Starting /dee2/code/volunteer_pipeline.sh SRR7172471 current disk space = 3059097358336 free memory = 1500903812 SRR7172471 SRAfilesize 08e924ee1a318bf7e5d3438c62e08c97 SRR7172471.sra SRR7172471.sra file validated SRR7172471 is paired end SRR7172471 is conventional basespace SRR7172471 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172471_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.927 34.0 33.0 34.0 33.0 34.0 2 33.40075 34.0 34.0 34.0 33.0 34.0 3 33.42075 34.0 34.0 34.0 33.0 34.0 4 33.50125 34.0 34.0 34.0 33.0 34.0 5 33.52425 34.0 34.0 34.0 33.0 34.0 6 37.228 38.0 38.0 38.0 36.0 38.0 7 37.40875 38.0 38.0 38.0 37.0 38.0 8 37.45925 38.0 38.0 38.0 37.0 38.0 9 37.4835 38.0 38.0 38.0 38.0 38.0 10-14 37.4937 38.0 38.0 38.0 37.8 38.0 15-19 37.52415 38.0 38.0 38.0 38.0 38.0 20-24 37.52565 38.0 38.0 38.0 38.0 38.0 25-29 37.5037 38.0 38.0 38.0 38.0 38.0 30-34 37.44089999999999 38.0 38.0 38.0 37.6 38.0 35-39 37.40989999999999 38.0 38.0 38.0 37.4 38.0 40-44 37.23245 38.0 38.0 38.0 37.0 38.0 45-49 37.2018 38.0 38.0 38.0 36.8 38.0 50-54 37.0484 38.0 38.0 38.0 36.0 38.0 55-59 37.0431 38.0 38.0 38.0 36.0 38.0 60-64 37.02575 38.0 38.0 38.0 36.0 38.0 65-69 36.9551 38.0 38.0 38.0 36.0 38.0 70-74 36.8442 38.0 38.0 38.0 35.4 38.0 75-79 36.754 38.0 38.0 38.0 35.0 38.0 80-84 36.6578 38.0 38.0 38.0 34.8 38.0 85-89 36.6127 38.0 38.0 38.0 34.8 38.0 90-94 36.4798 38.0 38.0 38.0 34.0 38.0 95-99 36.34675 38.0 37.8 38.0 33.8 38.0 100-104 36.08225 38.0 37.8 38.0 33.4 38.0 105-109 35.995599999999996 38.0 37.4 38.0 33.0 38.0 110-114 35.5933 38.0 37.0 38.0 30.6 38.0 115-119 35.67569999999999 38.0 37.0 38.0 31.4 38.0 120-124 35.52080000000001 38.0 37.0 38.0 31.0 38.0 125-129 34.977250000000005 38.0 36.0 38.0 27.8 38.0 130-134 34.81235 38.0 35.6 38.0 27.8 38.0 135-139 34.4287 38.0 35.2 38.0 25.8 38.0 140-144 33.79345000000001 38.0 34.2 38.0 22.0 38.0 145-149 32.95395 38.0 33.2 38.0 16.6 38.0 150-151 28.704875 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 2.0 12 1.0 13 1.0 14 2.0 15 2.0 16 5.0 17 2.0 18 6.0 19 7.0 20 6.0 21 6.0 22 6.0 23 17.0 24 13.0 25 16.0 26 17.0 27 32.0 28 21.0 29 48.0 30 45.0 31 55.0 32 73.0 33 108.0 34 133.0 35 252.0 36 611.0 37 2511.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.0559796437659 17.150127226463106 8.727735368956743 28.06615776081425 2 22.0 19.375 33.275 25.35 3 18.55 27.925 27.575 25.95 4 21.95 33.175 24.6 20.275000000000002 5 21.25 37.275000000000006 22.95 18.525 6 17.7 34.4 26.674999999999997 21.224999999999998 7 15.299999999999999 22.05 43.625 19.025 8 17.675 23.400000000000002 31.6 27.325 9 17.875 23.225 31.8 27.1 10-14 20.445 29.104999999999997 26.275 24.175 15-19 20.16 28.82 27.79 23.23 20-24 20.19 28.7 27.529999999999998 23.580000000000002 25-29 19.97 28.77 27.21 24.05 30-34 19.994999999999997 28.075 28.115000000000002 23.815 35-39 20.805 28.275 27.505000000000003 23.415 40-44 20.11 28.205000000000002 28.08 23.605 45-49 20.380000000000003 28.29 27.67 23.66 50-54 20.53 28.645 27.384999999999998 23.44 55-59 20.53 27.825 27.51 24.135 60-64 20.22 28.720000000000002 28.1 22.96 65-69 19.865 28.185 28.065 23.885 70-74 20.565 28.49 27.13 23.815 75-79 20.27 28.605000000000004 27.68 23.445 80-84 19.830000000000002 28.075 28.17 23.925 85-89 19.99 27.689999999999998 28.28 24.04 90-94 20.225 28.33 27.1 24.345 95-99 20.575 27.975 27.775 23.674999999999997 100-104 20.29913461057476 28.627882547146218 26.962132959831926 24.110849882447102 105-109 20.275000000000002 27.765 28.050000000000004 23.91 110-114 20.850020024028833 27.75330396475771 27.50800961153384 23.888666399679614 115-119 20.665 28.48 27.55 23.305 120-124 20.76 28.775000000000002 