Starting /dee2/code/volunteer_pipeline.sh SRR7172469 current disk space = 3059119673344 free memory = 1573836352 SRR7172469 SRAfilesize 9a1f5a789595671c94ea30ff20c8cd62 SRR7172469.sra SRR7172469.sra file validated SRR7172469 is paired end SRR7172469 is conventional basespace SRR7172469 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172469_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42425 34.0 33.0 34.0 32.0 34.0 2 33.27075 34.0 33.0 34.0 32.0 34.0 3 33.37475 34.0 33.0 34.0 33.0 34.0 4 33.41725 34.0 33.0 34.0 33.0 34.0 5 33.209 34.0 33.0 34.0 33.0 34.0 6 37.09925 38.0 37.0 38.0 36.0 38.0 7 37.48925 38.0 38.0 38.0 37.0 38.0 8 37.5615 38.0 38.0 38.0 37.0 38.0 9 37.503 38.0 38.0 38.0 38.0 38.0 10-14 37.4396 38.0 38.0 38.0 37.0 38.0 15-19 37.2559 38.0 38.0 38.0 36.8 38.0 20-24 37.15939999999999 38.0 38.0 38.0 36.4 38.0 25-29 37.333749999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.24385 38.0 38.0 38.0 36.8 38.0 35-39 37.07275 38.0 38.0 38.0 36.2 38.0 40-44 37.20885 38.0 38.0 38.0 36.8 38.0 45-49 36.734750000000005 38.0 38.0 38.0 34.8 38.0 50-54 37.08964999999999 38.0 38.0 38.0 36.2 38.0 55-59 37.1256 38.0 38.0 38.0 36.0 38.0 60-64 37.05030000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.9487 38.0 38.0 38.0 35.6 38.0 70-74 36.6563 38.0 38.0 38.0 34.6 38.0 75-79 36.666199999999996 38.0 37.8 38.0 34.2 38.0 80-84 36.3486 38.0 37.4 38.0 33.4 38.0 85-89 36.30075 38.0 37.6 38.0 32.8 38.0 90-94 35.88605 38.0 36.8 38.0 31.0 38.0 95-99 36.483799999999995 38.0 37.8 38.0 34.0 38.0 100-104 36.318200000000004 38.0 37.6 38.0 33.8 38.0 105-109 35.880700000000004 38.0 36.8 38.0 31.6 38.0 110-114 35.825500000000005 38.0 37.0 38.0 31.0 38.0 115-119 35.6645 38.0 36.6 38.0 30.6 38.0 120-124 35.483450000000005 38.0 35.8 38.0 30.2 38.0 125-129 35.06325 38.0 35.2 38.0 27.8 38.0 130-134 34.795899999999996 38.0 35.0 38.0 27.4 38.0 135-139 34.129999999999995 38.0 34.4 38.0 23.6 38.0 140-144 33.309799999999996 38.0 33.8 38.0 19.0 38.0 145-149 31.82095 36.8 32.0 38.0 11.6 38.0 150-151 28.818125 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 1.0 16 2.0 17 0.0 18 1.0 19 0.0 20 2.0 21 5.0 22 5.0 23 7.0 24 11.0 25 18.0 26 23.0 27 23.0 28 36.0 29 36.0 30 66.0 31 76.0 32 106.0 33 139.0 34 172.0 35 391.0 36 859.0 37 2017.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.25773195876289 13.350515463917526 10.360824742268042 41.03092783505154 2 20.75 20.95 36.55 21.75 3 18.475 25.95 25.674999999999997 29.9 4 22.375 32.9 22.2 22.525000000000002 5 22.1 36.525 23.7 17.675 6 17.45 35.125 26.8 20.625 7 13.625000000000002 23.325000000000003 44.2 18.85 8 17.575 23.45 32.775 26.200000000000003 9 17.1 22.825 33.925 26.150000000000002 10-14 20.505000000000003 29.005 27.07 23.419999999999998 15-19 19.77 28.065 27.905 24.26 20-24 19.35 28.939999999999998 27.87 23.84 25-29 19.73 28.860000000000003 28.23 23.18 30-34 19.79 28.449999999999996 28.144999999999996 23.615 35-39 19.759999999999998 28.165000000000003 28.375 23.7 40-44 19.785 28.04 28.33 23.845 45-49 19.919999999999998 28.725 27.584999999999997 23.77 50-54 19.84 28.38 28.175 23.605 55-59 20.155 28.860000000000003 27.650000000000002 23.335 60-64 19.715 28.845 28.065 23.375 65-69 20.34 28.375 27.889999999999997 