Starting /dee2/code/volunteer_pipeline.sh SRR7172468 current disk space = 3059226157056 free memory = 1404395772 SRR7172468 SRAfilesize dd7962647bc2ab9f705bf42834ca7ff4 SRR7172468.sra SRR7172468.sra file validated SRR7172468 is paired end SRR7172468 is conventional basespace SRR7172468 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172468_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96025 34.0 33.0 34.0 33.0 34.0 2 33.42225 34.0 34.0 34.0 33.0 34.0 3 33.485 34.0 34.0 34.0 33.0 34.0 4 33.51925 34.0 34.0 34.0 33.0 34.0 5 33.41225 34.0 34.0 34.0 33.0 34.0 6 37.17025 38.0 38.0 38.0 36.0 38.0 7 37.424 38.0 38.0 38.0 37.0 38.0 8 37.562 38.0 38.0 38.0 38.0 38.0 9 37.59775 38.0 38.0 38.0 38.0 38.0 10-14 37.536750000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.5212 38.0 38.0 38.0 38.0 38.0 20-24 37.55505 38.0 38.0 38.0 38.0 38.0 25-29 37.539 38.0 38.0 38.0 38.0 38.0 30-34 37.455499999999994 38.0 38.0 38.0 37.8 38.0 35-39 37.40915 38.0 38.0 38.0 37.2 38.0 40-44 37.328450000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.292300000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.23685 38.0 38.0 38.0 36.4 38.0 55-59 37.10510000000001 38.0 38.0 38.0 36.0 38.0 60-64 37.0985 38.0 38.0 38.0 36.0 38.0 65-69 37.12595 38.0 38.0 38.0 36.0 38.0 70-74 36.971199999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.88635000000001 38.0 38.0 38.0 35.4 38.0 80-84 36.78595 38.0 38.0 38.0 35.0 38.0 85-89 36.70715 38.0 38.0 38.0 34.8 38.0 90-94 36.571299999999994 38.0 38.0 38.0 34.2 38.0 95-99 36.50035 38.0 38.0 38.0 34.0 38.0 100-104 36.201499999999996 38.0 37.8 38.0 33.6 38.0 105-109 36.1418 38.0 37.0 38.0 33.2 38.0 110-114 35.8033 38.0 37.0 38.0 31.8 38.0 115-119 35.7588 38.0 36.8 38.0 31.6 38.0 120-124 35.5914 38.0 36.4 38.0 30.6 38.0 125-129 35.25824999999999 38.0 36.0 38.0 29.2 38.0 130-134 34.671949999999995 38.0 35.2 38.0 27.0 38.0 135-139 34.376599999999996 38.0 35.0 38.0 25.6 38.0 140-144 33.92445 38.0 34.8 38.0 22.8 38.0 145-149 33.17925 38.0 33.2 38.0 18.6 38.0 150-151 28.776000000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 2.0 17 2.0 18 2.0 19 4.0 20 3.0 21 7.0 22 10.0 23 3.0 24 16.0 25 15.0 26 18.0 27 14.0 28 37.0 29 41.0 30 50.0 31 66.0 32 72.0 33 87.0 34 174.0 35 253.0 36 688.0 37 2433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.201625190452006 15.286947689182325 9.878110716099544 37.633316404266125 2 20.9 20.275000000000002 37.075 21.75 3 19.45 25.3 26.474999999999998 28.775000000000002 4 21.475 34.599999999999994 22.175 21.75 5 20.390781563126254 37.5751503006012 23.822645290581164 18.211422845691384 6 18.375 35.8 26.25 19.575 7 14.325 22.5 44.675 18.5 8 17.299999999999997 22.025 32.1 28.575 9 17.974999999999998 23.05 32.7 26.275 10-14 19.805 30.115 25.785000000000004 24.295 15-19 20.01 27.994999999999997 27.715 24.279999999999998 20-24 20.23 28.689999999999998 27.134999999999998 23.945 25-29 20.169999999999998 28.415000000000003 27.939999999999998 23.474999999999998 30-34 19.950000000000003 29.03 27.665 23.355 35-39 19.91497874468617 28.527131782945737 27.89697424356089 23.6609152288072 40-44 20.204040808161633 28.235647129425885 27.545509101820365 24.014802960592117 45-49 20.29507376844211 28.49212303075769 27.536884221055264 23.675918979744935 50-54 19.72993248312078 28.772193048262068 27.551887971993 23.945986496624155 55-59 20.10505252626313 28.884442221110557 27.288644322161083 23.721860930465233 60-64 20.006003301816 28.670768922907598 27.340037020361198 23.983190754915203 65-69 20.080040020010003 29.084542271135565 28.114057028514257 22.72136068034017 70-74 19.819864898674005 28.231173380035024 28.15611708781586 23.792844633475106 75-79 20.252151290774464 29.067440464278565 27.46147688613168 