Starting /dee2/code/volunteer_pipeline.sh SRR7172466 current disk space = 3058897866752 free memory = 1580296124 SRR7172466 SRAfilesize 75f14dca4e56a9e00d10a2562ef8a960 SRR7172466.sra SRR7172466.sra file validated SRR7172466 is paired end SRR7172466 is conventional basespace SRR7172466 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172466_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0875 34.0 33.0 34.0 33.0 34.0 2 33.404 34.0 33.0 34.0 33.0 34.0 3 33.434 34.0 34.0 34.0 33.0 34.0 4 33.44375 34.0 34.0 34.0 33.0 34.0 5 33.33975 34.0 34.0 34.0 33.0 34.0 6 37.00875 38.0 37.0 38.0 36.0 38.0 7 37.355 38.0 38.0 38.0 37.0 38.0 8 37.35225 38.0 38.0 38.0 37.0 38.0 9 37.45675 38.0 38.0 38.0 37.0 38.0 10-14 37.428549999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.4298 38.0 38.0 38.0 37.4 38.0 20-24 37.4572 38.0 38.0 38.0 37.4 38.0 25-29 37.429199999999994 38.0 38.0 38.0 37.4 38.0 30-34 37.395450000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.271750000000004 38.0 38.0 38.0 36.8 38.0 40-44 37.166700000000006 38.0 38.0 38.0 36.4 38.0 45-49 37.0719 38.0 38.0 38.0 36.0 38.0 50-54 36.916700000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.878 38.0 38.0 38.0 35.4 38.0 60-64 36.886449999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.878750000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.722 38.0 38.0 38.0 34.8 38.0 75-79 36.6145 38.0 38.0 38.0 34.2 38.0 80-84 36.5058 38.0 38.0 38.0 34.2 38.0 85-89 36.357150000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.2539 38.0 38.0 38.0 33.6 38.0 95-99 36.20215 38.0 37.8 38.0 33.8 38.0 100-104 35.93625 38.0 37.0 38.0 32.8 38.0 105-109 35.88095 38.0 37.0 38.0 32.2 38.0 110-114 35.4675 38.0 36.6 38.0 30.2 38.0 115-119 35.32225 38.0 36.0 38.0 29.4 38.0 120-124 35.189949999999996 38.0 36.0 38.0 28.8 38.0 125-129 34.96485 38.0 35.8 38.0 28.0 38.0 130-134 34.525549999999996 38.0 35.0 38.0 27.0 38.0 135-139 34.029650000000004 38.0 34.8 38.0 23.4 38.0 140-144 33.4649 38.0 34.0 38.0 19.8 38.0 145-149 32.66155 38.0 33.2 38.0 14.2 38.0 150-151 28.200875 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 1.0 12 1.0 13 2.0 14 0.0 15 2.0 16 1.0 17 4.0 18 6.0 19 4.0 20 4.0 21 12.0 22 9.0 23 10.0 24 10.0 25 15.0 26 22.0 27 27.0 28 34.0 29 54.0 30 45.0 31 68.0 32 85.0 33 122.0 34 176.0 35 297.0 36 753.0 37 2231.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.53030303030303 16.161616161616163 12.121212121212121 31.186868686868685 2 24.2 18.3 33.1 24.4 3 17.925 26.125 27.425 28.525 4 22.125 32.675 23.9 21.3 5 20.530796194291437 36.629944917376065 24.73710565848773 18.102153229844767 6 17.775 35.5 25.7 21.025 7 14.875 22.175 43.55 19.400000000000002 8 17.025000000000002 23.7 31.45 27.825 9 16.6 24.6 31.974999999999998 26.825 10-14 20.064999999999998 29.01 26.825 24.099999999999998 15-19 19.68 28.98 27.805000000000003 23.535 20-24 19.134999999999998 29.025000000000002 28.485 23.355 25-29 19.915 29.45 27.700000000000003 22.935 30-34 20.02 28.63 27.765 23.585 35-39 19.59489872468117 28.877219304826205 28.057014253563388 23.470867716929234 40-44 20.489097819563913 28.700740148029606 27.045409081816363 23.76475295059012 45-49 19.879969992498125 28.452113028257063 27.731932983245812 