Starting /dee2/code/volunteer_pipeline.sh SRR7172465 current disk space = 3110538330112 free memory = 1279689872 SRR7172465 SRAfilesize ae3b7f106c630dbbfaafcc8a98c1778e SRR7172465.sra SRR7172465.sra file validated SRR7172465 is paired end SRR7172465 is conventional basespace SRR7172465 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172465_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46275 34.0 33.0 34.0 33.0 34.0 2 33.36475 34.0 34.0 34.0 33.0 34.0 3 33.42175 34.0 34.0 34.0 33.0 34.0 4 33.52325 34.0 34.0 34.0 33.0 34.0 5 33.488 34.0 34.0 34.0 33.0 34.0 6 37.277 38.0 38.0 38.0 36.0 38.0 7 37.50575 38.0 38.0 38.0 37.0 38.0 8 37.51625 38.0 38.0 38.0 38.0 38.0 9 37.5315 38.0 38.0 38.0 38.0 38.0 10-14 37.524750000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.540600000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.498599999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.49025 38.0 38.0 38.0 38.0 38.0 30-34 37.46245 38.0 38.0 38.0 38.0 38.0 35-39 37.354499999999994 38.0 38.0 38.0 37.2 38.0 40-44 37.09245 38.0 38.0 38.0 36.0 38.0 45-49 37.05105 38.0 38.0 38.0 36.0 38.0 50-54 36.957300000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.827999999999996 38.0 38.0 38.0 35.6 38.0 60-64 36.85555 38.0 38.0 38.0 35.6 38.0 65-69 36.76735000000001 38.0 38.0 38.0 35.2 38.0 70-74 36.64985 38.0 38.0 38.0 34.4 38.0 75-79 36.5218 38.0 38.0 38.0 34.0 38.0 80-84 36.353500000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.1992 38.0 38.0 38.0 33.4 38.0 90-94 36.20915 38.0 37.4 38.0 33.6 38.0 95-99 35.971399999999996 38.0 37.0 38.0 32.6 38.0 100-104 35.8104 38.0 37.0 38.0 31.6 38.0 105-109 35.6539 38.0 37.0 38.0 30.6 38.0 110-114 35.21704999999999 38.0 36.0 38.0 28.6 38.0 115-119 35.20625 38.0 36.0 38.0 28.4 38.0 120-124 35.156 38.0 35.8 38.0 28.4 38.0 125-129 34.64254999999999 38.0 35.0 38.0 26.8 38.0 130-134 34.08225 38.0 34.6 38.0 24.0 38.0 135-139 33.4586 38.0 33.8 38.0 19.4 38.0 140-144 32.638 38.0 32.8 38.0 13.8 38.0 145-149 31.521449999999998 38.0 31.2 38.0 8.4 38.0 150-151 26.303375000000003 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 2.0 10 1.0 11 0.0 12 1.0 13 1.0 14 3.0 15 1.0 16 3.0 17 2.0 18 7.0 19 4.0 20 5.0 21 9.0 22 15.0 23 14.0 24 13.0 25 20.0 26 23.0 27 37.0 28 26.0 29 40.0 30 49.0 31 84.0 32 83.0 33 120.0 34 194.0 35 354.0 36 880.0 37 2006.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.72384396796693 15.293205889950917 8.679927667269439 37.30302247481271 2 21.375 18.875 35.375 24.375 3 18.2 26.174999999999997 27.224999999999998 28.4 4 21.875 33.7 22.675 21.75 5 21.575 36.025 23.825 18.575 6 17.875 34.175 26.424999999999997 21.525 7 13.4 22.900000000000002 44.125 19.575 8 17.125 23.474999999999998 31.55 27.85 9 18.525 24.0 32.35 25.124999999999996 10-14 19.650000000000002 30.17 26.325 23.855 15-19 19.955000000000002 28.32 27.605 24.12 20-24 19.585979298964947 28.536426821341067 28.32141607080354 23.556177808890443 25-29 19.555977798889945 28.641432071603578 28.106405320266013 23.69618480924046 30-34 19.300965048252415 28.7964398219911 28.046402320116005 23.85619280964048 35-39 19.358711420139063 28.622880296133257 27.882547146215796 24.13586113751188 40-44 19.987989190271243 28.59073165849264 28.150335301771594 23.27094384946452 45-49 20.449314520164112 28.965275692985088 27.73941759231462 22.845992194536173 50-54 19.871891107441325 28.459190311765 27.818645848971624 23.85027273182205 55-59 20.074088906688026 28.30396475770925 27.968562274729674 23.653384060873048 60-64 20.055068836045056 28.28035043804756 27.519399249061326 24.14518147684606 65-69 20.055068836045056 28.090112640801003 28.030037546933666 23.824780976220275 70-74 19.824780976220275 28.695869837296623 