23.21893135881529 80-84 20.16407383322495 28.342754239407736 27.747486368865992 23.745685558501325 85-89 20.134060327147214 28.60287129208144 27.692461607723473 23.57060677304787 90-94 20.528211284513805 27.450980392156865 28.416366546618647 23.604441776710683 95-99 20.543217286914768 27.906162464985997 27.871148459383754 23.679471788715485 100-104 20.678424691852893 28.244313057420584 27.56288205230985 23.514380198416678 105-109 20.341187653209264 28.40562309270099 27.550152583921157 23.703036670168594 110-114 20.34271971139393 29.151217556869426 27.182082372983263 23.32398035875338 115-119 21.037622573544127 27.931759055433258 27.22133279967981 23.809285571342805 120-124 20.74 28.465 27.41 23.385 125-129 20.595 28.144999999999996 27.625 23.635 130-134 20.62622505905413 28.97924310197517 27.07443333165804 23.32009850731266 135-139 21.093986098519192 28.46277828145462 27.13810818978543 23.30512743024076 140-144 21.35275858616201 28.456994092320016 26.940022028637227 23.250225292880742 145-149 20.555 29.175 27.045 23.225 150-151 20.7625 28.525 27.425 23.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 4.0 24 4.0 25 2.0 26 4.5 27 9.0 28 13.0 29 19.0 30 19.5 31 25.5 32 39.0 33 53.5 34 63.5 35 75.0 36 101.5 37 127.0 38 133.5 39 158.0 40 190.5 41 216.0 42 237.0 43 249.0 44 256.0 45 255.0 46 245.5 47 235.0 48 216.5 49 173.5 50 155.0 51 153.0 52 130.0 53 95.0 54 73.0 55 63.0 56 55.5 57 46.0 58 30.0 59 22.0 60 17.0 61 9.0 62 5.0 63 3.0 64 3.0 65 3.0 66 1.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.02 45-49 0.025 50-54 0.025 55-59 0.05 60-64 0.055 65-69 0.05 70-74 0.075 75-79 0.06 80-84 0.045 85-89 0.045 90-94 0.04 95-99 0.04 100-104 0.21 105-109 0.055 110-114 0.21 115-119 0.06 120-124 0.0 125-129 0.0 130-134 0.515 135-139 0.73 140-144 0.13 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 1.925 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.0 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.762499999999999 0.0 0.0 0.0 0.0 132-133 5.2375 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 5.862500000000001 0.0 0.0 0.0 0.0 138-139 6.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.005605469 29.339241 130-134 >>END_MODULE SRR7172468 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172468_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58075 33.0 33.0 34.0 32.0 34.0 2 32.74125 34.0 33.0 34.0 32.0 34.0 3 32.7305 34.0 33.0 34.0 32.0 34.0 4 32.63875 34.0 33.0 34.0 32.0 34.0 5 32.67925 34.0 33.0 34.0 32.0 34.0 6 36.71075 38.0 38.0 38.0 36.0 38.0 7 36.84225 38.0 38.0 38.0 36.0 38.0 8 36.72875 38.0 38.0 38.0 36.0 38.0 9 36.8075 38.0 38.0 38.0 36.0 38.0 10-14 36.81155 38.0 38.0 38.0 36.0 38.0 15-19 36.79795 38.0 38.0 38.0 36.4 38.0 20-24 36.85475 38.0 38.0 38.0 36.4 38.0 25-29 36.851549999999996 38.0 38.0 38.0 36.8 38.0 30-34 36.802949999999996 38.0 38.0 38.0 36.4 38.0 35-39 36.7504 38.0 38.0 38.0 36.0 38.0 40-44 36.700450000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.745050000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.6862 38.0 38.0 38.0 36.0 38.0 55-59 36.640049999999995 38.0 38.0 38.0 35.8 38.0 60-64 36.5998 38.0 38.0 38.0 35.8 38.0 65-69 36.485350000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.39865 38.0 38.0 38.0 34.8 38.0 75-79 36.356049999999996 38.0 38.0 38.0 34.8 38.0 80-84 36.257 38.0 38.0 38.0 34.4 38.0 85-89 36.12075 38.0 38.0 38.0 34.0 38.0 90-94 35.967150000000004 38.0 38.0 38.0 33.4 38.0 95-99 35.83185 38.0 38.0 38.0 33.0 38.0 100-104 35.7718 38.0 37.8 38.0 32.4 38.0 105-109 35.6388 38.0 37.8 38.0 31.6 38.0 110-114 35.32865 38.0 37.0 38.0 30.0 38.0 115-119 35.111749999999994 38.0 37.0 38.0 28.4 38.0 120-124 34.835 38.0 36.4 38.0 27.6 38.0 125-129 34.544549999999994 38.0 36.0 