Starting /dee2/code/volunteer_pipeline.sh SRR7172472 current disk space = 3059116093440 free memory = 1444274372 SRR7172472 SRAfilesize cc1796232cc5e1d43a721e5cb7f60bc5 SRR7172472.sra SRR7172472.sra file validated SRR7172472 is paired end SRR7172472 is conventional basespace SRR7172472 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172472_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5225 34.0 33.0 34.0 32.0 34.0 2 33.321 34.0 34.0 34.0 33.0 34.0 3 33.3485 34.0 34.0 34.0 33.0 34.0 4 33.41225 34.0 34.0 34.0 33.0 34.0 5 33.44575 34.0 34.0 34.0 33.0 34.0 6 37.157 38.0 38.0 38.0 36.0 38.0 7 37.39075 38.0 38.0 38.0 37.0 38.0 8 37.5435 38.0 38.0 38.0 37.0 38.0 9 37.505 38.0 38.0 38.0 37.0 38.0 10-14 37.4968 38.0 38.0 38.0 37.4 38.0 15-19 37.556549999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.49825 38.0 38.0 38.0 37.8 38.0 25-29 37.48305 38.0 38.0 38.0 37.8 38.0 30-34 37.47625000000001 38.0 38.0 38.0 37.8 38.0 35-39 37.40025 38.0 38.0 38.0 37.4 38.0 40-44 37.1836 38.0 38.0 38.0 36.6 38.0 45-49 37.082649999999994 38.0 38.0 38.0 36.2 38.0 50-54 36.9206 38.0 38.0 38.0 36.0 38.0 55-59 36.9682 38.0 38.0 38.0 36.0 38.0 60-64 36.96415 38.0 38.0 38.0 35.8 38.0 65-69 36.887350000000005 38.0 38.0 38.0 35.6 38.0 70-74 36.7718 38.0 38.0 38.0 35.0 38.0 75-79 36.637950000000004 38.0 38.0 38.0 34.2 38.0 80-84 36.5077 38.0 38.0 38.0 34.0 38.0 85-89 36.440549999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.265249999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.043899999999994 38.0 37.0 38.0 32.6 38.0 100-104 35.778549999999996 38.0 37.0 38.0 31.4 38.0 105-109 35.82885 38.0 37.0 38.0 31.6 38.0 110-114 35.5079 38.0 36.0 38.0 30.4 38.0 115-119 35.28144999999999 38.0 36.2 38.0 29.6 38.0 120-124 35.0227 38.0 35.8 38.0 28.0 38.0 125-129 34.73945 38.0 35.2 38.0 27.2 38.0 130-134 34.3104 38.0 35.0 38.0 24.4 38.0 135-139 33.8418 38.0 34.2 38.0 22.6 38.0 140-144 33.1765 38.0 33.6 38.0 18.6 38.0 145-149 32.186699999999995 38.0 32.6 38.0 10.8 38.0 150-151 26.98975 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 1.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 4.0 17 3.0 18 3.0 19 2.0 20 6.0 21 8.0 22 9.0 23 9.0 24 24.0 25 16.0 26 12.0 27 26.0 28 32.0 29 49.0 30 47.0 31 62.0 32 91.0 33 113.0 34 186.0 35 364.0 36 826.0 37 2098.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.574555755858874 15.967035797064124 7.210919392222509 33.2474890548545 2 20.9 18.275 36.075 24.75 3 18.725 25.424999999999997 26.900000000000002 28.95 4 22.900000000000002 32.574999999999996 23.575 20.95 5 21.975 35.949999999999996 23.150000000000002 18.925 6 17.375 37.075 25.05 20.5 7 13.775 23.200000000000003 45.225 17.8 8 16.325 24.95 30.95 27.775 9 16.7 25.174999999999997 32.975 25.15 10-14 20.555 29.775000000000002 26.39 23.28 15-19 20.07 28.449999999999996 27.565 23.915 20-24 19.955000000000002 28.244999999999997 27.939999999999998 23.86 25-29 20.156046814044213 29.038711613484047 27.153145943783137 23.652095628688606 30-34 20.13006503251626 28.444222111055527 27.978989494747374 23.446723361680842 35-39 19.694771078308733 29.00675506629973 27.36052039029272 23.937953465098825 40-44 20.59868849176553 28.232467337438056 28.13735796165591 23.03148620914051 45-49 20.05706276904595 29.081990189208128 27.044749224146564 23.81619781759936 50-54 19.920916962810953 28.950397917813703 27.548926372691323 23.579758746684018 55-59 20.05006257822278 28.49561952440551 27.829787234042552 23.62453066332916 60-64 20.430538172715895 28.400500625782225 