27.804755944931163 23.67459324155194 75-79 19.869837296620776 29.15644555694618 27.264080100125156 23.709637046307886 80-84 19.779724655819773 28.911138923654566 27.399249061326657 23.909887359198997 85-89 20.28035043804756 29.146433041301627 26.968710888610765 23.60450563204005 90-94 20.755944931163956 28.065081351689614 27.198998748435542 23.979974968710888 95-99 20.785982478097623 28.48560700876095 27.43929912390488 23.289111389236545 100-104 20.62975570684822 28.534241089307166 27.50800961153384 23.327993592310772 105-109 20.39753667451059 28.623641916587395 27.56721574125069 23.41160566765133 110-114 20.814139795714 27.94912878029241 27.87402363308632 23.36270779090727 115-119 20.2833258246984 28.86819842819242 27.116183611152827 23.73229213595635 120-124 20.599999999999998 28.665000000000003 26.93 23.805 125-129 21.20772463478087 28.417050230138084 26.94616770062037 23.429057434460677 130-134 20.455116290751995 29.175666850856487 26.86994524539107 23.499271613000452 135-139 20.754241981773326 28.42253662957555 26.997633553194706 23.82558783545642 140-144 21.648709596592333 27.732397895264345 26.20897018291155 24.409922325231772 145-149 20.53 28.599999999999998 27.115000000000002 23.755000000000003 150-151 20.625 27.4125 27.825 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.5 19 2.0 20 1.0 21 1.5 22 1.5 23 3.5 24 4.5 25 3.0 26 6.5 27 11.5 28 14.0 29 17.0 30 21.0 31 26.0 32 36.0 33 48.5 34 57.5 35 71.0 36 96.5 37 134.0 38 157.5 39 166.0 40 187.5 41 202.5 42 227.5 43 258.5 44 269.0 45 258.5 46 248.0 47 236.0 48 208.5 49 188.0 50 172.0 51 149.5 52 116.5 53 92.0 54 76.0 55 56.0 56 39.0 57 33.0 58 29.0 59 20.5 60 13.0 61 9.5 62 9.5 63 7.5 64 3.0 65 1.5 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.005 30-34 0.005 35-39 0.045 40-44 0.09 45-49 0.06999999999999999 50-54 0.08499999999999999 55-59 0.12 60-64 0.125 65-69 0.125 70-74 0.125 75-79 0.125 80-84 0.125 85-89 0.125 90-94 0.125 95-99 0.125 100-104 0.12 105-109 0.135 110-114 0.13999999999999999 115-119 0.11499999999999999 120-124 0.0 125-129 0.06 130-134 0.46499999999999997 135-139 0.695 140-144 0.22499999999999998 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3193849256365 98.5 2 0.5797832114948324 1.15 3 0.050415931434333254 0.15 4 0.050415931434333254 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.425 0.0 0.0 0.0 0.0 100-101 1.8125 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.5999999999999996 0.0 0.0 0.0 0.0 108-109 2.975 0.0 0.0 0.0 0.0 110-111 3.2875 0.0 0.0 0.0 0.0 112-113 3.575 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.375 0.0 0.0 0.0 0.0 118-119 4.8625 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.4875 0.0 0.0 0.0 0.0 124-125 6.025 0.0 0.0 0.0 0.0 126-127 6.5 0.0 0.0 0.0 0.0 128-129 7.012499999999999 0.0 0.0 0.0 0.0 130-131 7.5875 0.0 0.0 0.0 0.0 132-133 7.975 0.0 0.0 0.0 0.0 134-135 8.5 0.0 0.0 0.0 0.0 136-137 9.075 0.0 0.0 0.0 0.0 138-139 9.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACATT 10 0.0068857023 144.61249 2 >>END_MODULE SRR7172465 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172465_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96325 33.0 33.0 34.0 32.0 34.0 2 32.9605 34.0 33.0 34.0 32.0 34.0 3 33.02275 34.0 33.0 34.0 32.0 34.0 4 32.971 34.0 33.0 34.0 32.0 34.0 5 32.926 34.0 33.0 34.0 32.0 34.0 6 37.1555 38.0 38.0 38.0 37.0 38.0 7 37.09225 38.0 38.0 38.0 37.0 38.0 8 37.172 38.0 38.0 38.0 37.0 38.0 9 37.10125 38.0 38.0 38.0 37.0 38.0 10-14 37.15604999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.13225 38.0 38.0 38.0 37.0 38.0 20-24 37.121599999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.14525 38.0 38.0 38.0 37.0 38.0 30-34 37.00705 38.0 38.0 38.0 37.0 38.0 35-39 