Starting /dee2/code/volunteer_pipeline.sh SRR7172467 current disk space = 3059231547392 free memory = 1475729256 SRR7172467 SRAfilesize 7aa63d8223eea94bea370c64cefe385c SRR7172467.sra SRR7172467.sra file validated SRR7172467 is paired end SRR7172467 is conventional basespace SRR7172467 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172467_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.31925 34.0 33.0 34.0 32.0 34.0 2 33.28925 34.0 33.0 34.0 32.0 34.0 3 33.346 34.0 34.0 34.0 33.0 34.0 4 33.4725 34.0 34.0 34.0 33.0 34.0 5 33.4775 34.0 34.0 34.0 33.0 34.0 6 37.19525 38.0 38.0 38.0 36.0 38.0 7 37.42325 38.0 38.0 38.0 37.0 38.0 8 37.56325 38.0 38.0 38.0 37.0 38.0 9 37.52425 38.0 38.0 38.0 37.0 38.0 10-14 37.5083 38.0 38.0 38.0 38.0 38.0 15-19 37.53965 38.0 38.0 38.0 38.0 38.0 20-24 37.55075 38.0 38.0 38.0 38.0 38.0 25-29 37.49825 38.0 38.0 38.0 38.0 38.0 30-34 37.50985 38.0 38.0 38.0 38.0 38.0 35-39 37.4253 38.0 38.0 38.0 37.4 38.0 40-44 37.2254 38.0 38.0 38.0 36.8 38.0 45-49 37.1885 38.0 38.0 38.0 36.6 38.0 50-54 37.07305 38.0 38.0 38.0 36.0 38.0 55-59 37.02015 38.0 38.0 38.0 36.0 38.0 60-64 37.053549999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.9437 38.0 38.0 38.0 36.0 38.0 70-74 36.801 38.0 38.0 38.0 35.2 38.0 75-79 36.67065 38.0 38.0 38.0 35.0 38.0 80-84 36.5532 38.0 38.0 38.0 34.2 38.0 85-89 36.461200000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.2845 38.0 38.0 38.0 34.0 38.0 95-99 36.08409999999999 38.0 37.4 38.0 33.2 38.0 100-104 35.8077 38.0 36.8 38.0 31.2 38.0 105-109 35.872550000000004 38.0 37.0 38.0 32.4 38.0 110-114 35.5541 38.0 36.8 38.0 30.8 38.0 115-119 35.3591 38.0 36.2 38.0 29.6 38.0 120-124 35.0468 38.0 36.0 38.0 28.0 38.0 125-129 34.79559999999999 38.0 35.4 38.0 27.0 38.0 130-134 34.303650000000005 38.0 35.0 38.0 24.0 38.0 135-139 33.93265 38.0 34.4 38.0 22.2 38.0 140-144 33.2121 38.0 33.6 38.0 16.2 38.0 145-149 32.342349999999996 38.0 33.0 38.0 10.8 38.0 150-151 27.3495 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 3.0 14 0.0 15 4.0 16 4.0 17 5.0 18 3.0 19 4.0 20 4.0 21 6.0 22 11.0 23 5.0 24 5.0 25 15.0 26 19.0 27 23.0 28 40.0 29 49.0 30 61.0 31 57.0 32 93.0 33 116.0 34 185.0 35 309.0 36 823.0 37 2152.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.81617837697693 12.652320456313197 10.11148561057817 40.42001555613171 2 19.400000000000002 18.5 37.375 24.725 3 19.675 22.7 26.900000000000002 30.725 4 21.7 33.1 22.775000000000002 22.425 5 21.25 34.449999999999996 25.874999999999996 18.425 6 18.3 35.35 25.924999999999997 20.424999999999997 7 14.725 23.05 43.875 18.35 8 17.9 23.05 31.85 27.200000000000003 9 17.175 23.799999999999997 33.5 25.525 10-14 20.07 29.56 27.265 23.105 15-19 19.325 29.099999999999998 27.87 23.705000000000002 20-24 19.814999999999998 29.110000000000003 28.139999999999997 22.935 25-29 20.175 28.95 27.715 23.16 30-34 19.38596929846492 29.35646782339117 28.106405320266013 23.151157557877895 35-39 19.39081724517355 28.74362308692608 27.868360508152445 23.997199159747925 40-44 19.809904952476238 28.29414707353677 28.54927463731866 23.34667333666833 45-49 20.00900405182332 28.742934320444203 27.167225251363114 24.080836376369366 50-54 20.234105347406334 28.087639437746986 28.3577609924466 23.32049422240008 55-59 20.120060030015008 28.804402201100547 28.059029514757377 23.016508254127064 60-64 20.060030015007506 28.54927463731866 27.938969484742373 23.451725862931465 65-69 19.97098404122267 28.475661613887638 27.655210365701137 23.898143979188553 70-74 