Starting /dee2/code/volunteer_pipeline.sh SRR7172470 current disk space = 3059120295936 free memory = 1570048860 SRR7172470 SRAfilesize fdb8a9860e935171af7634110d4ad9bb SRR7172470.sra SRR7172470.sra file validated SRR7172470 is paired end SRR7172470 is conventional basespace SRR7172470 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172470_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.48375 34.0 33.0 34.0 32.0 34.0 2 33.30275 34.0 33.0 34.0 33.0 34.0 3 33.36425 34.0 34.0 34.0 33.0 34.0 4 33.43225 34.0 34.0 34.0 33.0 34.0 5 33.4235 34.0 34.0 34.0 33.0 34.0 6 37.10225 38.0 37.0 38.0 36.0 38.0 7 37.45175 38.0 38.0 38.0 37.0 38.0 8 37.49625 38.0 38.0 38.0 37.0 38.0 9 37.46825 38.0 38.0 38.0 37.0 38.0 10-14 37.462900000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.4536 38.0 38.0 38.0 37.4 38.0 20-24 37.43300000000001 38.0 38.0 38.0 37.4 38.0 25-29 37.38945 38.0 38.0 38.0 37.0 38.0 30-34 37.355599999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.289750000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.040400000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.9402 38.0 38.0 38.0 35.8 38.0 50-54 36.7471 38.0 38.0 38.0 35.0 38.0 55-59 36.7805 38.0 38.0 38.0 35.0 38.0 60-64 36.71195 38.0 38.0 38.0 35.0 38.0 65-69 36.5705 38.0 38.0 38.0 34.2 38.0 70-74 36.452799999999996 38.0 38.0 38.0 34.0 38.0 75-79 36.33395 38.0 38.0 38.0 34.0 38.0 80-84 36.268499999999996 38.0 37.8 38.0 33.6 38.0 85-89 36.1549 38.0 37.2 38.0 33.0 38.0 90-94 35.92855 38.0 37.0 38.0 32.4 38.0 95-99 35.68945 38.0 37.0 38.0 30.8 38.0 100-104 35.407799999999995 38.0 36.0 38.0 29.0 38.0 105-109 35.39325 38.0 36.2 38.0 29.4 38.0 110-114 35.06400000000001 38.0 36.0 38.0 28.0 38.0 115-119 34.78959999999999 38.0 35.4 38.0 26.8 38.0 120-124 34.46084999999999 38.0 35.0 38.0 26.0 38.0 125-129 34.1564 38.0 34.6 38.0 24.0 38.0 130-134 33.57405 38.0 34.2 38.0 19.4 38.0 135-139 32.9489 38.0 33.8 38.0 14.8 38.0 140-144 32.3903 38.0 32.4 38.0 14.0 38.0 145-149 31.330899999999996 37.6 31.0 38.0 8.6 38.0 150-151 25.962375 32.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 1.0 10 2.0 11 3.0 12 3.0 13 4.0 14 3.0 15 1.0 16 3.0 17 3.0 18 3.0 19 8.0 20 12.0 21 10.0 22 11.0 23 13.0 24 10.0 25 23.0 26 34.0 27 29.0 28 42.0 29 56.0 30 49.0 31 89.0 32 103.0 33 137.0 34 191.0 35 367.0 36 934.0 37 1853.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.58829595256509 15.648362980149525 9.899458623356535 31.863882443928848 2 22.7 18.775 33.275 25.25 3 17.275 26.825 28.299999999999997 27.6 4 21.325 33.925 22.625 22.125 5 21.55 37.025000000000006 23.549999999999997 17.875 6 18.099999999999998 35.975 24.675 21.25 7 13.3 22.75 46.050000000000004 17.9 8 17.4 24.05 31.25 27.3 9 17.525 22.975 32.05 27.450000000000003 10-14 20.385 29.555 26.125 23.935000000000002 15-19 20.02 28.685 27.785 23.51 20-24 19.52 29.294999999999998 27.435 23.75 25-29 20.32101605080254 29.541477073853695 26.80134006700335 23.336166808340415 30-34 20.23202320232023 28.817881788178816 27.907790779077907 23.042304230423042 35-39 20.36425497848494 28.394876413489445 27.33413389372561 23.90673471430001 40-44 20.190285428142214 29.048572859288935 27.035553329994993 23.72558838257386 45-49 20.36146991088415 28.121558025433064 27.310503654751177 24.20646840893161 50-54 19.971962148901014 28.388324237720923 27.607269814249236 24.032443799128824 55-59 20.19842661722704 