23.935983995999 50-54 20.060015003750937 28.057014253563388 28.197049262315577 23.68592148037009 55-59 20.37120416228926 27.845314923207766 28.10045525038771 23.683025664115263 60-64 20.1430930104568 28.98884274778606 27.152649221994295 23.715415019762844 65-69 20.221121616889288 28.445645104807642 28.12046625644104 23.212767021862025 70-74 20.66963615434663 28.472048446023724 27.08573144487263 23.772583954757017 75-79 20.53437406184329 28.499949964975485 27.814470129090363 23.151205844090864 80-84 19.684842421210604 28.269134567283643 27.828914457228613 24.21710855427714 85-89 21.087380583204123 28.014805181813635 27.139498824588603 23.75831541039364 90-94 20.24506126531633 27.76694173543386 27.921980495123783 24.066016504126033 95-99 20.57117135140542 27.923377013103934 27.603280984295285 23.90217065119536 100-104 20.91346153846154 28.555689102564102 27.39883814102564 23.132011217948715 105-109 20.65445812068448 28.024617232062443 27.55428800160112 23.766636645651957 110-114 20.774277557970652 28.391846546802224 27.800871437872487 23.033004457354636 115-119 21.536152114085564 28.416312234175635 27.135351513635225 22.912184138103576 120-124 21.035 28.449999999999996 27.08 23.435 125-129 21.38 28.15 26.935 23.535 130-134 20.819540575784934 28.914635369645904 26.898384993479784 23.367439061089375 135-139 21.25671806720579 28.087799487668892 27.223868602139735 23.431613842985584 140-144 21.050788091068302 28.221165874405806 26.89016762571929 23.837878408806603 145-149 21.295 27.93 26.51 24.265 150-151 20.75 28.037499999999998 27.3875 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 3.0 20 2.0 21 0.5 22 0.5 23 1.0 24 3.0 25 7.5 26 10.0 27 8.5 28 11.0 29 17.5 30 21.0 31 33.0 32 45.5 33 48.5 34 66.5 35 90.0 36 93.0 37 96.5 38 123.0 39 155.5 40 190.0 41 224.5 42 239.0 43 245.5 44 257.0 45 253.0 46 243.0 47 223.5 48 216.0 49 209.5 50 168.0 51 136.5 52 114.0 53 95.5 54 79.0 55 61.0 56 50.0 57 37.0 58 30.0 59 25.0 60 21.5 61 16.5 62 8.5 63 6.0 64 4.0 65 1.5 66 0.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.02 45-49 0.025 50-54 0.025 55-59 0.055 60-64 0.065 65-69 0.055 70-74 0.095 75-79 0.06999999999999999 80-84 0.05 85-89 0.034999999999999996 90-94 0.025 95-99 0.03 100-104 0.16 105-109 0.06999999999999999 110-114 0.165 115-119 0.075 120-124 0.0 125-129 0.0 130-134 0.31 135-139 0.455 140-144 0.075 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.4749999999999996 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.35 0.0 0.0 0.0 0.0 132-133 4.7875 0.0 0.0 0.0 0.0 134-135 5.300000000000001 0.0 0.0 0.0 0.0 136-137 5.7125 0.0 0.0 0.0 0.0 138-139 6.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTATGC 10 0.006830828 145.0 6 >>END_MODULE SRR7172466 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172466_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34925 33.0 33.0 34.0 31.0 34.0 2 32.4625 33.0 33.0 34.0 31.0 34.0 3 32.38475 33.0 33.0 34.0 31.0 34.0 4 32.31525 33.0 33.0 34.0 31.0 34.0 5 32.22575 33.0 33.0 34.0 31.0 34.0 6 36.27075 38.0 38.0 38.0 34.0 38.0 7 36.3805 38.0 38.0 38.0 35.0 38.0 8 36.29825 38.0 38.0 38.0 34.0 38.0 9 36.34725 38.0 38.0 38.0 34.0 38.0 10-14 36.36365 38.0 38.0 38.0 34.6 38.0 15-19 36.367000000000004 