 6.0 10 1.0 11 1.0 12 2.0 13 2.0 14 2.0 15 1.0 16 2.0 17 8.0 18 5.0 19 9.0 20 6.0 21 12.0 22 10.0 23 13.0 24 20.0 25 14.0 26 29.0 27 23.0 28 34.0 29 44.0 30 60.0 31 74.0 32 90.0 33 138.0 34 197.0 35 348.0 36 844.0 37 2000.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.07771487390633 14.873906330416881 9.547092125579 32.501286670097784 2 22.95 17.825 32.5 26.724999999999998 3 18.25 27.025 27.450000000000003 27.275 4 22.95 30.9 22.900000000000002 23.25 5 21.75 35.875 24.4 17.974999999999998 6 18.55 35.325 24.875 21.25 7 14.799999999999999 23.825 43.4 17.974999999999998 8 16.900000000000002 24.675 30.925000000000004 27.500000000000004 9 17.775 22.675 34.025 25.525 10-14 21.07 28.939999999999998 26.424999999999997 23.565 15-19 20.23 28.42 27.245 24.104999999999997 20-24 20.169999999999998 27.685 28.1 24.044999999999998 25-29 20.57 28.78 27.089999999999996 23.56 30-34 19.88 28.765 27.744999999999997 23.61 35-39 19.909977494373592 29.177294323580895 26.846711677919483 24.066016504126033 40-44 20.19004751187797 28.56714178544636 27.336834208552137 23.905976494123532 45-49 20.230057514378593 28.707176794198553 27.426856714178545 23.63590897724431 50-54 20.51512878219555 28.00700175043761 27.571892973243312 23.905976494123532 55-59 20.13808975834292 28.073247610947117 27.57292239955971 24.21574023115025 60-64 19.974981235926943 28.081060795596695 27.685764323242434 24.258193645233924 65-69 20.380285213910433 28.30622967225419 27.1703777833375 24.143107330497873 70-74 20.090067550662997 28.431323492619466 27.555666750062546 23.92294220665499 75-79 20.31523642732049 28.14610958218664 27.540655491618715 23.997998498874157 80-84 20.815611708781585 28.416312234175635 27.060295221416062 23.70778083562672 85-89 20.42930051035725 28.219753827679376 27.319123386370457 24.031822275592916 90-94 20.565424068051037 27.865899424568426 27.950963222416814 23.617713284963724 95-99 20.344240968678072 28.600020014009807 27.023916741719205 24.031822275592916 100-104 20.47421339602821 28.61287579410735 27.127207243259466 23.785703566604973 105-109 20.47035276457343 28.416312234175635 27.140355266449838 23.9729797348011 110-114 20.885885885885884 28.428428428428425 27.272272272272275 23.413413413413416 115-119 20.834584208946264 28.66506554588212 27.239067347143 23.26128289802862 120-124 21.185000000000002 28.134999999999998 26.950000000000003 23.73 125-129 21.185000000000002 28.075 26.86 23.880000000000003 130-134 20.89 28.360000000000003 26.845000000000002 23.905 135-139 21.88 28.13 26.07 23.919999999999998 140-144 21.43 27.48 26.695 24.395 145-149 21.44 28.23 26.665 23.665 150-151 21.3875 28.3625 26.724999999999998 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 1.5 18 2.0 19 1.5 20 1.0 21 0.5 22 1.0 23 2.5 24 3.5 25 3.5 26 4.5 27 8.0 28 11.5 29 17.0 30 19.0 31 21.5 32 33.5 33 38.5 34 54.0 35 82.0 36 87.5 37 105.0 38 130.5 39 154.0 40 177.5 41 185.0 42 210.0 43 239.5 44 264.0 45 278.5 46 258.0 47 240.5 48 223.5 49 205.5 50 184.0 51 151.0 52 127.5 53 101.5 54 85.0 55 70.0 56 59.0 57 44.5 58 35.0 59 28.0 60 17.0 61 13.5 62 5.5 63 2.0 64 1.5 65 2.0 66 1.0 67 0.5 68 1.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.025 55-59 0.065 60-64 0.075 65-69 0.075 70-74 0.075 75-79 0.075 80-84 0.075 85-89 0.06999999999999999 90-94 0.075 95-99 0.06999999999999999 100-104 0.045 105-109 0.075 110-114 0.1 115-119 0.06999999999999999 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06518443658413 98.02499999999999 2 0.808489135927236 1.6 3 0.12632642748863063 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.8250000000000002 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.2625 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.449999999999999 