28.00020043092649 27.659467855890163 24.141905095956307 60-64 20.42218210990774 27.993381468110712 27.51203369434416 24.072402727637385 65-69 20.42719614921781 28.90092258323305 27.065784195748094 23.606097071801045 70-74 20.164485231432728 28.73476756431473 27.37575848753824 23.724988716714307 75-79 20.772316950852556 28.314944834503507 27.18655967903711 23.72617853560682 80-84 20.166466105094262 28.60509426393903 27.30645808263137 23.92198154833534 85-89 20.7759009573455 28.053731642524184 27.58758959450654 23.582777805623778 90-94 20.292834578548867 28.014842300556587 27.809256380684953 23.883066740209596 95-99 20.417063511955487 28.0615569702742 27.76580279713269 23.755576720637624 100-104 20.622119815668203 28.496293327990387 27.203967140853536 23.67761971548788 105-109 20.8074222668004 28.204613841524573 27.141424272818455 23.846539618856568 110-114 21.334402726953734 28.643039751365983 26.878540277708158 23.14401724397213 115-119 21.0906174819567 27.987169206094624 27.22534081796311 23.696872493985566 120-124 20.905 27.955000000000002 27.105 24.035 125-129 20.595 27.855 27.38 24.169999999999998 130-134 20.915 28.110000000000003 26.88 24.095 135-139 20.997099709971 28.852885288528853 26.767676767676768 23.382338233823383 140-144 21.15 28.294999999999998 26.205000000000002 24.349999999999998 145-149 20.979999999999997 28.449999999999996 26.44 24.13 150-151 20.9375 27.625 27.3875 24.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.5 16 1.0 17 1.0 18 1.5 19 1.0 20 1.0 21 1.5 22 3.0 23 4.5 24 4.5 25 6.0 26 11.0 27 13.5 28 15.0 29 17.0 30 18.5 31 29.0 32 37.0 33 46.0 34 63.5 35 75.5 36 83.0 37 99.5 38 123.5 39 156.5 40 178.0 41 195.5 42 224.0 43 239.5 44 247.0 45 236.5 46 245.5 47 262.0 48 243.0 49 214.5 50 180.5 51 153.0 52 131.0 53 104.0 54 82.5 55 67.0 56 48.5 57 37.0 58 28.5 59 20.5 60 18.5 61 10.5 62 5.5 63 4.5 64 1.5 65 0.5 66 0.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.01 35-39 0.06999999999999999 40-44 0.15 45-49 0.13 50-54 0.135 55-59 0.215 60-64 0.27999999999999997 65-69 0.27999999999999997 70-74 0.295 75-79 0.3 80-84 0.27999999999999997 85-89 0.245 90-94 0.28500000000000003 95-99 0.255 100-104 0.18 105-109 0.3 110-114 0.255 115-119 0.24 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88635788407998 97.675 2 1.0124019235636548 2.0 3 0.07593014426727411 0.22499999999999998 4 0.02531004808909137 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.9750000000000001 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.8875 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 4.9375 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.975 0.0 0.0 0.0 0.0 136-137 6.550000000000001 0.0 0.0 0.0 0.0 138-139 7.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0037167438 20.5375 120-124 >>END_MODULE SRR7172470 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172470_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69275 33.0 33.0 34.0 32.0 34.0 2 32.8155 34.0 33.0 34.0 32.0 34.0 3 32.816 34.0 33.0 34.0 32.0 34.0 4 32.6875 34.0 33.0 34.0 32.0 34.0 5 32.6485 34.0 33.0 34.0 32.0 34.0 6 36.874 38.0 38.0 38.0 36.0 38.0 7 36.8945 38.0 38.0 38.0 36.0 38.0 8 37.0115 38.0 38.0 38.0 37.0 38.0 9 36.90525 38.0 38.0 38.0 37.0 38.0 10-14 36.805600000000005 38.0 38.0 38.0 36.2 38.0 15-19 36.8703 38.0 38.0 38.0 36.6 38.0 20-24 36.847500000000004 38.0 38.0 38.0 36.6 38.0 