37.02705 38.0 38.0 38.0 37.0 38.0 40-44 37.02285 38.0 38.0 38.0 37.0 38.0 45-49 37.01065 38.0 38.0 38.0 37.0 38.0 50-54 36.972849999999994 38.0 38.0 38.0 37.0 38.0 55-59 36.8902 38.0 38.0 38.0 36.6 38.0 60-64 36.89835000000001 38.0 38.0 38.0 36.6 38.0 65-69 36.7691 38.0 38.0 38.0 36.0 38.0 70-74 36.70545 38.0 38.0 38.0 36.0 38.0 75-79 36.63955 38.0 38.0 38.0 35.8 38.0 80-84 36.528749999999995 38.0 38.0 38.0 35.4 38.0 85-89 36.38825 38.0 38.0 38.0 34.8 38.0 90-94 36.2218 38.0 38.0 38.0 34.2 38.0 95-99 36.09085 38.0 38.0 38.0 34.0 38.0 100-104 35.99565 38.0 38.0 38.0 33.8 38.0 105-109 35.9546 38.0 38.0 38.0 33.4 38.0 110-114 35.7296 38.0 37.6 38.0 33.0 38.0 115-119 35.487700000000004 38.0 37.2 38.0 31.0 38.0 120-124 35.249649999999995 38.0 37.2 38.0 30.2 38.0 125-129 34.93615 38.0 36.4 38.0 28.2 38.0 130-134 34.45864999999999 38.0 35.6 38.0 25.6 38.0 135-139 33.991949999999996 38.0 34.6 38.0 22.8 38.0 140-144 33.15855 38.0 33.2 38.0 15.2 38.0 145-149 32.12115 38.0 33.0 38.0 8.6 38.0 150-151 27.753500000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 7.0 4 4.0 5 3.0 6 2.0 7 2.0 8 0.0 9 3.0 10 4.0 11 2.0 12 8.0 13 3.0 14 2.0 15 1.0 16 7.0 17 7.0 18 6.0 19 7.0 20 8.0 21 12.0 22 7.0 23 16.0 24 20.0 25 23.0 26 12.0 27 29.0 28 24.0 29 32.0 30 53.0 31 50.0 32 72.0 33 76.0 34 119.0 35 242.0 36 543.0 37 2588.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.25 18.675 12.950000000000001 28.125 2 25.3003003003003 27.002002002002 31.256256256256254 16.441441441441444 3 21.396396396396398 28.52852852852853 30.38038038038038 19.694694694694697 4 23.423423423423422 36.91191191191191 22.27227227227227 17.39239239239239 5 24.44944944944945 37.16216216216216 21.52152152152152 16.866866866866868 6 18.825 39.375 24.2 17.599999999999998 7 18.025 18.875 41.525 21.575 8 19.425 24.9 28.449999999999996 27.224999999999998 9 22.05 23.9 29.9 24.15 10-14 23.225 28.845 26.38 21.55 15-19 22.99 28.325 28.185 20.5 20-24 22.855 27.639999999999997 28.410000000000004 21.095 25-29 22.64 29.099999999999998 28.215 20.044999999999998 30-34 23.055 27.785 28.705000000000002 20.455000000000002 35-39 23.11615580779039 28.266413320666032 27.66638331916596 20.95104755237762 40-44 22.45 28.405 28.265 20.880000000000003 45-49 22.33611680584029 27.646382319115958 28.601430071503575 21.416070803540176 50-54 22.96614830741537 27.76638831941597 28.816440822041102 20.451022551127558 55-59 23.05 27.689999999999998 28.294999999999998 20.965 60-64 22.720000000000002 28.299999999999997 28.23 20.75 65-69 23.849999999999998 27.61 27.91 20.630000000000003 70-74 23.075000000000003 28.13 27.985 20.810000000000002 75-79 23.34 27.634999999999998 28.194999999999997 20.830000000000002 80-84 23.165 28.249999999999996 27.77 20.815 85-89 23.386169308465423 28.506425321266065 27.86639331966598 20.24101205060253 90-94 23.598539780967144 27.98419762964445 28.10921638245737 20.308046206931042 95-99 23.442344234423445 27.762776277627765 28.06780678067807 20.72707270727073 100-104 23.830000000000002 27.955000000000002 27.529999999999998 20.685000000000002 105-109 23.565 28.04 27.794999999999998 20.599999999999998 110-114 23.845 28.189999999999998 28.015 19.950000000000003 115-119 24.015 28.310000000000002 27.439999999999998 20.235 120-124 23.905 27.925 27.98 20.19 125-129 24.54 27.775 27.639999999999997 20.044999999999998 130-134 25.570342205323193 27.62157294376626 27.416449869921955 19.39163498098859 135-139 25.434249386794818 27.086149071432146 27.42654052159984 20.0530610201732 140-144 24.884999999999998 28.155 27.07 19.89 145-149 25.575 27.794999999999998 26.88 19.75 150-151 25.35 28.462500000000002 27.200000000000003 18.987499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 1.0 23 