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.199999999999999 0.0 0.0 0.0 0.0 134-135 5.575 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTACAT 10 0.006577216 146.82278 1 TTCAACA 10 0.006832588 144.9875 9 CTACATG 10 0.006832588 144.9875 2 >>END_MODULE SRR7172464 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172464_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5985 33.0 33.0 34.0 32.0 34.0 2 32.668 33.0 33.0 34.0 32.0 34.0 3 32.663 34.0 33.0 34.0 32.0 34.0 4 32.48825 34.0 33.0 34.0 32.0 34.0 5 32.462 33.0 33.0 34.0 32.0 34.0 6 36.65325 38.0 38.0 38.0 36.0 38.0 7 36.715 38.0 38.0 38.0 36.0 38.0 8 36.69775 38.0 38.0 38.0 36.0 38.0 9 36.78025 38.0 38.0 38.0 36.0 38.0 10-14 36.666999999999994 38.0 38.0 38.0 36.0 38.0 15-19 36.6909 38.0 38.0 38.0 36.0 38.0 20-24 36.68555 38.0 38.0 38.0 36.0 38.0 25-29 36.728249999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.6751 38.0 38.0 38.0 36.0 38.0 35-39 36.497550000000004 38.0 38.0 38.0 35.6 38.0 40-44 36.5251 38.0 38.0 38.0 35.8 38.0 45-49 36.5406 38.0 38.0 38.0 36.0 38.0 50-54 36.4721 38.0 38.0 38.0 35.6 38.0 55-59 36.355 38.0 38.0 38.0 34.8 38.0 60-64 36.354049999999994 38.0 38.0 38.0 35.0 38.0 65-69 36.19755 38.0 38.0 38.0 34.0 38.0 70-74 36.0947 38.0 38.0 38.0 34.0 38.0 75-79 36.05929999999999 38.0 38.0 38.0 34.0 38.0 80-84 35.92935 38.0 38.0 38.0 33.2 38.0 85-89 35.8744 38.0 38.0 38.0 33.4 38.0 90-94 35.775400000000005 38.0 38.0 38.0 33.0 38.0 95-99 35.503750000000004 38.0 37.4 38.0 31.2 38.0 100-104 35.36005 38.0 37.0 38.0 29.6 38.0 105-109 35.17125 38.0 37.0 38.0 28.8 38.0 110-114 34.957449999999994 38.0 36.8 38.0 27.6 38.0 115-119 34.601350000000004 38.0 36.0 38.0 25.6 38.0 120-124 34.4954 38.0 36.0 38.0 25.2 38.0 125-129 34.00295 38.0 35.2 38.0 21.4 38.0 130-134 33.25275 38.0 34.2 38.0 15.0 38.0 135-139 32.703199999999995 38.0 33.0 38.0 14.2 38.0 140-144 32.0469 38.0 32.4 38.0 13.0 38.0 145-149 31.062050000000006 38.0 31.4 38.0 3.8 38.0 150-151 25.73625 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 8.0 4 4.0 5 3.0 6 5.0 7 5.0 8 3.0 9 3.0 10 4.0 11 4.0 12 2.0 13 4.0 14 5.0 15 4.0 16 7.0 17 11.0 18 5.0 19 10.0 20 11.0 21 17.0 22 14.0 23 20.0 24 23.0 25 36.0 26 29.0 27 35.0 28 23.0 29 34.0 30 55.0 31 80.0 32 76.0 33 112.0 34 170.0 35 267.0 36 596.0 37 2289.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.175 21.4 14.075 23.35 2 28.425 23.825 31.1 16.650000000000002 3 19.900000000000002 27.025 34.625 18.45 4 23.680920230057513 33.983495873968494 23.88097024256064 18.454613653413354 5 24.675 37.075 21.325 16.925 6 19.85 38.475 22.45 19.225 7 18.975 20.575 40.8 19.650000000000002 8 20.25 24.725 26.125 28.9 9 21.7 24.875 29.099999999999998 24.325 10-14 23.35 28.21 26.665 21.775 15-19 23.485 27.715 27.38 21.42 20-24 23.044999999999998 28.67 27.839999999999996 20.445 25-29 23.669999999999998 27.845 27.384999999999998 21.099999999999998 30-34 22.735 28.075 28.08 21.11 35-39 23.35 27.445000000000004 27.565 21.64 40-44 23.375 27.195000000000004 27.715 21.715 45-49 23.135 27.450000000000003 28.23 21.185000000000002 50-54 23.69 27.189999999999998 27.800000000000004 21.32 55-59 23.015 27.134999999999998 28.08 21.77 60-64 22.81 27.655 27.750000000000004 21.785 65-69 23.855 27.33 27.825 20.990000000000002 70-74 23.75 27.54 26.83 21.88 75-79 22.81 26.85 27.96 22.38 80-84 23.235 27.38 27.91 21.475 85-89 23.119999999999997 28.095 27.365000000000002 21.42 90-94 23.49 27.29 28.02 21.2 95-99 23.46 27.87 27.315 21.355 100-104 23.955000000000002 27.87 27.43 20.745 105-109 23.935000000000002 27.275 27.500000000000004 21.29 110-114 23.64 28.71 26.919999999999998 20.73 115-119 24.474999999999998 27.584999999999997 27.35 