27.564455569461828 23.60450563204005 65-69 20.621808350856114 28.64223490537699 26.93501552017623 23.80094122359067 70-74 20.338473863408773 28.730222311235732 27.548567995193267 23.382735830162225 75-79 20.075112669003506 28.833249874812218 27.806710065097644 23.28492739108663 80-84 20.090112640801 29.12140175219024 27.489361702127656 23.299123904881103 85-89 20.14619004706118 28.577150295384 27.881245619305094 23.395414038249722 90-94 20.15119655552218 28.527085210774004 28.13657755081606 23.185140682887752 95-99 20.355444305381727 28.550688360450565 27.97997496871089 23.11389236545682 100-104 20.682580193164192 28.574288144923184 27.893709653205224 22.8494220087074 105-109 20.442708333333336 27.9296875 27.844551282051285 23.783052884615387 110-114 20.66599899849775 28.377566349524287 27.69654481722584 23.25988983475213 115-119 21.084518325655917 28.47987182054877 27.017824954936913 23.4177848988584 120-124 20.745 28.71 26.985 23.56 125-129 20.815 28.485 27.439999999999998 23.26 130-134 21.11 28.975 26.815 23.1 135-139 20.625 28.28 27.04 24.055 140-144 20.945 28.194999999999997 26.99 23.87 145-149 20.605 28.395 26.674999999999997 24.325 150-151 20.875 28.825 26.55 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 1.0 21 0.5 22 1.5 23 1.5 24 3.5 25 4.5 26 5.5 27 7.5 28 11.5 29 17.5 30 25.5 31 34.0 32 39.0 33 55.5 34 71.0 35 76.0 36 87.5 37 115.5 38 141.0 39 161.5 40 201.0 41 233.5 42 242.5 43 249.0 44 253.5 45 251.0 46 244.0 47 234.5 48 219.5 49 188.0 50 159.5 51 137.0 52 109.0 53 93.0 54 77.5 55 60.5 56 49.5 57 37.0 58 28.5 59 22.0 60 12.5 61 9.5 62 7.5 63 3.5 64 3.0 65 3.0 66 3.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.03 30-34 0.05 35-39 0.075 40-44 0.11499999999999999 45-49 0.11 50-54 0.105 55-59 0.125 60-64 0.125 65-69 0.13 70-74 0.13999999999999999 75-79 0.15 80-84 0.125 85-89 0.13 90-94 0.13 95-99 0.125 100-104 0.08499999999999999 105-109 0.16 110-114 0.15 115-119 0.13999999999999999 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.9749999999999999 0.0 0.0 0.0 0.0 108-109 2.3625 0.0 0.0 0.0 0.0 110-111 2.7 0.0 0.0 0.0 0.0 112-113 2.9124999999999996 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.7375 0.0 0.0 0.0 0.0 118-119 4.325 0.0 0.0 0.0 0.0 120-121 4.887499999999999 0.0 0.0 0.0 0.0 122-123 5.35 0.0 0.0 0.0 0.0 124-125 5.85 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 6.8375 0.0 0.0 0.0 0.0 130-131 7.4375 0.0 0.0 0.0 0.0 132-133 8.075 0.0 0.0 0.0 0.0 134-135 8.675 0.0 0.0 0.0 0.0 136-137 9.3375 0.0 0.0 0.0 0.0 138-139 9.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTCAT 10 0.006832588 144.9875 5 AATACTG 10 0.006832588 144.9875 5 >>END_MODULE SRR7172472 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172472_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68375 33.0 33.0 34.0 32.0 34.0 2 32.806 33.0 33.0 34.0 32.0 34.0 3 32.812 34.0 33.0 34.0 32.0 34.0 4 32.7015 34.0 33.0 34.0 32.0 34.0 5 32.65575 34.0 33.0 34.0 32.0 34.0 6 36.88325 38.0 38.0 38.0 36.0 38.0 7 36.96475 38.0 38.0 38.0 37.0 38.0 8 36.9355 38.0 38.0 38.0 36.0 38.0 9 36.99925 38.0 38.0 38.0 37.0 38.0 10-14 36.79559999999999 38.0 38.0 38.0 36.2 38.0 15-19 36.846799999999995 38.0 38.0 38.0 36.6 38.0 20-24 36.8875 38.0 38.0 38.0 36.8 38.0 25-29 36.837650000000004 38.0 38.0 38.0 36.8 38.0 30-34 36.781850000000006 38.0 38.0 38.0 36.2 38.0 35-39 36.6686 38.0 38.0 38.0 36.0 38.0 40-44 36.7084 38.0 38.0 38.0 36.0 38.0 45-49 