38.0 38.0 38.0 34.8 38.0 20-24 36.3562 38.0 38.0 38.0 35.0 38.0 25-29 36.32965 38.0 38.0 38.0 35.0 38.0 30-34 36.28515 38.0 38.0 38.0 34.6 38.0 35-39 36.1989 38.0 38.0 38.0 34.2 38.0 40-44 36.082049999999995 38.0 38.0 38.0 34.0 38.0 45-49 36.12335 38.0 38.0 38.0 34.2 38.0 50-54 36.15409999999999 38.0 38.0 38.0 34.0 38.0 55-59 36.0868 38.0 38.0 38.0 34.0 38.0 60-64 36.01109999999999 38.0 38.0 38.0 34.0 38.0 65-69 35.9335 38.0 38.0 38.0 33.8 38.0 70-74 35.83615 38.0 38.0 38.0 33.4 38.0 75-79 35.7308 38.0 38.0 38.0 33.0 38.0 80-84 35.6548 38.0 38.0 38.0 33.0 38.0 85-89 35.489250000000006 38.0 38.0 38.0 32.2 38.0 90-94 35.36364999999999 38.0 37.6 38.0 30.6 38.0 95-99 35.199650000000005 38.0 37.0 38.0 30.2 38.0 100-104 35.00655 38.0 37.0 38.0 28.4 38.0 105-109 34.92535 38.0 37.0 38.0 28.0 38.0 110-114 34.694399999999995 38.0 36.4 38.0 27.0 38.0 115-119 34.526300000000006 38.0 36.0 38.0 26.4 38.0 120-124 34.225 38.0 35.8 38.0 23.2 38.0 125-129 33.9091 38.0 35.0 38.0 22.2 38.0 130-134 33.49765 38.0 34.8 38.0 16.6 38.0 135-139 32.9588 38.0 33.8 38.0 13.8 38.0 140-144 32.3734 38.0 33.2 38.0 13.2 38.0 145-149 31.394600000000004 38.0 31.8 38.0 6.4 38.0 150-151 26.8495 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 11.0 4 8.0 5 7.0 6 9.0 7 7.0 8 5.0 9 2.0 10 7.0 11 8.0 12 4.0 13 7.0 14 6.0 15 6.0 16 4.0 17 8.0 18 9.0 19 7.0 20 11.0 21 13.0 22 11.0 23 15.0 24 23.0 25 18.0 26 27.0 27 26.0 28 44.0 29 50.0 30 53.0 31 58.0 32 81.0 33 132.0 34 138.0 35 279.0 36 575.0 37 2296.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.45363408521303 22.431077694235587 13.383458646616543 22.731829573934835 2 27.510040160642568 25.07530120481928 30.3714859437751 17.043172690763054 3 22.06879236756214 27.768014059753952 31.684659804167715 18.478533768516193 4 23.801154908360534 34.145116746171226 23.022847100175746 19.030881245292495 5 24.253075571177504 37.13281446146121 22.018578960582474 16.59553100677881 6 19.533015315089127 38.11197589756465 23.198594024604567 19.15641476274165 7 19.784082349987447 19.482801908109465 39.994978659302035 20.738137082601053 8 19.758975646497614 24.654782827014813 28.496108460959075 27.090133065528498 9 21.139844338438362 25.608837559628423 29.349736379613354 23.901581722319857 10-14 23.22872206879237 28.209892041174996 26.53276424805423 22.028621641978408 15-19 22.69143861410997 28.320361536530253 27.60733115741903 21.380868691940748 20-24 22.917398945518453 28.57142857142857 27.436605573688173 21.0745669093648 25-29 23.299020838563898 27.737886015566154 28.1646999748933 20.798393170976652 30-34 22.872206879236757 28.270148129550588 27.92367562139091 20.933969369821742 35-39 22.74165202108963 28.40572432839568 27.572181772533266 21.28044187798142 40-44 22.867185538538788 27.99397439116244 27.998995731860404 21.139844338438362 45-49 23.113231232739142 27.913632939994983 27.978910369068544 20.994225458197338 50-54 23.093145869947275 27.160431835300024 28.42580969118755 21.320612603565152 55-59 22.671353251318102 28.0893798644238 28.1044438865177 21.134822997740397 60-64 23.288978157167964 27.778056741149886 27.682651267888524 21.250313833793623 65-69 23.54004519206628 26.974642229475272 28.320361536530253 21.164951041928195 70-74 