38.0 25.8 38.0 130-134 34.183350000000004 38.0 35.2 38.0 23.4 38.0 135-139 33.5782 38.0 33.8 38.0 21.0 38.0 140-144 32.93115 38.0 33.2 38.0 13.6 38.0 145-149 31.9598 38.0 32.8 38.0 8.6 38.0 150-151 27.286 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 7.0 4 2.0 5 1.0 6 0.0 7 2.0 8 2.0 9 1.0 10 2.0 11 5.0 12 1.0 13 2.0 14 3.0 15 3.0 16 2.0 17 8.0 18 10.0 19 10.0 20 9.0 21 11.0 22 14.0 23 13.0 24 20.0 25 30.0 26 28.0 27 33.0 28 38.0 29 38.0 30 45.0 31 54.0 32 76.0 33 101.0 34 139.0 35 260.0 36 540.0 37 2464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.71313941825476 20.035105315947842 13.164493480441324 29.087261785356066 2 25.106596438424884 26.686731878605467 33.48382242287434 14.72284926009531 3 19.523212045169387 28.707653701380174 31.14178168130489 20.627352572145547 4 22.464859437751002 37.24899598393574 22.339357429718877 17.946787148594378 5 23.293172690763054 38.07730923694779 22.590361445783135 16.039156626506024 6 19.07035175879397 38.14070351758794 24.77386934673367 18.015075376884422 7 18.090452261306535 18.241206030150753 42.437185929648244 21.231155778894472 8 21.030150753768844 24.547738693467338 28.04020100502513 26.38190954773869 9 21.55778894472362 25.628140703517587 29.396984924623116 23.417085427135678 10-14 22.979899497487438 28.95979899497487 26.33668341708543 21.723618090452263 15-19 23.170854271356784 27.7286432160804 28.326633165829147 20.77386934673367 20-24 22.089342244108337 28.16943872167228 28.531229586452945 21.209989447766446 25-29 22.049736247174074 28.58075860336599 28.06832454157247 21.301180607887467 30-34 22.56881655615833 28.25999598151497 28.541289933694998 20.629897528631705 35-39 22.592313489073096 27.5709620698317 28.927405174579253 20.90931926651595 40-44 23.015075376884422 28.060301507537687 28.296482412060303 20.628140703517587 45-49 22.44221105527638 27.964824120603016 28.4321608040201 21.160804020100503 50-54 22.688442211055275 28.05527638190955 28.246231155778894 21.01005025125628 55-59 22.58064516129032 27.891669178976986 28.509697517837402 21.017988141895287 60-64 22.78048535396674 27.412952821182735 28.759483494950512 21.047078329900014 65-69 22.909547738693465 27.21608040201005 28.55276381909548 21.321608040201003 70-74 22.889447236180903 28.226130653266328 27.949748743718594 20.934673366834172 75-79 22.71242651123059 27.606652932013464 28.526204713330987 21.154715843424952 80-84 22.94472361809045 26.92462311557789 28.512562814070353 21.618090452261306 85-89 23.100502512562816 27.366834170854272 28.216080402010054 21.316582914572866 90-94 23.035938678059814 27.93164111585826 27.881377230459915 21.151042975622016 95-99 22.579024071561385 28.41348811498065 27.905924920850296 21.10156289260767 100-104 23.326633165829147 27.341708542713565 28.25628140703518 21.075376884422113 105-109 23.251256281407034 27.643216080402013 28.442211055276385 20.66331658291457 110-114 23.535323083107226 27.756004421666162 28.39413124309115 20.314541252135466 115-119 23.64824120603015 26.979899497487438 28.91457286432161 20.457286432160803 120-124 23.7035175879397 27.91959798994975 27.869346733668344 20.507537688442213 125-129 23.633165829145728 28.12060301507538 27.653266331658294 20.592964824120603 130-134 24.192495102225347 27.357211031295524 27.85452353443512 20.595770332044005 135-139 24.16737830913749 28.040387803285277 27.502888431205104 20.28934545637213 140-144 24.20603015075377 27.889447236180903 27.66331658291457 20.241206030150753 145-149 24.184550434738906 28.456551238880234 27.38603809619541 19.972860230185454 150-151 24.651338107802488 28.18193240356829 27.42806885287096 19.73866063575826 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 12.0 1 7.5 2 2.0 3 1.5 4 1.0 5 0.0 6 0.5 7 0.5 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.5 20 3.5 21 3.5 22 3.0 23 2.5 24 3.5 25 4.0 26 4.5 27 7.5 28 14.0 29 17.5 30 19.5 31 25.0 32 37.0 33 48.0 34 59.5 35 73.5 36 88.5 37 102.0 38 129.0 39 171.5 40 213.5 41 221.0 42 240.0 43 255.5 44 254.0 45 271.0 46 255.5 47 226.0 48 209.0 49 200.0 50 180.0 51 144.5 52 111.5 53 91.5 54 74.5 55 62.5 56 46.0 57 23.0 58 16.5 59 16.5 60 10.5 61 7.5 62 9.0 63 10.0 64 5.0 65 1.0 66 0.