23.395 70-74 19.675 28.92 27.950000000000003 23.455000000000002 75-79 19.8 28.925 27.91 23.365 80-84 20.41 28.610000000000003 27.279999999999998 23.7 85-89 20.335 28.875 27.515 23.275000000000002 90-94 20.244999999999997 28.895 28.01 22.85 95-99 19.869999999999997 29.299999999999997 27.36 23.47 100-104 20.14 29.205 27.529999999999998 23.125 105-109 20.51 28.395 27.91 23.185 110-114 20.665 28.194999999999997 27.705000000000002 23.435 115-119 20.46 28.675 27.694999999999997 23.169999999999998 120-124 20.599999999999998 28.675 27.465 23.26 125-129 20.599999999999998 28.835 27.345000000000002 23.22 130-134 20.369999999999997 28.52 27.439999999999998 23.669999999999998 135-139 20.89 28.58 27.12 23.41 140-144 20.46 28.725 27.155 23.66 145-149 21.224999999999998 28.205000000000002 26.515 24.055 150-151 20.0875 28.6625 27.5125 23.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 2.5 21 3.0 22 1.5 23 4.0 24 6.0 25 5.0 26 5.5 27 8.0 28 15.5 29 19.5 30 22.5 31 30.0 32 32.5 33 41.5 34 62.0 35 85.5 36 103.5 37 125.0 38 139.0 39 168.0 40 198.5 41 221.0 42 261.5 43 273.5 44 260.0 45 249.5 46 250.0 47 228.5 48 208.0 49 191.0 50 167.5 51 144.5 52 107.5 53 84.0 54 65.0 55 49.5 56 47.5 57 39.0 58 22.0 59 15.0 60 12.0 61 6.0 62 4.0 63 2.5 64 1.5 65 2.5 66 2.0 67 2.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.20060180541624875 0.4 3 0.05015045135406219 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.4874999999999998 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.5 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.225 0.0 0.0 0.0 0.0 130-131 4.7625 0.0 0.0 0.0 0.0 132-133 5.225 0.0 0.0 0.0 0.0 134-135 5.675 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138-139 6.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACCCT 10 0.006832588 144.9875 145 TGGATTC 10 0.006832588 144.9875 3 >>END_MODULE SRR7172469 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172469_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92875 33.0 33.0 34.0 32.0 34.0 2 33.06275 34.0 33.0 34.0 32.0 34.0 3 33.13075 34.0 33.0 34.0 33.0 34.0 4 33.12075 34.0 33.0 34.0 33.0 34.0 5 33.10125 34.0 33.0 34.0 33.0 34.0 6 37.213 38.0 38.0 38.0 37.0 38.0 7 37.2505 38.0 38.0 38.0 37.0 38.0 8 37.2225 38.0 38.0 38.0 37.0 38.0 9 37.0705 38.0 38.0 38.0 37.0 38.0 10-14 37.077 38.0 38.0 38.0 36.8 38.0 15-19 37.23735 38.0 38.0 38.0 37.0 38.0 20-24 36.972750000000005 38.0 38.0 38.0 36.4 38.0 25-29 36.8606 38.0 38.0 38.0 36.2 38.0 30-34 37.03305 38.0 38.0 38.0 36.8 38.0 35-39 37.077999999999996 38.0 38.0 38.0 36.4 38.0 40-44 36.83625 38.0 38.0 38.0 35.6 38.0 45-49 36.866499999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.65335 38.0 38.0 38.0 34.6 38.0 55-59 36.943650000000005 38.0 38.0 38.0 36.2 38.0 60-64 36.92985 38.0 38.0 38.0 36.0 38.0 65-69 36.678149999999995 38.0 38.0 38.0 35.0 38.0 70-74 36.74875 38.0 38.0 38.0 35.8 38.0 75-79 36.82645 38.0 38.0 38.0 36.0 38.0 80-84 36.70005 38.0 38.0 38.0 35.0 38.0 85-89 36.17115 38.0 37.6 38.0 32.8 38.0 90-94 36.47525 38.0 38.0 38.0 34.6 38.0 95-99 36.49235 38.0 38.0 38.0 34.2 38.0 100-104 36.13615 38.0 37.6 38.0 32.6 38.0 105-109 36.09195 38.0 38.0 38.0 33.8 38.0 110-114 35.86704999999999 38.0 37.4 38.0 32.2 38.0 115-119 