36.683800000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.652300000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.567949999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.5861 38.0 38.0 38.0 35.8 38.0 65-69 36.43485 38.0 38.0 38.0 35.2 38.0 70-74 36.3774 38.0 38.0 38.0 34.4 38.0 75-79 36.2816 38.0 38.0 38.0 34.2 38.0 80-84 36.19690000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.0915 38.0 38.0 38.0 34.0 38.0 90-94 36.0158 38.0 38.0 38.0 34.0 38.0 95-99 35.78575 38.0 38.0 38.0 33.0 38.0 100-104 35.67139999999999 38.0 38.0 38.0 31.8 38.0 105-109 35.429199999999994 38.0 37.0 38.0 30.8 38.0 110-114 35.25279999999999 38.0 37.0 38.0 30.0 38.0 115-119 34.95115 38.0 36.2 38.0 28.0 38.0 120-124 34.900099999999995 38.0 36.2 38.0 28.0 38.0 125-129 34.464999999999996 38.0 35.8 38.0 25.2 38.0 130-134 33.668549999999996 38.0 34.8 38.0 19.0 38.0 135-139 32.96855 38.0 33.0 38.0 15.4 38.0 140-144 32.43215 38.0 33.0 38.0 13.0 38.0 145-149 31.25625 38.0 32.2 38.0 6.2 38.0 150-151 26.279249999999998 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 8.0 4 5.0 5 2.0 6 2.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 7.0 13 3.0 14 11.0 15 6.0 16 5.0 17 8.0 18 4.0 19 9.0 20 8.0 21 13.0 22 18.0 23 16.0 24 19.0 25 28.0 26 19.0 27 24.0 28 38.0 29 44.0 30 52.0 31 62.0 32 75.0 33 114.0 34 136.0 35 270.0 36 612.0 37 2355.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.825 21.375 10.825 24.975 2 25.387693846923458 25.362681340670335 32.21610805402702 17.03351675837919 3 19.884942471235618 27.763881940970485 33.66683341670835 18.684342171085543 4 23.44258193645234 35.10132599449587 22.54190642982237 18.914185639229423 5 24.58729364682341 38.19409704852426 21.210605302651324 16.008004002001 6 18.775 37.824999999999996 23.625 19.775000000000002 7 18.525 19.55 41.625 20.3 8 21.75 23.799999999999997 28.625 25.825 9 20.3 25.75 29.7 24.25 10-14 23.53 29.049999999999997 26.495 20.925 15-19 23.05 28.615000000000002 27.76 20.575 20-24 23.52 28.715000000000003 27.12 20.645 25-29 22.99 27.92 28.425 20.665 30-34 22.775000000000002 27.99 28.525 20.71 35-39 23.29 27.52 28.660000000000004 20.53 40-44 23.400000000000002 27.955000000000002 27.99 20.655 45-49 22.69180754226268 27.62328698609583 28.903671101330396 20.781234370311093 50-54 22.705000000000002 28.125 27.92 21.25 55-59 22.81 28.084999999999997 28.155 20.95 60-64 23.04 27.57 28.205000000000002 21.185000000000002 65-69 22.99 28.375 27.725 20.91 70-74 23.285 27.485 28.26 20.97 75-79 22.770000000000003 27.515 28.68 21.035 80-84 23.595 27.79 27.83 20.785 85-89 22.915 27.24 28.744999999999997 21.099999999999998 90-94 23.919783956791356 27.030406081216242 28.075615123024605 20.974194838967794 95-99 23.94739473947395 28.06280628062806 27.97779777977798 20.01200120012001 100-104 23.455000000000002 28.499999999999996 27.79 20.255000000000003 105-109 23.735 27.705000000000002 28.025 20.535 110-114 23.75 27.474999999999998 28.075 20.7 115-119 24.275 27.810000000000002 27.915 20.0 120-124 23.995 27.644999999999996 28.134999999999998 20.225 125-129 24.48 27.884999999999998 27.58 20.055 130-134 25.45 27.375 27.229999999999997 19.945 135-139 24.834999999999997 27.810000000000002 27.68 19.675 140-144 25.83 27.355 26.71 20.105 145-149 25.424999999999997 28.26 26.555 19.759999999999998 150-151 26.5 28.1 26.637499999999996 18.