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.325 3 0.375 4 0.4 5 0.4 6 0.5 7 0.5 8 0.5 9 0.5 10-14 0.5 15-19 0.5 20-24 0.49500000000000005 25-29 0.475 30-34 0.45999999999999996 35-39 0.475 40-44 0.5 45-49 0.5 50-54 0.5 55-59 0.49 60-64 0.485 65-69 0.5 70-74 0.5 75-79 0.49500000000000005 80-84 0.5 85-89 0.5 90-94 0.525 95-99 0.505 100-104 0.5 105-109 0.5 110-114 0.49 115-119 0.5 120-124 0.5 125-129 0.5 130-134 0.46499999999999997 135-139 0.46499999999999997 140-144 0.5 145-149 0.515 150-151 0.5125000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39378630967416 98.375 2 0.45466026774437995 0.8999999999999999 3 0.07577671129072998 0.22499999999999998 4 0.050517807527153326 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025258903763576663 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.275 0.0 0.0 0.0 0.0 124-125 3.6624999999999996 0.0 0.0 0.0 0.0 126-127 3.975 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.7125 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 5.862500000000001 0.0 0.0 0.0 0.0 138-139 6.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra Read 809191 spots for SRR7172468.sra Written 809191 spots for SRR7172468.sra Read 809180 spots for SRR7172468.sra Written 809180 spots for SRR7172468.sra SRR ids: ['SRR7172468.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zi2q5qt5 SRR7172468.sra spots: 16183611 blocks: [[1, 809180], [809181, 1618360], [1618361, 2427540], [2427541, 3236720], [3236721, 4045900], [4045901, 4855080], [4855081, 5664260], [5664261, 6473440], [6473441, 7282620], [7282621, 8091800], [8091801, 8900980], [8900981, 9710160], [9710161, 10519340], [10519341, 11328520], [11328521, 12137700], [12137701, 12946880], [12946881, 13756060], [13756061, 14565240], [14565241, 15374420], [15374421, 16183611]] SRR7172468 file size 5462394 SRR7172468 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172468 SRR7172468_1.fastq SRR7172468_2.fastq Input file: SRR7172468_1.fastq Paired file: SRR7172468_2.fastq trimmed: SRR7172468-trimmed-pair1.fastq, SRR7172468-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:37:41 2025 >> started Mon Feb 10 10:37:59 2025 >> done (17.513s) 16183611 read pairs processed; of these: 25593 ( 0.16%) short read pairs filtered out after trimming by size control 83264 ( 0.51%) empty read pairs filtered out after trimming by size control 16074754 (99.33%) read pairs available; of these: 7949417 (49.45%) trimmed read pairs available after processing 8125337 (50.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 3 0.00% 21 12 0.00% 22 4 0.00% 23 11 0.00% 24 9 0.00% 25 9 0.00% 26 11 0.00% 27 14 0.00% 28 16 0.00% 29 16 0.00% 30 11 0.00% 31 8 0.00% 32 10 0.00% 33 18 0.00% 34 22 0.00% 35 21 0.00% 36 25 0.00% 37 53 0.00% 38 15 0.00% 39 45 0.00% 40 32 0.00% 41 32 0.00% 42 36 0.00% 43 45 0.00% 44 61 0.00% 45 140 0.00% 46 107 0.00% 47 102 0.00% 48 91 0.00% 49 82 0.00% 50 95 0.00% 51 124 0.00% 52 106 0.00% 53 124 0.00% 54 170 0.00% 55 170 0.00% 56 179 0.00% 57 214 0.00% 58 219 0.00% 59 261 0.00% 60 301 0.00% 61 375 0.00% 62 382 0.00% 63 462 0.00% 64 491 0.00% 65 595 0.00% 66 635 0.00% 67 731 0.00% 68 824 0.01% 69 1101 0.01% 70 1213 0.01% 71 1249 0.01% 72 1379 0.01% 73 1491 0.01% 74 1610 0.01% 75 1778 0.01% 76 2082 0.01% 77 2270 0.01% 78 2387 0.01% 79 