19.96897828479936 28.394876413489445 28.169718803162212 23.466426498548984 75-79 20.290217663247436 28.386289717287966 27.610708031023268 23.71278458844133 80-84 19.894947473736867 28.179089544772385 28.289144572286144 23.6368184092046 85-89 19.885937265496022 28.985942268247538 27.20996548101456 23.918154985241884 90-94 20.765382691345675 28.23411705852926 27.71885942971486 23.281640820410203 95-99 20.710355177588795 28.01400700350175 27.813906953476735 23.461730865432717 100-104 20.463185274109644 28.776510604241697 27.410964385754298 23.349339735894358 105-109 20.1891797207347 28.266853510835293 27.466092788148742 24.077873980281268 110-114 20.696905977771102 27.966356263142085 28.30679883849004 23.029938920596777 115-119 20.32829546591933 28.70583525172655 27.43469122209989 23.53117806025423 120-124 20.085 28.134999999999998 27.224999999999998 24.555 125-129 20.69 28.63 27.165 23.515 130-134 20.94 28.144999999999996 27.57 23.345 135-139 21.18 28.09 27.595 23.135 140-144 21.205 27.98 26.724999999999998 24.09 145-149 20.979999999999997 28.360000000000003 27.26 23.400000000000002 150-151 20.5 28.1125 27.5875 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 1.0 20 0.5 21 2.0 22 2.0 23 2.0 24 6.0 25 7.0 26 7.5 27 10.5 28 11.5 29 10.5 30 19.5 31 33.5 32 36.0 33 53.5 34 76.0 35 82.0 36 95.0 37 135.0 38 163.0 39 163.5 40 197.0 41 220.5 42 219.0 43 237.5 44 258.0 45 250.0 46 243.0 47 244.0 48 220.0 49 190.0 50 162.0 51 134.5 52 110.0 53 83.5 54 70.5 55 67.0 56 43.5 57 29.5 58 29.5 59 21.5 60 15.5 61 13.0 62 7.0 63 3.0 64 3.0 65 2.0 66 2.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.03 40-44 0.05 45-49 0.045 50-54 0.045 55-59 0.05 60-64 0.05 65-69 0.055 70-74 0.06999999999999999 75-79 0.075 80-84 0.05 85-89 0.055 90-94 0.05 95-99 0.05 100-104 0.04 105-109 0.095 110-114 0.13 115-119 0.09 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.6801007556675063 1.35 3 0.0 0.0 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 2.1375 0.0 0.0 0.0 0.0 106-107 2.4749999999999996 0.0 0.0 0.0 0.0 108-109 2.8499999999999996 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.5250000000000004 0.0 0.0 0.0 0.0 114-115 3.8375 0.0 0.0 0.0 0.0 116-117 4.199999999999999 0.0 0.0 0.0 0.0 118-119 4.65 0.0 0.0 0.0 0.0 120-121 5.137499999999999 0.0 0.0 0.0 0.0 122-123 5.55 0.0 0.0 0.0 0.0 124-125 5.925 0.0 0.0 0.0 0.0 126-127 6.4 0.0 0.0 0.0 0.0 128-129 6.9125 0.0 0.0 0.0 0.0 130-131 7.325 0.0 0.0 0.0 0.0 132-133 7.7 0.0 0.0 0.0 0.0 134-135 8.2375 0.0 0.0 0.0 0.0 136-137 8.8125 0.0 0.0 0.0 0.0 138-139 9.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCAAT 10 0.0060887975 150.61038 1 CTGGTCA 10 0.006836113 144.9625 3 >>END_MODULE SRR7172467 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172467_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.754 33.0 33.0 34.0 32.0 34.0 2 32.828 33.0 33.0 34.0 32.0 34.0 3 32.89275 34.0 33.0 34.0 32.0 34.0 4 32.7735 34.0 33.0 34.0 32.0 34.0 5 32.76425 34.0 33.0 34.0 32.0 34.0 6 36.993 38.0 38.0 38.0 37.0 38.0 7 37.0955 38.0 38.0 38.0 37.0 38.0 8 37.028 38.0 38.0 38.0 37.0 38.0 9 37.0775 38.0 38.0 38.0 37.0 38.0 10-14 36.995349999999995 38.0 38.0 38.0 36.8 38.0 15-19 37.01515 38.0 38.0 38.0 36.8 38.0 20-24 37.006099999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.006600000000006 38.0 38.0 38.0 37.0 38.0 30-34 36.98290000000001 38.0 38.0 38.0 36.8 38.0 35-39 36.827200000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.825649999999996 38.0 38.0 38.0 36.2 38.0 45-49 36.8609 38.0 38.0 38.0 36.4 