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 2.0 23 2.5 24 2.0 25 3.0 26 8.0 27 11.0 28 10.5 29 11.5 30 16.5 31 26.0 32 39.5 33 45.0 34 54.0 35 66.0 36 79.0 37 107.5 38 141.0 39 174.5 40 197.5 41 221.5 42 249.5 43 264.0 44 251.5 45 257.5 46 260.0 47 241.5 48 211.0 49 186.0 50 179.5 51 140.0 52 111.0 53 98.5 54 84.5 55 64.0 56 45.5 57 38.0 58 27.0 59 19.5 60 14.5 61 10.5 62 9.0 63 6.5 64 3.5 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.075 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.02 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21638018200201 98.125 2 0.5561172901921132 1.0999999999999999 3 0.1263902932254803 0.375 4 0.10111223458038424 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.8875 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.6 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 3.2125000000000004 0.0 0.0 0.0 0.0 116-117 3.5625 0.0 0.0 0.0 0.0 118-119 4.15 0.0 0.0 0.0 0.0 120-121 4.7125 0.0 0.0 0.0 0.0 122-123 5.1375 0.0 0.0 0.0 0.0 124-125 5.625 0.0 0.0 0.0 0.0 126-127 6.2125 0.0 0.0 0.0 0.0 128-129 6.575 0.0 0.0 0.0 0.0 130-131 7.1625 0.0 0.0 0.0 0.0 132-133 7.8125 0.0 0.0 0.0 0.0 134-135 8.45 0.0 0.0 0.0 0.0 136-137 9.1375 0.0 0.0 0.0 0.0 138-139 9.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 30 0.0014437955 24.166668 105-109 >>END_MODULE Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799161 spots for SRR7172472.sra Written 799161 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra Read 799154 spots for SRR7172472.sra Written 799154 spots for SRR7172472.sra SRR ids: ['SRR7172472.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_shxlde9e SRR7172472.sra spots: 15983087 blocks: [[1, 799154], [799155, 1598308], [1598309, 2397462], [2397463, 3196616], [3196617, 3995770], [3995771, 4794924], [4794925, 5594078], [5594079, 6393232], [6393233, 7192386], [7192387, 7991540], [7991541, 8790694], [8790695, 9589848], [9589849, 10389002], [10389003, 11188156], [11188157, 11987310], [11987311, 12786464], [12786465, 13585618], [13585619, 14384772], [14384773, 15183926], [15183927, 15983087]] SRR7172472 file size 5394443 SRR7172472 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172472 SRR7172472_1.fastq SRR7172472_2.fastq Input file: SRR7172472_1.fastq Paired file: SRR7172472_2.fastq trimmed: SRR7172472-trimmed-pair1.fastq, SRR7172472-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:48:03 2025 >> started Mon Feb 10 10:48:22 2025 >> done (18.873s) 15983087 read pairs processed; of these: 25498 ( 0.16%) short read pairs filtered out after trimming by size control 75186 ( 0.47%) empty read pairs filtered out after trimming by size control 15882403 (99.37%) read pairs available; of these: 8482554 (53.41%) trimmed read pairs available after processing 7399849 (46.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 5 0.00% 21 7 0.00% 22 5 0.00% 23 7 0.00% 24 6 0.00% 25 13 0.00% 26 20 0.00% 27 13 0.00% 28 16 0.00% 29 13 0.00% 30 18 0.00% 31 12 0.00% 32 16 0.00% 33 13 0.00% 34 17 0.00% 35 16 0.00% 36 21 0.00% 37 26 0.00% 38 26 0.00% 39 31 0.00% 40 44 0.00% 41 31 0.00% 42 49 0.00% 43 58 0.00% 44 42 0.00% 45 59 0.00% 46 59 0.00% 47 57 0.00% 48 77 0.00% 49 112 0.00% 50 103 0.00% 51 125 0.00% 52 145 0.00% 53 146 0.00% 54 151 0.00% 55 210 0.00% 56 235 0.00% 57 215 0.00% 58 271 0.00% 59 304 0.00% 60 341 0.00% 61 434 0.00% 62 478 0.00% 63 517 0.00% 64 500 0.00% 65 587 0.00% 66 690 0.00% 67 786 0.00% 68 915 0.01% 69 1067 0.01% 70 1209 0.01% 71 1295 0.01% 72 1465 0.01% 73 1683 0.01% 74 1856 0.01% 75 2112 0.01% 76 2335 0.01% 77 2641 0.02% 78 2820 0.02% 79 3236 0.02% 80 3549 0.02% 81 4074 0.03% 82 4597 0.03% 83 5349 0.03% 84 6929 0.04% 85 7648 0.05% 86 8337 0.05% 87 8822 0.06% 88 9508 