23.670600050213405 27.37132814461461 28.034145116746174 20.92392668842581 75-79 22.832036153653025 27.40145618880241 28.265126788852623 21.501380868691943 80-84 23.434597037408988 27.486818980667838 27.672608586492593 21.40597539543058 85-89 24.017072558373084 27.82827014812955 27.5671604318353 20.587496861662064 90-94 23.431928890674435 27.544819966855822 27.95661125897655 21.066639883493195 95-99 23.275082856282012 27.904991463292156 27.55347996384453 21.266445716581302 100-104 23.565151895556113 27.23073060507155 28.054230479538038 21.149887019834296 105-109 23.48983178508662 27.632437860908865 28.275169470248557 20.602560883755963 110-114 23.7911122269646 27.888526236505147 28.194828019081097 20.12553351744916 115-119 24.17775546070801 27.84333417022345 27.632437860908865 20.34647250815968 120-124 24.162691438614107 28.14461461210143 27.602309816721064 20.090384132563393 125-129 23.88651770022596 27.948782324880746 27.40647752950038 20.75822244539292 130-134 24.49409992467989 27.808184785337687 27.768014059753952 19.92970123022847 135-139 24.649761486316844 27.532011046949535 27.245794627165452 20.572432839568165 140-144 25.28245041426061 27.396434848104445 26.909364800401708 20.411749937233242 145-149 24.91337317330387 28.107266609752422 26.99743885903681 19.981921357906895 150-151 25.433090635199594 27.391413507406476 27.22821993472257 19.947275922671352 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 8.5 2 3.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 2.5 21 1.5 22 3.0 23 4.5 24 5.5 25 7.0 26 4.5 27 6.5 28 9.5 29 12.5 30 16.0 31 19.5 32 27.5 33 34.5 34 48.5 35 64.0 36 84.0 37 100.0 38 116.0 39 149.5 40 187.0 41 213.0 42 238.5 43 257.5 44 274.5 45 281.0 46 256.5 47 241.0 48 223.5 49 206.5 50 170.0 51 133.0 52 122.5 53 105.0 54 85.5 55 66.5 56 52.5 57 39.5 58 28.0 59 22.5 60 17.5 61 13.5 62 10.5 63 5.5 64 3.5 65 3.0 66 2.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.4 3 0.42500000000000004 4 0.42500000000000004 5 0.42500000000000004 6 0.42500000000000004 7 0.42500000000000004 8 0.42500000000000004 9 0.42500000000000004 10-14 0.42500000000000004 15-19 0.42500000000000004 20-24 0.42500000000000004 25-29 0.42500000000000004 30-34 0.42500000000000004 35-39 0.42500000000000004 40-44 0.42500000000000004 45-49 0.42500000000000004 50-54 0.42500000000000004 55-59 0.42500000000000004 60-64 0.42500000000000004 65-69 0.42500000000000004 70-74 0.42500000000000004 75-79 0.42500000000000004 80-84 0.42500000000000004 85-89 0.42500000000000004 90-94 0.43499999999999994 95-99 0.43 100-104 0.42500000000000004 105-109 0.42500000000000004 110-114 0.42500000000000004 115-119 0.42500000000000004 120-124 0.42500000000000004 125-129 0.42500000000000004 130-134 0.42500000000000004 135-139 0.42500000000000004 140-144 0.42500000000000004 145-149 0.43499999999999994 150-151 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39363314805458 98.35000000000001 2 0.404244567963618 0.8 3 0.1010611419909045 0.3 4 0.07579585649317837 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025265285497726126 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.3625 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.7625 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.2750000000000004 0.0 0.0 0.0 0.0 120-121 2.5250000000000004 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.95 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.1625 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 5.0875 0.0 0.0 0.0 0.0 136-137 5.487500000000001 0.0 0.0 0.0 0.0 138-139 6.