2.5 24 5.0 25 7.0 26 8.0 27 7.0 28 8.0 29 15.0 30 24.0 31 25.0 32 27.5 33 35.0 34 49.5 35 74.0 36 88.5 37 110.0 38 138.0 39 167.5 40 213.0 41 229.5 42 242.5 43 274.0 44 277.0 45 277.0 46 275.0 47 235.5 48 193.0 49 192.5 50 164.5 51 114.5 52 109.0 53 93.5 54 71.0 55 61.5 56 45.0 57 36.0 58 26.0 59 17.0 60 16.5 61 10.5 62 8.0 63 9.0 64 4.5 65 1.5 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.005 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.015 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.06 135-139 0.11499999999999999 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31783729156139 98.275 2 0.48004042445679634 0.95 3 0.1010611419909045 0.3 4 0.05053057099545225 0.2 5 0.025265285497726126 0.125 6 0.025265285497726126 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.2625 0.0 0.0 0.0 0.0 106-107 2.5250000000000004 0.0 0.0 0.0 0.0 108-109 2.9124999999999996 0.0 0.0 0.0 0.0 110-111 3.2375 0.0 0.0 0.0 0.0 112-113 3.55 0.0 0.0 0.0 0.0 114-115 3.875 0.0 0.0 0.0 0.0 116-117 4.325 0.0 0.0 0.0 0.0 118-119 4.8375 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.5125 0.0 0.0 0.0 0.0 124-125 6.0625 0.0 0.0 0.0 0.0 126-127 6.5375 0.0 0.0 0.0 0.0 128-129 7.0625 0.0 0.0 0.0 0.0 130-131 7.6625 0.0 0.0 0.0 0.0 132-133 8.0625 0.0 0.0 0.0 0.0 134-135 8.575 0.0 0.0 0.0 0.0 136-137 9.175 0.0 0.0 0.0 0.0 138-139 9.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAATC 10 0.006830828 145.0 1 >>END_MODULE Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra Read 725110 spots for SRR7172465.sra Written 725110 spots for SRR7172465.sra SRR ids: ['SRR7172465.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t55sutib SRR7172465.sra spots: 14502200 blocks: [[1, 725110], [725111, 1450220], [1450221, 2175330], [2175331, 2900440], [2900441, 3625550], [3625551, 4350660], [4350661, 5075770], [5075771, 5800880], [5800881, 6525990], [6525991, 7251100], [7251101, 7976210], [7976211, 8701320], [8701321, 9426430], [9426431, 10151540], [10151541, 10876650], [10876651, 11601760], [11601761, 12326870], [12326871, 13051980], [13051981, 13777090], [13777091, 14502200]] SRR7172465 file size 4892619 SRR7172465 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172465 SRR7172465_1.fastq SRR7172465_2.fastq Input file: SRR7172465_1.fastq Paired file: SRR7172465_2.fastq trimmed: SRR7172465-trimmed-pair1.fastq, SRR7172465-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 19:09:25 2025 >> started Fri Feb 14 19:09:55 2025 >> done (29.269s) 14502200 read pairs processed; of these: 18911 ( 0.13%) short read pairs filtered out after trimming by size control 58190 ( 0.40%) empty read pairs filtered out after trimming by size control 14425099 (99.47%) read pairs available; of these: 7654848 (53.07%) trimmed read pairs available after processing 6770251 (46.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 8 0.00% 21 6 0.00% 22 6 0.00% 23 8 0.00% 24 11 0.00% 25 6 0.00% 26 7 0.00% 27 14 0.00% 28 10 0.00% 29 8 0.00% 30 18 0.00% 31 13 0.00% 32 9 0.00% 33 16 0.00% 34 10 0.00% 35 17 0.00% 36 20 0.00% 37 20 0.00% 38 7 0.00% 39 24 0.00% 40 21 0.00% 41 20 0.00% 42 40 0.00% 43 40 0.00% 44 47 0.00% 45 33 0.00% 46 58 0.00% 47 61 0.00% 48 54 0.00% 49 80 0.00% 50 91 0.00% 51 109 0.00% 52 122 0.00% 53 106 0.00% 54 131 0.00% 55 133 0.00% 56 175 0.00% 57 222 0.00% 58 240 0.00% 59 247 0.00% 60 307 0.00% 61 359 0.00% 62 394 0.00% 63 456 0.00% 64 520 0.00% 65 528 0.00% 66 629 0.00% 67 743 0.01% 68 896 0.01% 69 1286 0.01% 70 1434 0.01% 71 1249 0.01% 72 1431 0.01% 73 1595 0.01% 74 1858 0.01% 75 1921 0.01% 76 2175 0.02% 77 2485 0.02% 78 2683 0.02% 79 2986 0.02% 80 3350 0.02% 81 3881 0.03% 82 4430 0.03% 83 4975 0.03% 84 6131 0.04% 85 7176 0.05% 86 7460 