0.06% 89 9867 0.06% 90 10703 0.07% 91 11667 0.07% 92 12881 0.08% 93 13824 0.09% 94 14827 0.09% 95 15966 0.10% 96 16335 0.10% 97 17364 0.11% 98 17835 0.11% 99 19294 0.12% 100 20237 0.13% 101 21545 0.14% 102 23176 0.15% 103 24119 0.15% 104 25437 0.16% 105 26806 0.17% 106 27697 0.17% 107 28628 0.18% 108 30040 0.19% 109 31437 0.20% 110 32726 0.21% 111 33654 0.21% 112 35557 0.22% 113 37330 0.24% 114 38990 0.25% 115 41117 0.26% 116 42556 0.27% 117 43678 0.28% 118 44788 0.28% 119 46107 0.29% 120 48139 0.30% 121 49222 0.31% 122 50979 0.32% 123 53716 0.34% 124 55601 0.35% 125 57760 0.36% 126 60129 0.38% 127 61617 0.39% 128 63791 0.40% 129 65975 0.42% 130 68078 0.43% 131 70036 0.44% 132 72130 0.45% 133 75975 0.48% 134 79010 0.50% 135 83312 0.52% 136 86638 0.55% 137 91293 0.57% 138 96717 0.61% 139 101603 0.64% 140 106701 0.67% 141 115176 0.73% 142 124069 0.78% 143 137561 0.87% 144 157410 0.99% 145 185734 1.17% 146 221784 1.40% 147 293526 1.85% 148 425038 2.68% 149 806705 5.08% 150 3612359 22.74% 151 7399849 46.59% 15882403 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=18 prefix-density=0.49 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=38.45 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.8 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=14 prefix-density=0.66 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=13.22 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.6 sequence=CCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7172472 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:49:06 Started mapping on | Feb 10 10:49:06 Finished on | Feb 10 10:50:59 Mapping speed, Million of reads per hour | 505.99 Number of input reads | 15882403 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14956058 Uniquely mapped reads % | 94.17% Average mapped length | 290.69 Number of splices: Total | 13980041 Number of splices: Annotated (sjdb) | 13660638 Number of splices: GT/AG | 13701978 Number of splices: GC/AG | 225673 Number of splices: AT/AC | 8308 Number of splices: Non-canonical | 44082 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372964 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 43404 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 574070 574070 574070 N_multimapping 372964 372964 372964 N_noFeature 699192 14662777 834228 N_ambiguous 249497 1242 90439 UnstrandedReadsAssigned:14007369 PositiveStrandReadsAssigned:292039 NegativeStrandReadsAssigned:14031391 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7172472 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172472-trimmed-pair1.fastq SRR7172472-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,882,403 reads, 13,993,392 reads pseudoaligned [quant] estimated average fragment length: 228.713 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR7172472.ke.tsv 34699 SRR7172472.se.tsv 87100 total ==> SRR7172472.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.29 489 17.4595 Potri.005G024800.1.v4.1 1035 807.287 192 15.2026 Potri.004G059700.1.v4.1 961 733.313 9 0.784509 Potri.007G009000.2.v4.1 1416 1188.29 0 0 Potri.003G141000.2.v4.1 2943 2715.29 1005 23.6589 Potri.016G087400.1.v4.1 270 89.7845 721 513.309 Potri.015G069301.1.v4.1 564 341.586 0 0 Potri.010G195200.1.v4.1 1773 1545.29 17 0.703209 Potri.012G127500.1.v4.1 977 749.297 162 13.8199 ==> SRR7172472.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 822 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR7172472 completed mapping pipeline successfully