20.59 120-124 23.919999999999998 28.155 27.185 20.74 125-129 24.77 27.57 27.47 20.19 130-134 25.35 27.155 27.3 20.195 135-139 24.490000000000002 27.98 27.095000000000002 20.435 140-144 24.66 27.500000000000004 27.675 20.165 145-149 25.27 27.33 27.425 19.975 150-151 26.2625 27.712500000000002 26.575 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 2.5 22 2.0 23 1.5 24 2.0 25 2.5 26 4.5 27 8.0 28 8.5 29 10.0 30 14.0 31 17.0 32 21.5 33 30.5 34 44.5 35 59.5 36 73.0 37 94.5 38 123.5 39 150.0 40 189.0 41 214.5 42 227.5 43 249.5 44 253.0 45 255.0 46 260.5 47 263.5 48 237.0 49 213.0 50 199.5 51 152.0 52 118.0 53 102.5 54 93.5 55 78.5 56 63.5 57 50.0 58 30.0 59 24.0 60 19.5 61 13.0 62 7.0 63 2.5 64 2.5 65 2.0 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.82981429661663 97.125 2 0.8140422284406004 1.6 3 0.2543881963876876 0.75 4 0.0 0.0 5 0.07631645891630628 0.375 6 0.02543881963876876 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.8250000000000002 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.8375 0.0 0.0 0.0 0.0 120-121 3.0875000000000004 0.0 0.0 0.0 0.0 122-123 3.4124999999999996 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.175 0.0 0.0 0.0 0.0 128-129 4.6 0.0 0.0 0.0 0.0 130-131 4.949999999999999 0.0 0.0 0.0 0.0 132-133 5.262499999999999 0.0 0.0 0.0 0.0 134-135 5.6875 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTAGAT 10 0.006830828 145.0 1 AGATCAA 10 0.006830828 145.0 4 >>END_MODULE Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729648 spots for SRR7172464.sra Written 729648 spots for SRR7172464.sra Read 729653 spots for SRR7172464.sra Written 729653 spots for SRR7172464.sra SRR ids: ['SRR7172464.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c0dfrlim SRR7172464.sra spots: 14592965 blocks: [[1, 729648], [729649, 1459296], [1459297, 2188944], [2188945, 2918592], [2918593, 3648240], [3648241, 4377888], [4377889, 5107536], [5107537, 5837184], [5837185, 6566832], [6566833, 7296480], [7296481, 8026128], [8026129, 8755776], [8755777, 9485424], [9485425, 10215072], [10215073, 10944720], [10944721, 11674368], [11674369, 12404016], [12404017, 13133664], [13133665, 13863312], [13863313, 14592965]] SRR7172464 file size 4923376 SRR7172464 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172464 SRR7172464_1.fastq SRR7172464_2.fastq Input file: SRR7172464_1.fastq Paired file: SRR7172464_2.fastq trimmed: SRR7172464-trimmed-pair1.fastq, SRR7172464-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 19:57:22 2025 >> started Fri Feb 14 19:57:37 2025 >> done (15.216s) 14592965 read pairs processed; of these: 34824 ( 0.24%) short read pairs filtered out after trimming by size control 81317 ( 0.56%) empty read pairs filtered out after trimming by size control 14476824 (99.20%) read pairs available; of these: 7930799 (54.78%) trimmed read pairs available after processing 6546025 (45.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 10 0.00% 20 10 0.00% 21 7 0.00% 22 9 0.00% 23 8 0.00% 24 22 0.00% 25 10 0.00% 26 14 0.00% 27 17 0.00% 28 12 0.00% 29 13 0.00% 30 15 0.00% 31 9 0.00% 32 13 0.00% 33 13 0.00% 34 24 0.00% 35 26 0.00% 36 28 0.00% 37 15 0.00% 38 25 0.00% 39 25 0.00% 40 26 0.00% 41 27 0.00% 42 32 0.00% 43 52 0.00% 44 50 0.00% 45 52 0.00% 46 64 0.00% 47 65 0.00% 48 72 0.00% 49 98 0.00% 50 99 0.00% 51 109 0.00% 52 129 0.00% 53 126 0.00% 54 131 0.00% 55 157 0.00% 56 173 0.00% 57 186 0.00% 58 207 0.00% 59 223 0.00% 60 282 0.00% 61 356 0.00% 62 412 0.00% 63 393 0.00% 64 543 0.00% 65 536 0.00% 66 633 0.00% 67 747 0.01% 68 774 0.01% 69 1022 0.01% 70 1101 0.01% 71 1196 0.01% 72 1347 0.01% 73 1393 0.01% 74 1604 0.01% 75 1803 0.01% 76 1944 0.01% 77 2097 0.01% 78 2363 0.02% 79 