25-29 36.838049999999996 38.0 38.0 38.0 36.4 38.0 30-34 36.802800000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.6582 38.0 38.0 38.0 36.0 38.0 40-44 36.716899999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.74315 38.0 38.0 38.0 36.0 38.0 50-54 36.615 38.0 38.0 38.0 36.0 38.0 55-59 36.512350000000005 38.0 38.0 38.0 35.4 38.0 60-64 36.4716 38.0 38.0 38.0 35.2 38.0 65-69 36.36425 38.0 38.0 38.0 34.8 38.0 70-74 36.3152 38.0 38.0 38.0 34.6 38.0 75-79 36.272949999999994 38.0 38.0 38.0 34.4 38.0 80-84 36.14025 38.0 38.0 38.0 34.0 38.0 85-89 36.03215 38.0 38.0 38.0 34.0 38.0 90-94 35.8635 38.0 38.0 38.0 33.0 38.0 95-99 35.72375 38.0 38.0 38.0 32.2 38.0 100-104 35.53935 38.0 37.4 38.0 31.2 38.0 105-109 35.2489 38.0 37.0 38.0 29.4 38.0 110-114 35.142399999999995 38.0 37.0 38.0 29.0 38.0 115-119 34.868399999999994 38.0 36.2 38.0 27.8 38.0 120-124 34.67285 38.0 36.0 38.0 26.0 38.0 125-129 34.1844 38.0 35.6 38.0 23.0 38.0 130-134 33.454449999999994 38.0 34.4 38.0 16.2 38.0 135-139 32.96245 38.0 33.0 38.0 14.2 38.0 140-144 32.263850000000005 38.0 33.0 38.0 13.0 38.0 145-149 31.132149999999996 38.0 31.8 38.0 3.8 38.0 150-151 26.30025 33.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 8.0 4 2.0 5 5.0 6 3.0 7 3.0 8 2.0 9 4.0 10 6.0 11 3.0 12 2.0 13 4.0 14 4.0 15 5.0 16 7.0 17 7.0 18 8.0 19 7.0 20 13.0 21 16.0 22 15.0 23 19.0 24 17.0 25 30.0 26 24.0 27 26.0 28 37.0 29 54.0 30 53.0 31 65.0 32 83.0 33 107.0 34 141.0 35 277.0 36 573.0 37 2353.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.65 21.75 14.7 23.9 2 28.582145536384097 24.681170292573142 29.9074768692173 16.829207301825456 3 22.330582645661416 26.831707926981746 31.757939484871216 19.079769942485623 4 23.58679339669835 33.84192096048024 22.761380690345174 19.809904952476238 5 24.50612653163291 36.70917729432358 21.280320080020005 17.504376094023506 6 19.775000000000002 37.974999999999994 22.425 19.825 7 19.950000000000003 19.325 40.2 20.525 8 20.025000000000002 24.0 28.999999999999996 26.974999999999998 9 22.8 24.725 27.425 25.05 10-14 23.375 28.235 26.46 21.93 15-19 23.125 27.495000000000005 27.785 21.595 20-24 23.18 28.435 27.975 20.41 25-29 23.419999999999998 27.985 27.85 20.745 30-34 23.1 27.315 28.26 21.325 35-39 23.369999999999997 28.12 27.445000000000004 21.065 40-44 23.325000000000003 28.335 27.73 20.61 45-49 23.015 27.38 27.93 21.675 50-54 23.525 27.894999999999996 27.43 21.15 55-59 23.365 27.134999999999998 27.91 21.59 60-64 23.419999999999998 27.455000000000002 27.715 21.41 65-69 23.425 27.61 27.794999999999998 21.17 70-74 23.285 27.27 28.000000000000004 21.445 75-79 23.255 27.634999999999998 27.985 21.125 80-84 23.65 27.650000000000002 27.485 21.215 85-89 23.605 27.575 27.865000000000002 20.955 90-94 23.70618530926546 27.556377818890944 27.711385569278463 21.026051302565126 95-99 23.445 27.67 27.935 20.95 100-104 24.505 27.889999999999997 27.295 20.31 105-109 24.21 27.689999999999998 27.935 20.165 110-114 23.494999999999997 27.32 28.265 20.919999999999998 115-119 24.265 27.98 27.255000000000003 20.5 120-124 24.3 27.315 27.49 20.895 125-129 24.349999999999998 27.800000000000004 27.76 20.09 130-134 24.55 27.515 27.43 20.505000000000003 135-139 24.69 27.12 27.985 20.205000000000002 140-144 24.845 27.51 27.224999999999998 20.419999999999998 145-149 25.230000000000004 27.810000000000002 26.784999999999997 20.175 150-151 25.4625 28.025 27.175 19.