35.940999999999995 38.0 37.4 38.0 33.0 38.0 120-124 35.68795 38.0 37.0 38.0 31.8 38.0 125-129 35.49300000000001 38.0 36.6 38.0 31.2 38.0 130-134 34.6466 38.0 35.6 38.0 26.2 38.0 135-139 34.2774 38.0 35.0 38.0 23.6 38.0 140-144 34.213499999999996 38.0 35.0 38.0 23.8 38.0 145-149 33.6472 38.0 34.2 38.0 22.4 38.0 150-151 29.677500000000002 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 3.0 12 1.0 13 5.0 14 2.0 15 1.0 16 4.0 17 3.0 18 5.0 19 2.0 20 8.0 21 9.0 22 9.0 23 14.0 24 19.0 25 13.0 26 21.0 27 31.0 28 24.0 29 28.0 30 43.0 31 49.0 32 74.0 33 111.0 34 163.0 35 258.0 36 558.0 37 2530.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.175000000000004 18.7 14.85 29.275000000000002 2 25.874999999999996 25.5 32.725 15.9 3 20.95 28.025 29.825000000000003 21.2 4 22.35 37.05 23.075000000000003 17.525 5 23.225 37.625 22.3 16.85 6 19.0 38.9 23.9 18.2 7 19.15 18.2 42.975 19.675 8 20.625 23.95 29.925 25.5 9 22.325 23.05 30.599999999999998 24.025 10-14 23.21 28.744999999999997 26.565 21.48 15-19 22.27 28.375 28.544999999999998 20.810000000000002 20-24 22.735 28.294999999999998 28.225 20.745 25-29 22.400000000000002 28.849999999999998 28.194999999999997 20.555 30-34 22.075 28.63 28.465 20.830000000000002 35-39 22.24 28.785 28.189999999999998 20.785 40-44 22.939999999999998 28.425 28.43 20.205000000000002 45-49 22.63 28.37 28.075 20.925 50-54 22.505 28.405 28.275 20.815 55-59 22.735 27.905 28.134999999999998 21.224999999999998 60-64 23.294999999999998 27.615000000000002 27.99 21.099999999999998 65-69 23.28 27.985 28.1 20.635 70-74 22.67 27.994999999999997 28.54 20.794999999999998 75-79 22.95 28.655 28.29 20.105 80-84 23.21 27.565 28.565 20.66 85-89 23.36 28.544999999999998 27.985 20.11 90-94 23.455000000000002 28.17 28.189999999999998 20.185 95-99 23.44 28.155 28.315 20.09 100-104 23.82 27.900000000000002 28.07 20.21 105-109 23.419999999999998 28.51 27.834999999999997 20.235 110-114 23.235 28.12 28.065 20.580000000000002 115-119 23.415 28.43 27.51 20.645 120-124 23.93 28.21 27.634999999999998 20.225 125-129 23.474999999999998 27.889999999999997 28.27 20.365 130-134 24.42 27.21 28.199999999999996 20.169999999999998 135-139 24.48 28.16 27.445000000000004 19.915 140-144 24.86 28.33 27.169999999999998 19.64 145-149 25.05 28.804999999999996 26.76 19.384999999999998 150-151 25.124999999999996 28.299999999999997 27.037499999999998 19.537499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.5 14 1.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.5 22 2.0 23 3.5 24 5.5 25 4.5 26 6.5 27 8.5 28 7.5 29 15.5 30 21.5 31 24.0 32 33.0 33 44.0 34 56.5 35 73.5 36 92.5 37 116.5 38 151.0 39 178.0 40 198.5 41 229.5 42 266.0 43 293.5 44 283.5 45 263.5 46 255.0 47 238.5 48 208.5 49 176.0 50 158.0 51 127.5 52 106.0 53 90.0 54 60.5 55 48.5 56 43.0 57 29.5 58 18.5 59 14.0 60 10.0 61 8.0 62 7.0 63 6.5 64 4.0 65 1.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34409687184662 98.45 2 0.479313824419778 0.95 3 0.12613521695257315 0.375 4 0.025227043390514632 0.1 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.3375 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.9000000000000004 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.3125 0.0 0.0 0.0 0.0 134-135 5.725 0.0 0.0 0.0 0.0 136-137 6.262499999999999 0.0 0.0 0.0 0.0 138-139 6.