0.05% 87 7835 0.05% 88 8558 0.06% 89 9193 0.06% 90 9670 0.07% 91 10669 0.07% 92 12441 0.09% 93 13109 0.09% 94 13184 0.09% 95 14667 0.10% 96 14591 0.10% 97 15275 0.11% 98 15859 0.11% 99 16579 0.11% 100 17990 0.12% 101 18886 0.13% 102 20389 0.14% 103 21722 0.15% 104 22341 0.15% 105 23664 0.16% 106 24080 0.17% 107 25003 0.17% 108 25774 0.18% 109 26940 0.19% 110 28144 0.20% 111 29177 0.20% 112 30700 0.21% 113 32193 0.22% 114 33656 0.23% 115 35275 0.24% 116 36235 0.25% 117 37315 0.26% 118 38380 0.27% 119 39068 0.27% 120 40452 0.28% 121 41680 0.29% 122 43398 0.30% 123 45490 0.32% 124 47296 0.33% 125 48908 0.34% 126 51246 0.36% 127 52411 0.36% 128 54023 0.37% 129 55422 0.38% 130 57407 0.40% 131 59362 0.41% 132 61566 0.43% 133 65010 0.45% 134 67811 0.47% 135 71354 0.49% 136 74746 0.52% 137 78754 0.55% 138 83331 0.58% 139 88218 0.61% 140 93093 0.65% 141 101144 0.70% 142 109295 0.76% 143 121305 0.84% 144 139374 0.97% 145 164796 1.14% 146 204243 1.42% 147 266213 1.85% 148 387703 2.69% 149 737118 5.11% 150 3348499 23.21% 151 6770251 46.93% 14425099 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=21 prefix-density=0.38 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=13.43 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=2.1 sequence=TGCTTGCTTCTAATCTTAATGGCGCCCACAATTACGCTTGTAAGGATTTGGGCAACC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=25 prefix-density=0.87 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=23.28 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.6 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7172465 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 19:11:49 Started mapping on | Feb 14 19:11:49 Finished on | Feb 14 19:13:40 Mapping speed, Million of reads per hour | 467.84 Number of input reads | 14425099 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13436881 Uniquely mapped reads % | 93.15% Average mapped length | 291.08 Number of splices: Total | 12932382 Number of splices: Annotated (sjdb) | 12636704 Number of splices: GT/AG | 12682081 Number of splices: GC/AG | 197711 Number of splices: AT/AC | 7717 Number of splices: Non-canonical | 44873 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388885 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 90518 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.38% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 616886 616886 616886 N_multimapping 388885 388885 388885 N_noFeature 580541 13200446 680131 N_ambiguous 225342 1112 87748 UnstrandedReadsAssigned:12630998 PositiveStrandReadsAssigned:235323 NegativeStrandReadsAssigned:12669002 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7172465 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172465-trimmed-pair1.fastq SRR7172465-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,425,099 reads, 12,686,702 reads pseudoaligned [quant] estimated average fragment length: 232.656 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR7172465.ke.tsv 34699 SRR7172465.se.tsv 87100 total ==> SRR7172465.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.34 625 24.88 Potri.005G024800.1.v4.1 1035 803.344 233 20.6248 Potri.004G059700.1.v4.1 961 729.461 14 1.36477 Potri.007G009000.2.v4.1 1416 1184.34 0 0 Potri.003G141000.2.v4.1 2943 2711.34 887.958 23.2886 Potri.016G087400.1.v4.1 270 88.3994 1028 826.949 Potri.015G069301.1.v4.1 564 338.969 0 0 Potri.010G195200.1.v4.1 1773 1541.34 180 8.3044 Potri.012G127500.1.v4.1 977 745.406 64 6.10551 ==> SRR7172465.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 845 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 227 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 6 SRR7172465 completed mapping pipeline successfully