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 3.0 23 2.5 24 2.0 25 4.5 26 5.0 27 9.0 28 11.0 29 11.0 30 19.0 31 21.5 32 23.5 33 37.5 34 53.0 35 59.0 36 71.0 37 103.5 38 128.5 39 138.5 40 155.5 41 197.0 42 238.5 43 245.5 44 254.5 45 271.0 46 277.5 47 262.0 48 234.5 49 210.5 50 177.5 51 146.0 52 125.0 53 103.0 54 89.5 55 71.5 56 51.5 57 44.0 58 35.5 59 32.5 60 24.5 61 14.5 62 11.0 63 6.5 64 4.0 65 4.0 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8840984022318 97.475 2 0.8876489982247019 1.7500000000000002 3 0.12680699974638598 0.375 4 0.10144559979710879 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.487500000000001 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.75 0.0 0.0 0.0 0.0 136-137 6.3 0.0 0.0 0.0 0.0 138-139 6.887499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATAA 10 0.0068519996 144.85 6 TATAAAG 10 0.0068519996 144.85 8 >>END_MODULE Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra Read 788413 spots for SRR7172470.sra Written 788413 spots for SRR7172470.sra SRR ids: ['SRR7172470.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pqgd72lu SRR7172470.sra spots: 15768260 blocks: [[1, 788413], [788414, 1576826], [1576827, 2365239], [2365240, 3153652], [3153653, 3942065], [3942066, 4730478], [4730479, 5518891], [5518892, 6307304], [6307305, 7095717], [7095718, 7884130], [7884131, 8672543], [8672544, 9460956], [9460957, 10249369], [10249370, 11037782], [11037783, 11826195], [11826196, 12614608], [12614609, 13403021], [13403022, 14191434], [14191435, 14979847], [14979848, 15768260]] SRR7172470 file size 5321645 SRR7172470 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172470 SRR7172470_1.fastq SRR7172470_2.fastq Input file: SRR7172470_1.fastq Paired file: SRR7172470_2.fastq trimmed: SRR7172470-trimmed-pair1.fastq, SRR7172470-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:30:39 2025 >> started Mon Feb 10 11:30:55 2025 >> done (16.607s) 15768260 read pairs processed; of these: 30937 ( 0.20%) short read pairs filtered out after trimming by size control 72806 ( 0.46%) empty read pairs filtered out after trimming by size control 15664517 (99.34%) read pairs available; of these: 8215152 (52.44%) trimmed read pairs available after processing 7449365 (47.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 6 0.00% 21 11 0.00% 22 12 0.00% 23 12 0.00% 24 14 0.00% 25 6 0.00% 26 16 0.00% 27 8 0.00% 28 10 0.00% 29 15 0.00% 30 22 0.00% 31 14 0.00% 32 17 0.00% 33 21 0.00% 34 28 0.00% 35 16 0.00% 36 23 0.00% 37 31 0.00% 38 23 0.00% 39 27 0.00% 40 23 0.00% 41 34 0.00% 42 33 0.00% 43 33 0.00% 44 54 0.00% 45 54 0.00% 46 57 0.00% 47 69 0.00% 48 61 0.00% 49 96 0.00% 50 112 0.00% 51 106 0.00% 52 110 0.00% 53 139 0.00% 54 149 0.00% 55 147 0.00% 56 184 0.00% 57 213 0.00% 58 237 0.00% 59 258 0.00% 60 299 0.00% 61 367 0.00% 62 404 0.00% 63 444 0.00% 64 458 0.00% 65 541 0.00% 66 668 0.00% 67 735 0.00% 68 887 0.01% 69 1102 0.01% 70 1278 0.01% 71 1255 0.01% 72 1417 0.01% 73 1501 0.01% 74 1715 0.01% 75 1882 0.01% 76 2073 0.01% 77 2285 0.01% 78 2541 0.02% 79 2916 0.02% 80 3193 0.02% 81 3836 0.02% 82 4223 0.03% 83 4845 0.03% 84 6252 0.04% 85 7131 0.05% 86 7285 0.05% 87 7935 0.05% 88 8283 0.05% 89 8728 0.06% 90 9423 0.06% 91 10191 0.07% 92 10952 0.07% 93 11362 0.07% 94 12140 0.08% 95 12730 0.08% 96 13161 0.08% 97 13885 0.09% 98 14165 0.09% 99 