26.979999999999997 23.485 125-129 20.8 27.694999999999997 27.439999999999998 24.065 130-134 21.025 28.07 27.445000000000004 23.46 135-139 20.5 28.854999999999997 27.12 23.525 140-144 20.665 28.560000000000002 26.6 24.175 145-149 20.87 28.59 26.955000000000002 23.585 150-151 20.4 28.8375 26.3625 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 3.0 24 5.0 25 5.0 26 4.5 27 8.0 28 8.0 29 10.0 30 18.0 31 30.0 32 37.5 33 45.0 34 59.5 35 72.0 36 94.0 37 111.5 38 127.0 39 144.5 40 164.0 41 211.5 42 236.5 43 263.5 44 292.0 45 277.5 46 246.0 47 224.5 48 229.5 49 209.5 50 170.5 51 140.0 52 116.0 53 99.0 54 78.0 55 69.0 56 57.5 57 35.0 58 24.5 59 19.0 60 14.0 61 12.0 62 9.5 63 6.0 64 2.5 65 0.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.045 105-109 0.0 110-114 0.12 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.95965490992134 97.5 2 0.786602385181426 1.55 3 0.17761989342806395 0.525 4 0.0 0.0 5 0.050748540979446845 0.25 6 0.0 0.0 7 0.025374270489723422 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 7 0.17500000000000002 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit CCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACAAAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7374999999999998 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.425 0.0 0.0 0.0 0.0 130-131 4.7375 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.487500000000001 0.0 0.0 0.0 0.0 136-137 5.8125 0.0 0.0 0.0 0.0 138-139 6.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172471 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172471_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55225 33.0 33.0 34.0 32.0 34.0 2 32.60775 34.0 33.0 34.0 32.0 34.0 3 32.6605 34.0 33.0 34.0 32.0 34.0 4 32.53925 34.0 33.0 34.0 32.0 34.0 5 32.55075 34.0 33.0 34.0 32.0 34.0 6 36.67125 38.0 38.0 38.0 36.0 38.0 7 36.59625 38.0 38.0 38.0 36.0 38.0 8 36.6215 38.0 38.0 38.0 36.0 38.0 9 36.71025 38.0 38.0 38.0 36.0 38.0 10-14 36.72075 38.0 38.0 38.0 36.0 38.0 15-19 36.68005 38.0 38.0 38.0 36.0 38.0 20-24 36.6682 38.0 38.0 38.0 36.0 38.0 25-29 36.646100000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.626 38.0 38.0 38.0 36.0 38.0 35-39 36.565349999999995 38.0 38.0 38.0 35.8 38.0 40-44 36.62535 38.0 38.0 38.0 36.0 38.0 45-49 36.57065 38.0 38.0 38.0 36.0 38.0 50-54 36.4815 38.0 38.0 38.0 35.8 38.0 55-59 36.41465 38.0 38.0 38.0 35.4 38.0 60-64 36.3458 38.0 38.0 38.0 34.4 38.0 65-69 36.320100000000004 38.0 38.0 38.0 34.6 38.0 70-74 36.32655 38.0 38.0 38.0 34.6 38.0 75-79 36.03725 38.0 38.0 38.0 34.0 38.0 80-84 36.11555 38.0 38.0 38.0 34.0 38.0 85-89 36.0851 38.0 38.0 38.0 34.0 38.0 90-94 35.856049999999996 38.0 38.0 38.0 33.2 38.0 95-99 35.672000000000004 38.0 38.0 38.0 32.2 38.0 100-104 35.65259999999999 38.0 38.0 38.0 32.2 38.0 105-109 35.2963 38.0 38.0 38.0 29.6 38.0 110-114 35.25045 38.0 37.4 38.0 29.4 38.0 115-119 35.1301 38.0 37.0 38.0 29.2 38.0 120-124 34.849849999999996 38.0 36.8 38.0 27.8 38.0 125-129 34.543 38.0 36.0 38.0 26.4 38.0 130-134 34.27225 38.0 35.8 38.0 24.4 38.0 135-139 33.61055 38.0 34.6 38.0 17.8 38.0 140-144 32.97330000000001 38.0 33.6 38.0 13.4 38.0 145-149 32.39309999999999 38.0 33.0 38.0 10.8 38.0 150-151 28.3455 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 6.0 4 7.0 5 1.0 6 5.0 7 3.0 8 1.0 9 6.0 10 4.0 11 3.0 12 3.0 13 3.0 14 6.0 15 11.0 16 11.0 17 11.0 18 15.0 19 10.0 20 13.0 21 7.0 22 7.0 23 13.0 24 16.0 25 25.0 26 22.0 27 38.0 28 41.0 29 57.0 30 36.0 31 50.0 32 65.0 33 86.0 34 129.0 35 210.0 36 431.0 37 2627.