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGAACT 10 0.006830828 145.0 9 AGTGTAA 10 0.006830828 145.0 7 AAGCCTT 10 0.006830828 145.0 5 >>END_MODULE Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038895 spots for SRR7172469.sra Written 1038895 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra Read 1038876 spots for SRR7172469.sra Written 1038876 spots for SRR7172469.sra SRR ids: ['SRR7172469.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dmtgclas SRR7172469.sra spots: 20777539 blocks: [[1, 1038876], [1038877, 2077752], [2077753, 3116628], [3116629, 4155504], [4155505, 5194380], [5194381, 6233256], [6233257, 7272132], [7272133, 8311008], [8311009, 9349884], [9349885, 10388760], [10388761, 11427636], [11427637, 12466512], [12466513, 13505388], [13505389, 14544264], [14544265, 15583140], [15583141, 16622016], [16622017, 17660892], [17660893, 18699768], [18699769, 19738644], [19738645, 20777539]] SRR7172469 file size 7019125 SRR7172469 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172469 SRR7172469_1.fastq SRR7172469_2.fastq Input file: SRR7172469_1.fastq Paired file: SRR7172469_2.fastq trimmed: SRR7172469-trimmed-pair1.fastq, SRR7172469-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:33:07 2025 >> started Mon Feb 10 11:33:29 2025 >> done (22.730s) 20777539 read pairs processed; of these: 12199 ( 0.06%) short read pairs filtered out after trimming by size control 7738 ( 0.04%) empty read pairs filtered out after trimming by size control 20757602 (99.90%) read pairs available; of these: 9887801 (47.63%) trimmed read pairs available after processing 10869801 (52.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 5 0.00% 20 8 0.00% 21 9 0.00% 22 11 0.00% 23 7 0.00% 24 6 0.00% 25 10 0.00% 26 8 0.00% 27 9 0.00% 28 11 0.00% 29 9 0.00% 30 8 0.00% 31 16 0.00% 32 13 0.00% 33 22 0.00% 34 11 0.00% 35 23 0.00% 36 18 0.00% 37 17 0.00% 38 18 0.00% 39 36 0.00% 40 15 0.00% 41 20 0.00% 42 28 0.00% 43 27 0.00% 44 31 0.00% 45 41 0.00% 46 45 0.00% 47 52 0.00% 48 62 0.00% 49 73 0.00% 50 76 0.00% 51 82 0.00% 52 94 0.00% 53 112 0.00% 54 121 0.00% 55 148 0.00% 56 126 0.00% 57 168 0.00% 58 186 0.00% 59 196 0.00% 60 250 0.00% 61 278 0.00% 62 350 0.00% 63 395 0.00% 64 416 0.00% 65 526 0.00% 66 555 0.00% 67 632 0.00% 68 835 0.00% 69 1234 0.01% 70 1192 0.01% 71 1033 0.00% 72 1144 0.01% 73 1352 0.01% 74 1461 0.01% 75 1678 0.01% 76 1843 0.01% 77 2020 0.01% 78 2283 0.01% 79 2650 0.01% 80 2904 0.01% 81 3313 0.02% 82 3721 0.02% 83 4260 0.02% 84 5065 0.02% 85 5914 0.03% 86 6487 0.03% 87 6914 0.03% 88 7768 0.04% 89 8323 0.04% 90 9010 0.04% 91 9646 0.05% 92 10347 0.05% 93 11461 0.06% 94 12167 0.06% 95 12931 0.06% 96 13715 0.07% 97 15145 0.07% 98 15654 0.08% 99 16753 0.08% 100 17657 0.09% 101 18713 0.09% 102 20059 0.10% 103 20988 0.10% 104 22081 0.11% 105 23345 0.11% 106 24818 0.12% 107 25948 0.13% 108 27173 0.13% 109 28662 0.14% 110 29927 0.14% 111 31480 0.15% 112 33212 0.16% 113 34760 0.17% 114 36893 0.18% 115 38766 0.19% 116 40132 0.19% 117 41957 0.20% 118 43421 0.21% 119 44879 0.22% 120 47154 0.23% 121 48927 0.24% 122 51212 0.25% 123 53868 0.26% 124 56289 0.27% 125 57268 0.28% 126 