14977 0.10% 100 16030 0.10% 101 16786 0.11% 102 18210 0.12% 103 18545 0.12% 104 19381 0.12% 105 20232 0.13% 106 21170 0.14% 107 21594 0.14% 108 22772 0.15% 109 23700 0.15% 110 24385 0.16% 111 25802 0.16% 112 27200 0.17% 113 28281 0.18% 114 29688 0.19% 115 30922 0.20% 116 32586 0.21% 117 33269 0.21% 118 34508 0.22% 119 35576 0.23% 120 37228 0.24% 121 38244 0.24% 122 39871 0.25% 123 41656 0.27% 124 44035 0.28% 125 45660 0.29% 126 48025 0.31% 127 49647 0.32% 128 51318 0.33% 129 53588 0.34% 130 55838 0.36% 131 57578 0.37% 132 61068 0.39% 133 64382 0.41% 134 67529 0.43% 135 71489 0.46% 136 74819 0.48% 137 80151 0.51% 138 86364 0.55% 139 91558 0.58% 140 97325 0.62% 141 106706 0.68% 142 117264 0.75% 143 132500 0.85% 144 153777 0.98% 145 184037 1.17% 146 225460 1.44% 147 306195 1.95% 148 450065 2.87% 149 862351 5.51% 150 3706811 23.66% 151 7449365 47.56% 15664517 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=21 prefix-density=0.77 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=454.66 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=8 prefix-density=1.28 prefix-fanout=1.7 sequence=ATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=64.68 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.7 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGT SRR7172470 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:31:39 Started mapping on | Feb 10 11:31:39 Finished on | Feb 10 11:33:17 Mapping speed, Million of reads per hour | 575.43 Number of input reads | 15664517 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14659565 Uniquely mapped reads % | 93.58% Average mapped length | 292.24 Number of splices: Total | 13535598 Number of splices: Annotated (sjdb) | 13268422 Number of splices: GT/AG | 13254293 Number of splices: GC/AG | 237032 Number of splices: AT/AC | 8447 Number of splices: Non-canonical | 35826 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 413951 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 44308 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 616812 616812 616812 N_multimapping 413951 413951 413951 N_noFeature 484288 14436629 582718 N_ambiguous 227628 1250 102199 UnstrandedReadsAssigned:13947649 PositiveStrandReadsAssigned:221686 NegativeStrandReadsAssigned:13974648 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172470 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172470-trimmed-pair1.fastq SRR7172470-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,664,517 reads, 14,026,954 reads pseudoaligned [quant] estimated average fragment length: 245.828 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR7172470.ke.tsv 34699 SRR7172470.se.tsv 87100 total ==> SRR7172470.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.17 380 14.8832 Potri.005G024800.1.v4.1 1035 790.172 181 15.9082 Potri.004G059700.1.v4.1 961 716.281 19 1.84219 Potri.007G009000.2.v4.1 1416 1171.17 0 0 Potri.003G141000.2.v4.1 2943 2698.17 703.356 18.1038 Potri.016G087400.1.v4.1 270 84.1309 476.254 393.14 Potri.015G069301.1.v4.1 564 326.877 0 0 Potri.010G195200.1.v4.1 1773 1528.17 19 0.863466 Potri.012G127500.1.v4.1 977 732.246 382 36.2302 ==> SRR7172470.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 70 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 32 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR7172470 completed mapping pipeline successfully