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.641798543079624 22.707862346144182 11.881436824918362 19.768902285857827 2 27.971852224176928 24.302588590098015 30.108067353606433 17.617491832118624 3 22.995727569741142 26.313144006031663 31.89243528524755 18.798693138979644 4 25.23247046996733 33.52601156069364 22.618748429253582 18.62276954008545 5 22.69414425735109 38.92937924101533 20.306609700929883 18.069866800703693 6 18.765679879578524 36.90416457601606 24.184646261916708 20.14550928248871 7 17.962870045158052 19.34269944806824 41.29453085800301 21.3998996487707 8 20.84796788760662 23.381836427496236 28.048168590065224 27.722027094831915 9 20.27094831911691 25.13798294029102 28.725539387857502 25.865529352734573 10-14 23.15720808871494 27.92413066385669 27.46249184605349 21.45616940137488 15-19 22.986602438657233 27.813738772642882 28.782176727382208 20.417482061317678 20-24 22.629202207727044 28.24887104867035 28.138484696437533 20.983442047165077 25-29 23.275299784255683 28.00160553910993 28.543474988711054 20.179619687923335 30-34 22.616897451334538 27.834637768412602 28.727674091912505 20.820790688340356 35-39 22.87276740919125 27.985149508328316 28.14569536423841 20.996387718242023 40-44 23.67523083099157 27.94560417503011 27.57928542753914 20.79987956643918 45-49 22.94144211952431 28.04455818154448 28.200110391891215 20.813889307039993 50-54 22.641509433962266 27.93556804496186 28.276796467282217 21.146126053793658 55-59 23.27646763672855 27.912694430506775 27.711991971901657 21.098845960863024 60-64 23.211239337681885 27.787255393878574 27.782237832413447 21.21926743602609 65-69 22.819869543401907 27.947817360762667 27.957852483692925 21.274460612142498 70-74 23.17226152842591 27.90907722414572 27.542776857845354 21.375884389583018 75-79 22.926388679813336 27.723418134377038 27.788649706457925 21.5615434793517 80-84 23.341363043260063 27.46662651811703 27.75268493425675 21.439325504366156 85-89 23.465649621117077 27.590706077181714 28.062427861695188 20.88121644000602 90-94 24.134123080012046 27.587591607268347 27.401867282401366 20.87641803031824 95-99 23.69979919678715 27.72590361445783 27.700803212851405 20.873493975903614 100-104 23.94359128776473 27.235772357723576 27.66235069758105 21.15828565693064 105-109 23.756711998795605 27.836603603151506 28.007226376273398 20.399458021779495 110-114 23.81573665194701 28.04094741067844 27.870333199518267 20.27298273785628 115-119 24.222043766311984 28.066653282473396 27.062838787392092 20.648464163822524 120-124 24.141910879164993 27.900441589723002 27.24307507025291 20.71457246085909 125-129 24.422922521075876 27.40365315134484 27.68466479325572 20.488759534323563 130-134 25.273457099849473 27.370797792272956 27.48118414450577 19.874560963371803 135-139 24.656297039638737 27.496236828901154 27.9177119919719 19.92975413948821 140-144 24.61986249811813 27.430119937772872 27.299643699503186 20.65037386460581 145-149 25.14678576805339 27.99217142570382 26.787775380137504 20.073267426105286 150-151 25.078409233471334 28.139505708192196 27.198594906536194 19.583490151800277 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 12.0 1 6.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 1.0 20 2.0 21 2.5 22 3.0 23 2.5 24 2.5 25 3.0 26 4.5 27 6.5 28 8.5 29 12.0 30 16.5 31 22.0 32 26.0 33 31.5 34 49.0 35 64.0 36 78.0 37 97.5 38 131.0 39 172.5 40 194.0 41 210.0 42 233.5 43 257.5 44 267.0 45 267.0 46 252.0 47 243.0 48 236.0 49 210.5 50 179.5 51 150.5 52 118.0 53 92.5 54 77.5 55 62.5 56 50.5 57 38.5 58 26.5 59 19.5 60 20.0 61 16.0 62 10.0 63 4.5 64 1.5 65 0.