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776664 spots for SRR7172466.sra Written 776664 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra Read 776650 spots for SRR7172466.sra Written 776650 spots for SRR7172466.sra SRR ids: ['SRR7172466.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iltx7t_r SRR7172466.sra spots: 15533014 blocks: [[1, 776650], [776651, 1553300], [1553301, 2329950], [2329951, 3106600], [3106601, 3883250], [3883251, 4659900], [4659901, 5436550], [5436551, 6213200], [6213201, 6989850], [6989851, 7766500], [7766501, 8543150], [8543151, 9319800], [9319801, 10096450], [10096451, 10873100], [10873101, 11649750], [11649751, 12426400], [12426401, 13203050], [13203051, 13979700], [13979701, 14756350], [14756351, 15533014]] SRR7172466 file size 5241928 SRR7172466 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172466 SRR7172466_1.fastq SRR7172466_2.fastq Input file: SRR7172466_1.fastq Paired file: SRR7172466_2.fastq trimmed: SRR7172466-trimmed-pair1.fastq, SRR7172466-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:25:04 2025 >> started Mon Feb 10 11:25:21 2025 >> done (16.286s) 15533014 read pairs processed; of these: 49904 ( 0.32%) short read pairs filtered out after trimming by size control 90505 ( 0.58%) empty read pairs filtered out after trimming by size control 15392605 (99.10%) read pairs available; of these: 7852982 (51.02%) trimmed read pairs available after processing 7539623 (48.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 7 0.00% 20 12 0.00% 21 12 0.00% 22 8 0.00% 23 3 0.00% 24 10 0.00% 25 12 0.00% 26 15 0.00% 27 13 0.00% 28 16 0.00% 29 16 0.00% 30 11 0.00% 31 20 0.00% 32 15 0.00% 33 17 0.00% 34 23 0.00% 35 22 0.00% 36 16 0.00% 37 56 0.00% 38 24 0.00% 39 45 0.00% 40 33 0.00% 41 38 0.00% 42 41 0.00% 43 38 0.00% 44 64 0.00% 45 122 0.00% 46 105 0.00% 47 95 0.00% 48 78 0.00% 49 79 0.00% 50 102 0.00% 51 120 0.00% 52 122 0.00% 53 138 0.00% 54 126 0.00% 55 131 0.00% 56 162 0.00% 57 164 0.00% 58 244 0.00% 59 257 0.00% 60 309 0.00% 61 337 0.00% 62 360 0.00% 63 411 0.00% 64 486 0.00% 65 503 0.00% 66 644 0.00% 67 797 0.01% 68 941 0.01% 69 1388 0.01% 70 1429 0.01% 71 1220 0.01% 72 1267 0.01% 73 1366 0.01% 74 1538 0.01% 75 1700 0.01% 76 1808 0.01% 77 2028 0.01% 78 2174 0.01% 79 2442 0.02% 80 2869 0.02% 81 3233 0.02% 82 3643 0.02% 83 4291 0.03% 84 6340 0.04% 85 7512 0.05% 86 7924 0.05% 87 8026 0.05% 88 8341 0.05% 89 8641 0.06% 90 9310 0.06% 91 9896 0.06% 92 10509 0.07% 93 11263 0.07% 94 11882 0.08% 95 11878 0.08% 96 12461 0.08% 97 12757 0.08% 98 13236 0.09% 99 14050 0.09% 100 14627 0.10% 101 15727 0.10% 102 16500 0.11% 103 17361 0.11% 104 18096 0.12% 105 19405 0.13% 106 19843 0.13% 107 20261 0.13% 108 21139 0.14% 109 22117 0.14% 110 22952 0.15% 111 24263 0.16% 112 25428 0.17% 113 26548 0.17% 114 27693 0.18% 115 28809 0.19% 116 29668 0.19% 117 30999 0.20% 118 31421 0.20% 