2749 0.02% 80 2994 0.02% 81 3372 0.02% 82 3762 0.03% 83 4426 0.03% 84 5935 0.04% 85 7018 0.05% 86 7226 0.05% 87 7438 0.05% 88 7800 0.05% 89 8332 0.06% 90 8819 0.06% 91 9339 0.06% 92 10153 0.07% 93 10837 0.07% 94 11173 0.08% 95 11887 0.08% 96 12120 0.08% 97 12684 0.09% 98 12980 0.09% 99 13618 0.09% 100 14501 0.10% 101 15340 0.11% 102 16288 0.11% 103 16763 0.12% 104 17830 0.12% 105 18661 0.13% 106 19038 0.13% 107 19983 0.14% 108 20588 0.14% 109 21501 0.15% 110 22263 0.15% 111 23523 0.16% 112 24764 0.17% 113 25912 0.18% 114 26910 0.19% 115 28328 0.20% 116 29123 0.20% 117 30282 0.21% 118 31544 0.22% 119 32171 0.22% 120 34100 0.24% 121 34827 0.24% 122 36218 0.25% 123 38400 0.27% 124 40074 0.28% 125 41906 0.29% 126 44320 0.31% 127 45935 0.32% 128 47861 0.33% 129 50261 0.35% 130 51602 0.36% 131 53786 0.37% 132 57236 0.40% 133 60527 0.42% 134 63720 0.44% 135 67639 0.47% 136 70827 0.49% 137 76806 0.53% 138 82799 0.57% 139 88056 0.61% 140 94909 0.66% 141 104252 0.72% 142 115266 0.80% 143 130942 0.90% 144 151144 1.04% 145 186117 1.29% 146 227569 1.57% 147 311561 2.15% 148 456688 3.15% 149 870921 6.02% 150 3541600 24.46% 151 6546025 45.22% 14476824 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=21 prefix-density=0.96 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=81.96 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.0 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=12 prefix-density=0.81 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=72.87 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCT SRR7172464 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 19:58:28 Started mapping on | Feb 14 19:58:28 Finished on | Feb 14 20:00:47 Mapping speed, Million of reads per hour | 374.94 Number of input reads | 14476824 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13492236 Uniquely mapped reads % | 93.20% Average mapped length | 292.13 Number of splices: Total | 12863164 Number of splices: Annotated (sjdb) | 12609185 Number of splices: GT/AG | 12596560 Number of splices: GC/AG | 226250 Number of splices: AT/AC | 7289 Number of splices: Non-canonical | 33065 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 396524 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 43021 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.66% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 616414 616414 616414 N_multimapping 396524 396524 396524 N_noFeature 439140 13267878 540799 N_ambiguous 210594 1028 87124 UnstrandedReadsAssigned:12842502 PositiveStrandReadsAssigned:223330 NegativeStrandReadsAssigned:12864313 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172464 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172464-trimmed-pair1.fastq SRR7172464-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,476,824 reads, 12,945,481 reads pseudoaligned [quant] estimated average fragment length: 250.324 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR7172464.ke.tsv 34699 SRR7172464.se.tsv 87100 total ==> SRR7172464.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.68 249 10.1202 Potri.005G024800.1.v4.1 1035 785.676 161 14.7306 Potri.004G059700.1.v4.1 961 711.808 6 0.605937 Potri.007G009000.2.v4.1 1416 1166.68 1 0.0616153 Potri.003G141000.2.v4.1 2943 2693.68 526 14.0372 Potri.016G087400.1.v4.1 270 83.3052 487 420.238 Potri.015G069301.1.v4.1 564 324.063 0 0 Potri.010G195200.1.v4.1 1773 1523.68 2 0.0943574 Potri.012G127500.1.v4.1 977 727.758 399 39.4117 ==> SRR7172464.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 27 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 23 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7172464 completed mapping pipeline successfully