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.525 3 0.525 4 0.525 5 0.525 6 0.35000000000000003 7 0.35000000000000003 8 0.35000000000000003 9 0.35000000000000003 10-14 0.35500000000000004 15-19 0.35500000000000004 20-24 0.35000000000000003 25-29 0.345 30-34 0.33999999999999997 35-39 0.33999999999999997 40-44 0.36 45-49 0.35500000000000004 50-54 0.36 55-59 0.35000000000000003 60-64 0.35000000000000003 65-69 0.35000000000000003 70-74 0.35500000000000004 75-79 0.35500000000000004 80-84 0.37 85-89 0.365 90-94 0.38999999999999996 95-99 0.4 100-104 0.37 105-109 0.365 110-114 0.36 115-119 0.38 120-124 0.36 125-129 0.36 130-134 0.35000000000000003 135-139 0.35000000000000003 140-144 0.365 145-149 0.365 150-151 0.36250000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98348157560356 97.375 2 0.7878017789072427 1.55 3 0.10165184243964422 0.3 4 0.07623888182973317 0.3 5 0.0 0.0 6 0.0 0.0 7 0.025412960609911054 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025412960609911054 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.4249999999999998 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.35 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.35 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.7125 0.0 0.0 0.0 0.0 132-133 5.050000000000001 0.0 0.0 0.0 0.0 134-135 5.5 0.0 0.0 0.0 0.0 136-137 5.8375 0.0 0.0 0.0 0.0 138-139 6.175000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAGCAG 10 0.006830828 145.0 3 CTATGCT 10 0.006830828 145.0 8 GGGGGGG 30 0.0014437955 24.166668 135-139 >>END_MODULE Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916363 spots for SRR7172471.sra Written 916363 spots for SRR7172471.sra Read 916369 spots for SRR7172471.sra Written 916369 spots for SRR7172471.sra SRR ids: ['SRR7172471.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8tfk5ev8 SRR7172471.sra spots: 18327266 blocks: [[1, 916363], [916364, 1832726], [1832727, 2749089], [2749090, 3665452], [3665453, 4581815], [4581816, 5498178], [5498179, 6414541], [6414542, 7330904], [7330905, 8247267], [8247268, 9163630], [9163631, 10079993], [10079994, 10996356], [10996357, 11912719], [11912720, 12829082], [12829083, 13745445], [13745446, 14661808], [14661809, 15578171], [15578172, 16494534], [16494535, 17410897], [17410898, 18327266]] SRR7172471 file size 6188808 SRR7172471 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172471 SRR7172471_1.fastq SRR7172471_2.fastq Input file: SRR7172471_1.fastq Paired file: SRR7172471_2.fastq trimmed: SRR7172471-trimmed-pair1.fastq, SRR7172471-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:45:45 2025 >> started Mon Feb 10 10:46:05 2025 >> done (20.588s) 18327266 read pairs processed; of these: 44608 ( 0.24%) short read pairs filtered out after trimming by size control 129983 ( 0.71%) empty read pairs filtered out after trimming by size control 18152675 (99.05%) read pairs available; of these: 9512804 (52.40%) trimmed read pairs available after processing 8639871 (47.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 10 0.00% 20 9 0.00% 21 11 0.00% 22 9 0.00% 23 13 0.00% 24 14 0.00% 25 9 0.00% 26 15 0.00% 27 19 0.00% 28 14 0.00% 29 15 0.00% 30 15 0.00% 31 24 0.00% 32 9 0.00% 33 15 0.00% 34 17 0.00% 35 18 0.00% 36 19 0.00% 37 18 0.00% 38 34 0.00% 39 21 0.00% 40 31 0.00% 41 40 0.00% 42 39 0.00% 43 40 0.00% 44 50 0.00% 45 59 0.00% 46 60 0.00% 47 87 0.00% 48 92 0.00% 49 92 0.00% 50 111 0.00% 51 138 0.00% 52 147 0.00% 53 181 0.00% 54 166 0.00% 55 198 0.00% 56 222 0.00% 57 262 0.00% 58 289 0.00% 59 317 0.00% 60 333 0.00% 61 437 0.00% 62 485 0.00% 63 544 0.00% 64 649 0.00% 65 706 0.00% 66 807 0.00% 67 879 0.00% 68 984 0.01% 69 1572 0.01% 70 2394 0.01% 71 1943 0.01% 72 1898 0.01% 73 2009 0.01% 74 2182 0.01% 75 2321 0.01% 76 2500 0.01% 77 2873 0.02% 78 3048 0.02% 79 3499 0.02% 80 3793 0.02% 81 4322 0.02% 82 4943 0.03% 83 5674 0.03% 84 