38.0 50-54 36.77524999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.69105 38.0 38.0 38.0 35.8 38.0 60-64 36.65715 38.0 38.0 38.0 36.0 38.0 65-69 36.543099999999995 38.0 38.0 38.0 35.4 38.0 70-74 36.459849999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.423249999999996 38.0 38.0 38.0 34.8 38.0 80-84 36.36515 38.0 38.0 38.0 34.2 38.0 85-89 36.32685 38.0 38.0 38.0 34.2 38.0 90-94 36.1388 38.0 38.0 38.0 34.0 38.0 95-99 35.9985 38.0 38.0 38.0 33.4 38.0 100-104 35.9 38.0 38.0 38.0 33.4 38.0 105-109 35.59625 38.0 37.0 38.0 31.4 38.0 110-114 35.5176 38.0 37.2 38.0 31.4 38.0 115-119 35.16295 38.0 36.8 38.0 28.8 38.0 120-124 34.9923 38.0 36.4 38.0 28.4 38.0 125-129 34.5768 38.0 35.8 38.0 26.6 38.0 130-134 33.812599999999996 38.0 35.0 38.0 21.4 38.0 135-139 33.2691 38.0 33.0 38.0 18.6 38.0 140-144 32.5244 38.0 33.0 38.0 13.0 38.0 145-149 31.23095 38.0 32.0 38.0 6.2 38.0 150-151 26.143 34.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 9.0 4 2.0 5 4.0 6 0.0 7 2.0 8 3.0 9 2.0 10 5.0 11 2.0 12 2.0 13 4.0 14 1.0 15 2.0 16 4.0 17 5.0 18 12.0 19 8.0 20 10.0 21 8.0 22 15.0 23 16.0 24 20.0 25 15.0 26 21.0 27 37.0 28 40.0 29 40.0 30 49.0 31 72.0 32 82.0 33 96.0 34 166.0 35 264.0 36 614.0 37 2357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.199999999999996 21.25 14.274999999999999 29.275000000000002 2 25.650000000000002 26.875 32.300000000000004 15.174999999999999 3 20.375 28.7 30.575000000000003 20.349999999999998 4 23.55588897224306 36.159039759939986 22.755688922230558 17.5293823455864 5 24.781195298824706 34.658664666166544 22.780695173793447 17.779444861215303 6 19.525000000000002 37.225 23.825 19.425 7 19.775000000000002 19.55 41.375 19.3 8 22.225 24.725 27.425 25.624999999999996 9 21.55 25.374999999999996 30.125 22.95 10-14 23.375 28.58 26.58 21.465 15-19 22.95 28.199999999999996 27.894999999999996 20.955 20-24 23.294999999999998 27.96 28.025 20.72 25-29 23.419999999999998 28.32 27.839999999999996 20.419999999999998 30-34 22.35 28.775000000000002 27.994999999999997 20.880000000000003 35-39 23.064999999999998 27.775 28.299999999999997 20.86 40-44 23.445 28.02 28.03 20.505000000000003 45-49 23.075000000000003 27.779999999999998 28.294999999999998 20.849999999999998 50-54 23.150000000000002 27.83 28.63 20.39 55-59 23.135 28.215 27.639999999999997 21.01 60-64 23.474999999999998 27.985 28.035 20.505000000000003 65-69 23.395 27.73 28.595 20.28 70-74 23.575 27.74 28.389999999999997 20.294999999999998 75-79 23.395 27.93 27.534999999999997 21.14 80-84 23.915 27.92 27.650000000000002 20.515 85-89 22.965 27.815 28.060000000000002 21.16 90-94 24.07 28.189999999999998 27.49 20.25 95-99 23.66 28.470000000000002 27.715 20.155 100-104 24.13 27.965 27.18 20.724999999999998 105-109 23.695 28.785 27.250000000000004 20.27 110-114 24.15 28.555000000000003 27.005000000000003 20.29 115-119 24.33 28.599999999999998 27.455000000000002 19.615 120-124 24.5 28.285 27.195000000000004 20.02 125-129 24.88 27.735 27.439999999999998 19.945 130-134 25.1 27.67 27.55 19.68 135-139 24.985 27.944999999999997 27.794999999999998 19.275000000000002 140-144 24.975 28.605000000000004 26.939999999999998 19.48 145-149 25.685000000000002 28.23 26.900000000000002 19.185 150-151 25.650000000000002 27.962500000000002 27.8625 18.