2838 0.02% 80 3031 0.02% 81 3503 0.02% 82 3781 0.02% 83 4424 0.03% 84 5698 0.04% 85 6452 0.04% 86 6833 0.04% 87 7298 0.05% 88 7527 0.05% 89 8072 0.05% 90 8823 0.05% 91 9477 0.06% 92 10002 0.06% 93 11357 0.07% 94 11780 0.07% 95 12068 0.08% 96 12372 0.08% 97 12929 0.08% 98 13460 0.08% 99 13895 0.09% 100 15089 0.09% 101 15790 0.10% 102 16632 0.10% 103 17810 0.11% 104 18377 0.11% 105 19399 0.12% 106 20241 0.13% 107 21014 0.13% 108 21709 0.14% 109 22416 0.14% 110 23566 0.15% 111 24201 0.15% 112 25706 0.16% 113 27054 0.17% 114 28101 0.17% 115 29273 0.18% 116 30387 0.19% 117 31080 0.19% 118 32183 0.20% 119 32945 0.20% 120 34611 0.22% 121 35548 0.22% 122 37635 0.23% 123 38925 0.24% 124 40929 0.25% 125 41952 0.26% 126 43915 0.27% 127 45709 0.28% 128 46921 0.29% 129 48999 0.30% 130 51391 0.32% 131 52965 0.33% 132 55753 0.35% 133 58937 0.37% 134 61557 0.38% 135 65185 0.41% 136 69011 0.43% 137 73552 0.46% 138 78393 0.49% 139 83421 0.52% 140 88782 0.55% 141 96425 0.60% 142 107149 0.67% 143 119587 0.74% 144 137171 0.85% 145 163592 1.02% 146 200216 1.25% 147 270269 1.68% 148 408456 2.54% 149 818663 5.09% 150 3801113 23.65% 151 8125337 50.55% 16074754 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.41 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=532.39 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=19.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=17 prefix-density=0.50 prefix-fanout=2.4 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=16.16 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=7.0 sequence=CAGAGGAAAGGGTATGGTGGACTCTCTTTTCCAAGCCCCCCAGGGAACTGGAACTCACAACCCCGTTTTGA SRR7172468 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:39:02 Started mapping on | Feb 10 10:39:02 Finished on | Feb 10 10:41:02 Mapping speed, Million of reads per hour | 482.24 Number of input reads | 16074754 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14975573 Uniquely mapped reads % | 93.16% Average mapped length | 292.96 Number of splices: Total | 13957806 Number of splices: Annotated (sjdb) | 13642356 Number of splices: GT/AG | 13682053 Number of splices: GC/AG | 217797 Number of splices: AT/AC | 8122 Number of splices: Non-canonical | 49834 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431867 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 94209 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 685993 685993 685993 N_multimapping 431867 431867 431867 N_noFeature 656320 14703080 794373 N_ambiguous 241267 1453 105771 UnstrandedReadsAssigned:14077986 PositiveStrandReadsAssigned:271040 NegativeStrandReadsAssigned:14075429 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172468 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172468-trimmed-pair1.fastq SRR7172468-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,074,754 reads, 14,057,206 reads pseudoaligned [quant] estimated average fragment length: 252.459 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7172468.ke.tsv 34699 SRR7172468.se.tsv 87100 total ==> SRR7172468.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.54 682 26.2986 Potri.005G024800.1.v4.1 1035 783.541 126 10.9542 Potri.004G059700.1.v4.1 961 709.73 24 2.30351 Potri.007G009000.2.v4.1 1416 1164.54 0 0 Potri.003G141000.2.v4.1 2943 2691.54 694.34 17.5729 Potri.016G087400.1.v4.1 270 82.0405 589 489.056 Potri.015G069301.1.v4.1 564 323.03 0 0 Potri.010G195200.1.v4.1 1773 1521.54 48 2.14896 Potri.012G127500.1.v4.1 977 725.658 511 47.969 ==> SRR7172468.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1355 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 264 Potri.001G212900.v4.1 84 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7172468 completed mapping pipeline successfully