60959 0.29% 127 62528 0.30% 128 64852 0.31% 129 67468 0.33% 130 70709 0.34% 131 73257 0.35% 132 77134 0.37% 133 81218 0.39% 134 84815 0.41% 135 90182 0.43% 136 94766 0.46% 137 101046 0.49% 138 107649 0.52% 139 114887 0.55% 140 121492 0.59% 141 132150 0.64% 142 145512 0.70% 143 160687 0.77% 144 183198 0.88% 145 214616 1.03% 146 262561 1.26% 147 346561 1.67% 148 508986 2.45% 149 966145 4.65% 150 4569221 22.01% 151 10869801 52.37% 20757602 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=16 prefix-density=0.28 prefix-fanout=2.5 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=30.95 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=9.0 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGAT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=27 prefix-density=0.56 prefix-fanout=2.0 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=94.31 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.2 sequence=AAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7172469 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:34:13 Started mapping on | Feb 10 11:34:13 Finished on | Feb 10 11:36:29 Mapping speed, Million of reads per hour | 549.47 Number of input reads | 20757602 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19512684 Uniquely mapped reads % | 94.00% Average mapped length | 293.15 Number of splices: Total | 18330105 Number of splices: Annotated (sjdb) | 17837977 Number of splices: GT/AG | 17979237 Number of splices: GC/AG | 266541 Number of splices: AT/AC | 11804 Number of splices: Non-canonical | 72523 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 654940 % of reads mapped to multiple loci | 3.16% Number of reads mapped to too many loci | 48350 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.53% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 605510 605510 605510 N_multimapping 654940 654940 654940 N_noFeature 855942 19153863 1046698 N_ambiguous 338759 1673 169543 UnstrandedReadsAssigned:18317983 PositiveStrandReadsAssigned:357148 NegativeStrandReadsAssigned:18296443 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172469 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172469-trimmed-pair1.fastq SRR7172469-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,757,602 reads, 18,271,456 reads pseudoaligned [quant] estimated average fragment length: 249.377 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR7172469.ke.tsv 34699 SRR7172469.se.tsv 87100 total ==> SRR7172469.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.62 1718 51.7955 Potri.005G024800.1.v4.1 1035 786.623 354 24.0097 Potri.004G059700.1.v4.1 961 712.789 4 0.299398 Potri.007G009000.2.v4.1 1416 1167.62 0 0 Potri.003G141000.2.v4.1 2943 2694.62 874.577 17.3161 Potri.016G087400.1.v4.1 270 84.6035 1357 855.739 Potri.015G069301.1.v4.1 564 326.681 0 0 Potri.010G195200.1.v4.1 1773 1524.62 647.922 22.6731 Potri.012G127500.1.v4.1 977 728.726 166 12.1533 ==> SRR7172469.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1223 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 307 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 469 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7172469 completed mapping pipeline successfully