7750 0.04% 85 9049 0.05% 86 9447 0.05% 87 9822 0.05% 88 10067 0.06% 89 10657 0.06% 90 11236 0.06% 91 11956 0.07% 92 12871 0.07% 93 14020 0.08% 94 14714 0.08% 95 15443 0.09% 96 15651 0.09% 97 16072 0.09% 98 16548 0.09% 99 17184 0.09% 100 18251 0.10% 101 18898 0.10% 102 20353 0.11% 103 21285 0.12% 104 22131 0.12% 105 23520 0.13% 106 24214 0.13% 107 25152 0.14% 108 25816 0.14% 109 27098 0.15% 110 28001 0.15% 111 29392 0.16% 112 30478 0.17% 113 32157 0.18% 114 33621 0.19% 115 35136 0.19% 116 36074 0.20% 117 37145 0.20% 118 38086 0.21% 119 39798 0.22% 120 41286 0.23% 121 42601 0.23% 122 44389 0.24% 123 47220 0.26% 124 49267 0.27% 125 51758 0.29% 126 54235 0.30% 127 55971 0.31% 128 57570 0.32% 129 60379 0.33% 130 62470 0.34% 131 64923 0.36% 132 68642 0.38% 133 72802 0.40% 134 77269 0.43% 135 83015 0.46% 136 86506 0.48% 137 92203 0.51% 138 99329 0.55% 139 106864 0.59% 140 115000 0.63% 141 125243 0.69% 142 138017 0.76% 143 155560 0.86% 144 179228 0.99% 145 210641 1.16% 146 257557 1.42% 147 342261 1.89% 148 516923 2.85% 149 974536 5.37% 150 4356291 24.00% 151 8639871 47.60% 18152675 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.54 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=222.45 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.16 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=28 prefix-density=1.15 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=58.61 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7172471 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:46:50 Started mapping on | Feb 10 10:46:50 Finished on | Feb 10 10:49:14 Mapping speed, Million of reads per hour | 453.82 Number of input reads | 18152675 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16779205 Uniquely mapped reads % | 92.43% Average mapped length | 292.10 Number of splices: Total | 16105364 Number of splices: Annotated (sjdb) | 15753276 Number of splices: GT/AG | 15785516 Number of splices: GC/AG | 257852 Number of splices: AT/AC | 9346 Number of splices: Non-canonical | 52650 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 472812 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 83572 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.39% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 942885 942885 942885 N_multimapping 472812 472812 472812 N_noFeature 677205 16454753 793181 N_ambiguous 324839 1131 115698 UnstrandedReadsAssigned:15777161 PositiveStrandReadsAssigned:323321 NegativeStrandReadsAssigned:15870326 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172471 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172471-trimmed-pair1.fastq SRR7172471-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,152,675 reads, 15,887,205 reads pseudoaligned [quant] estimated average fragment length: 252.663 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR7172471.ke.tsv 34699 SRR7172471.se.tsv 87100 total ==> SRR7172471.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.34 584 17.6835 Potri.005G024800.1.v4.1 1035 783.337 166 11.3341 Potri.004G059700.1.v4.1 961 709.424 23 1.73401 Potri.007G009000.2.v4.1 1416 1164.34 0 0 Potri.003G141000.2.v4.1 2943 2691.34 1178 23.4103 Potri.016G087400.1.v4.1 270 83.3423 679 435.746 Potri.015G069301.1.v4.1 564 322.549 0 0 Potri.010G195200.1.v4.1 1773 1521.34 24 0.843752 Potri.012G127500.1.v4.1 977 725.392 243 17.9169 ==> SRR7172471.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 578 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 307 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 70 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 19 SRR7172471 completed mapping pipeline successfully