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 1.0 23 1.0 24 2.5 25 5.0 26 4.0 27 8.5 28 12.0 29 11.5 30 20.0 31 25.5 32 31.5 33 43.0 34 53.5 35 70.0 36 94.0 37 112.5 38 136.5 39 161.5 40 194.0 41 231.5 42 257.0 43 267.0 44 266.5 45 258.5 46 239.5 47 230.5 48 209.5 49 199.0 50 187.0 51 136.0 52 110.0 53 96.0 54 72.0 55 60.0 56 52.0 57 46.5 58 29.0 59 16.0 60 13.5 61 9.0 62 8.0 63 4.5 64 1.5 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5790533736153072 1.15 3 0.025176233635448138 0.075 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.3625 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.7374999999999998 0.0 0.0 0.0 0.0 104-105 2.075 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.7750000000000004 0.0 0.0 0.0 0.0 110-111 3.1375 0.0 0.0 0.0 0.0 112-113 3.4749999999999996 0.0 0.0 0.0 0.0 114-115 3.75 0.0 0.0 0.0 0.0 116-117 4.1 0.0 0.0 0.0 0.0 118-119 4.5375 0.0 0.0 0.0 0.0 120-121 5.0 0.0 0.0 0.0 0.0 122-123 5.387499999999999 0.0 0.0 0.0 0.0 124-125 5.7875 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.7875 0.0 0.0 0.0 0.0 130-131 7.225 0.0 0.0 0.0 0.0 132-133 7.625 0.0 0.0 0.0 0.0 134-135 8.1875 0.0 0.0 0.0 0.0 136-137 8.8 0.0 0.0 0.0 0.0 138-139 9.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873065 spots for SRR7172467.sra Written 873065 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra Read 873048 spots for SRR7172467.sra Written 873048 spots for SRR7172467.sra SRR ids: ['SRR7172467.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iooemdz2 SRR7172467.sra spots: 17460977 blocks: [[1, 873048], [873049, 1746096], [1746097, 2619144], [2619145, 3492192], [3492193, 4365240], [4365241, 5238288], [5238289, 6111336], [6111337, 6984384], [6984385, 7857432], [7857433, 8730480], [8730481, 9603528], [9603529, 10476576], [10476577, 11349624], [11349625, 12222672], [12222673, 13095720], [13095721, 13968768], [13968769, 14841816], [14841817, 15714864], [15714865, 16587912], [16587913, 17460977]] SRR7172467 file size 5895251 SRR7172467 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172467 SRR7172467_1.fastq SRR7172467_2.fastq Input file: SRR7172467_1.fastq Paired file: SRR7172467_2.fastq trimmed: SRR7172467-trimmed-pair1.fastq, SRR7172467-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:40:56 2025 >> started Mon Feb 10 10:41:14 2025 >> done (17.481s) 17460977 read pairs processed; of these: 22593 ( 0.13%) short read pairs filtered out after trimming by size control 79799 ( 0.46%) empty read pairs filtered out after trimming by size control 17358585 (99.41%) read pairs available; of these: 8980280 (51.73%) trimmed read pairs available after processing 8378305 (48.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 6 0.00% 21 9 0.00% 22 5 0.00% 23 13 0.00% 24 13 0.00% 25 6 0.00% 26 6 0.00% 27 8 0.00% 28 11 0.00% 29 13 0.00% 30 10 0.00% 31 15 0.00% 32 17 0.00% 33 17 0.00% 34 16 0.00% 35 7 0.00% 36 18 0.00% 37 19 0.00% 38 23 0.00% 39 27 0.00% 40 41 0.00% 41 41 0.00% 42 49 0.00% 43 52 0.00% 44 53 0.00% 45 48 0.00% 46 67 0.00% 47 93 0.00% 48 91 0.00% 49 124 0.00% 50 139 0.00% 51 148 0.00% 52 158 0.00% 53 183 0.00% 54 220 0.00% 55 224 0.00% 56 218 0.00% 57 292 0.00% 58 320 0.00% 59 398 0.00% 60 443 0.00% 61 495 0.00% 62 588 0.00% 63 668 0.00% 64 759 0.00% 65 815 0.00% 66 903 0.01% 67 1143 0.01% 68 1243 0.01% 69 1666 0.01% 70 1734 0.01% 71 1868 0.01% 72 2079 0.01% 73 2438 0.01% 74 2610 0.02% 75 2916 0.02% 76 3111 0.02% 77 3510 0.02% 78 3783 0.02% 79 4329 0.02% 80 4881 0.03% 81 5366 0.03% 82 6175 0.04% 83 7032 0.04% 84 8646 0.05% 85 9739 0.06% 86 10210 0.06% 87 10724 0.06% 88 11232 0.06% 89 11896 0.07% 90 12835 0.07% 91 13886 0.08% 92 14736 0.08% 93 16178 0.09% 94 16968 0.10% 95 18147 0.10% 96 18526 0.11% 97 19512 0.11% 98 19814 