119 32574 0.21% 120 34159 0.22% 121 35424 0.23% 122 37050 0.24% 123 38536 0.25% 124 40680 0.26% 125 42047 0.27% 126 43568 0.28% 127 45216 0.29% 128 47253 0.31% 129 49152 0.32% 130 51016 0.33% 131 52943 0.34% 132 55706 0.36% 133 58893 0.38% 134 62186 0.40% 135 66385 0.43% 136 69783 0.45% 137 74397 0.48% 138 79482 0.52% 139 84659 0.55% 140 91005 0.59% 141 99372 0.65% 142 108806 0.71% 143 123091 0.80% 144 141739 0.92% 145 167370 1.09% 146 206547 1.34% 147 277226 1.80% 148 419826 2.73% 149 829811 5.39% 150 3650372 23.72% 151 7539623 48.98% 15392605 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=22 prefix-density=0.66 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=90.02 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.3 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=26 prefix-density=0.44 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=33.63 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.9 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7172466 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:26:07 Started mapping on | Feb 10 11:26:08 Finished on | Feb 10 11:28:01 Mapping speed, Million of reads per hour | 490.38 Number of input reads | 15392605 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14181945 Uniquely mapped reads % | 92.13% Average mapped length | 292.55 Number of splices: Total | 13162799 Number of splices: Annotated (sjdb) | 12866390 Number of splices: GT/AG | 12906296 Number of splices: GC/AG | 202997 Number of splices: AT/AC | 8011 Number of splices: Non-canonical | 45495 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415447 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 65535 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.63% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 836298 836298 836298 N_multimapping 415447 415447 415447 N_noFeature 533019 13903158 635621 N_ambiguous 272911 1041 96139 UnstrandedReadsAssigned:13376015 PositiveStrandReadsAssigned:277746 NegativeStrandReadsAssigned:13450185 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172466 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172466-trimmed-pair1.fastq SRR7172466-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,392,605 reads, 13,455,342 reads pseudoaligned [quant] estimated average fragment length: 251.965 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7172466.ke.tsv 34699 SRR7172466.se.tsv 87100 total ==> SRR7172466.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.04 578 20.098 Potri.005G024800.1.v4.1 1035 784.035 383 30.0147 Potri.004G059700.1.v4.1 961 710.114 11 0.951776 Potri.007G009000.2.v4.1 1416 1165.04 0 0 Potri.003G141000.2.v4.1 2943 2692.04 762 17.3918 Potri.016G087400.1.v4.1 270 81.4542 910 686.433 Potri.015G069301.1.v4.1 564 321.831 0 0 Potri.010G195200.1.v4.1 1773 1522.04 194 7.83154 Potri.012G127500.1.v4.1 977 726.072 281 23.7792 ==> SRR7172466.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 988 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 329 Potri.001G212900.v4.1 163 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 45 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 13 SRR7172466 completed mapping pipeline successfully