0.11% 99 20777 0.12% 100 22229 0.13% 101 22987 0.13% 102 25038 0.14% 103 25609 0.15% 104 27125 0.16% 105 28363 0.16% 106 29405 0.17% 107 30183 0.17% 108 30997 0.18% 109 32266 0.19% 110 33272 0.19% 111 34264 0.20% 112 35967 0.21% 113 38044 0.22% 114 39304 0.23% 115 41719 0.24% 116 42508 0.24% 117 43857 0.25% 118 45582 0.26% 119 46024 0.27% 120 47482 0.27% 121 48400 0.28% 122 50819 0.29% 123 53048 0.31% 124 55387 0.32% 125 57639 0.33% 126 59696 0.34% 127 61541 0.35% 128 62859 0.36% 129 65101 0.38% 130 67266 0.39% 131 69426 0.40% 132 71540 0.41% 133 75788 0.44% 134 78764 0.45% 135 82402 0.47% 136 86740 0.50% 137 91988 0.53% 138 97393 0.56% 139 103191 0.59% 140 108577 0.63% 141 116927 0.67% 142 126741 0.73% 143 140497 0.81% 144 160247 0.92% 145 189983 1.09% 146 229630 1.32% 147 304901 1.76% 148 445819 2.57% 149 854123 4.92% 150 3944010 22.72% 151 8378305 48.27% 17358585 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=11 prefix-density=0.43 prefix-fanout=2.7 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=35.84 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=21 prefix-density=0.50 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=19 fanout-score=18.41 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=6.5 sequence=AGCAATGGCAGCA SRR7172467 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:42:18 Started mapping on | Feb 10 10:42:23 Finished on | Feb 10 10:44:48 Mapping speed, Million of reads per hour | 430.97 Number of input reads | 17358585 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 14503116 Uniquely mapped reads % | 83.55% Average mapped length | 288.36 Number of splices: Total | 13702539 Number of splices: Annotated (sjdb) | 13345746 Number of splices: GT/AG | 13432592 Number of splices: GC/AG | 206272 Number of splices: AT/AC | 9156 Number of splices: Non-canonical | 54519 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429700 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 46817 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.61% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2440797 2440797 2440797 N_multimapping 429700 429700 429700 N_noFeature 633049 14231188 756307 N_ambiguous 331572 2630 180964 UnstrandedReadsAssigned:13538495 PositiveStrandReadsAssigned:269298 NegativeStrandReadsAssigned:13565845 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=144 echo kmer=139 SRR7172467 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172467-trimmed-pair1.fastq SRR7172467-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,358,585 reads, 14,920,029 reads pseudoaligned [quant] estimated average fragment length: 230.105 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52401 SRR7172467.ke.tsv 34699 SRR7172467.se.tsv 87100 total ==> SRR7172467.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.9 1284 44.9026 Potri.005G024800.1.v4.1 1035 805.895 149 11.5664 Potri.004G059700.1.v4.1 961 731.967 23 1.96575 Potri.007G009000.2.v4.1 1416 1186.9 0 0 Potri.003G141000.2.v4.1 2943 2713.9 727.158 16.762 Potri.016G087400.1.v4.1 270 90.6704 833.945 575.392 Potri.015G069301.1.v4.1 564 340.733 0 0 Potri.010G195200.1.v4.1 1773 1543.9 89.7629 3.63723 Potri.012G127500.1.v4.1 977 747.937 230 19.2378 ==> SRR7172467.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 955 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 135 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 100 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7172467 completed mapping pipeline successfully