Starting /dee2/code/volunteer_pipeline.sh SRR7172473 current disk space = 3059027390464 free memory = 1473303596 SRR7172473 SRAfilesize 9e4b7940d6f6bc29b184b5a3a8dd7dda SRR7172473.sra SRR7172473.sra file validated SRR7172473 is paired end SRR7172473 is conventional basespace SRR7172473 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172473_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0505 34.0 33.0 34.0 33.0 34.0 2 33.39775 34.0 33.0 34.0 33.0 34.0 3 33.437 34.0 34.0 34.0 33.0 34.0 4 33.3935 34.0 34.0 34.0 33.0 34.0 5 33.29275 34.0 34.0 34.0 33.0 34.0 6 36.94075 38.0 37.0 38.0 35.0 38.0 7 37.29375 38.0 38.0 38.0 37.0 38.0 8 37.45525 38.0 38.0 38.0 37.0 38.0 9 37.396 38.0 38.0 38.0 37.0 38.0 10-14 37.45555 38.0 38.0 38.0 37.2 38.0 15-19 37.46185 38.0 38.0 38.0 37.4 38.0 20-24 37.487 38.0 38.0 38.0 38.0 38.0 25-29 37.4812 38.0 38.0 38.0 37.8 38.0 30-34 37.4535 38.0 38.0 38.0 37.2 38.0 35-39 37.34545 38.0 38.0 38.0 37.0 38.0 40-44 37.26095 38.0 38.0 38.0 36.8 38.0 45-49 37.156850000000006 38.0 38.0 38.0 36.4 38.0 50-54 37.04350000000001 38.0 38.0 38.0 36.0 38.0 55-59 37.03395 38.0 38.0 38.0 36.0 38.0 60-64 37.01809999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.981849999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.8171 38.0 38.0 38.0 35.2 38.0 75-79 36.75485 38.0 38.0 38.0 35.0 38.0 80-84 36.63175 38.0 38.0 38.0 34.4 38.0 85-89 36.575900000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.421749999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.2595 38.0 38.0 38.0 34.0 38.0 100-104 36.2118 38.0 37.8 38.0 33.8 38.0 105-109 36.03359999999999 38.0 37.0 38.0 32.6 38.0 110-114 35.80095 38.0 37.0 38.0 31.8 38.0 115-119 35.6776 38.0 36.6 38.0 31.0 38.0 120-124 35.5104 38.0 36.4 38.0 30.4 38.0 125-129 35.17265 38.0 36.0 38.0 28.8 38.0 130-134 34.74435 38.0 35.4 38.0 27.0 38.0 135-139 34.260999999999996 38.0 35.0 38.0 24.8 38.0 140-144 33.77455 38.0 34.6 38.0 22.2 38.0 145-149 32.995799999999996 38.0 33.2 38.0 16.6 38.0 150-151 28.49625 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 3.0 14 2.0 15 1.0 16 2.0 17 1.0 18 3.0 19 4.0 20 3.0 21 4.0 22 5.0 23 16.0 24 10.0 25 13.0 26 24.0 27 27.0 28 37.0 29 39.0 30 44.0 31 62.0 32 72.0 33 106.0 34 183.0 35 286.0 36 695.0 37 2355.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.19473950429944 15.250379362670714 8.295397066262012 31.25948406676783 2 20.575 18.675 34.849999999999994 25.900000000000002 3 18.175 25.2 27.3 29.325000000000003 4 21.975 33.225 23.474999999999998 21.325 5 21.272863943873716 36.48208469055375 23.527937860185418 18.717113505387122 6 17.575 36.1 25.525 20.8 7 14.774999999999999 23.549999999999997 42.275 19.400000000000002 8 16.3 23.400000000000002 33.15 27.150000000000002 9 17.299999999999997 23.7 32.574999999999996 26.424999999999997 10-14 20.015 29.435 26.645000000000003 23.905 15-19 20.105 28.499999999999996 27.845 23.549999999999997 20-24 20.365 29.065 27.139999999999997 23.43 25-29 20.43 28.835 27.834999999999997 22.900000000000002 30-34 19.900000000000002 29.04 27.325 23.735 35-39 19.744999999999997 28.685 27.71 23.86 40-44 20.32 29.310000000000002 27.32 23.05 45-49 20.25 28.065 27.54 24.145 50-54 20.056002800140007 28.63143157157858 27.901395069753487 23.411170558527928 55-59 19.877951180472188 29.051620648259302 27.29591836734694 23.774509803921568 60-64 20.415207603801903 28.91445722861431 27.368684342171086 23.301650825412707 65-69 20.324145865639537 28.64789155119804 27.172227502376067 23.855735080786353 70-74 19.639819909954976 28.0040020010005 28.30915457728864 24.047023511755878 75-79 19.844922461230617 28.329164582291146 28.134067033516757 23.69184592296148 80-84 20.118047218887554 28.766506602641055 27.526010404161667 23.589435774309724 85-89 20.040010002500626 28.637159289822456 27.631907976994246 23.69092273068267 90-94 20.25803870580587 28.22423363504526 28.27924188628294 23.23848577286593 95-99 20.62809421413212 28.45926889033355 27.799169875481322 23.113467020053008 100-104 20.080120180270406 28.5728592889334 27.621432148222336 23.72558838257386 105-109 20.40520260130065 28.46423211605803 27.80390195097549 23.326663331665834 110-114 20.172275641025642 28.41546474358974 27.28866185897436 24.123597756410255 115-119 20.818327330932373 28.431372549019606 27.100840336134453 23.649459783913564 120-124 20.275000000000002 28.744999999999997 27.625 23.355 125-129 21.151057552877646 28.066403320166007 27.336366818340917 23.44617230861543 130-134 21.45259248105205 28.193545148822967 27.164583647041106 23.189278723083874 135-139 21.146592909228062 28.388232335931608 26.904702036711086 23.560472718129244 140-144 21.076076076076074 27.72272272272272 27.167167167167168 24.034034034034036 145-149 20.810000000000002 28.605000000000004 27.07 23.515 150-151 20.4625 28.349999999999998 26.7125 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 2.0 23 3.0 24 4.0 25 4.0 26 4.0 27 7.0 28 11.0 29 12.5 30 16.0 31 23.0 32 34.5 33 52.0 34 71.5 35 80.5 36 88.0 37 130.5 38 164.0 39 171.5 40 184.5 41 211.0 42 232.5 43 251.0 44 248.5 45 231.5 46 232.0 47 240.5 48 228.5 49 203.5 50 189.5 51 146.5 52 113.5 53 102.0 54 79.5 55 59.5 56 48.0 57 33.0 58 19.5 59 18.0 60 15.5 61 10.0 62 6.5 63 3.0 64 1.5 65 0.5 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.04 60-64 0.05 65-69 0.045 70-74 0.05 75-79 0.05 80-84 0.04 85-89 0.025 90-94 0.015 95-99 0.015 100-104 0.15 105-109 0.05 110-114 0.16 115-119 0.04 120-124 0.0 125-129 0.005 130-134 0.385 135-139 0.575 140-144 0.1 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24357034795764 98.4 2 0.680786686838124 1.35 3 0.05042864346949068 0.15 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.5125 0.0 0.0 0.0 0.0 116-117 2.8375 0.0 0.0 0.0 0.0 118-119 3.3 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 4.0 0.0 0.0 0.0 0.0 124-125 4.5375 0.0 0.0 0.0 0.0 126-127 5.025 0.0 0.0 0.0 0.0 128-129 5.574999999999999 0.0 0.0 0.0 0.0 130-131 5.949999999999999 0.0 0.0 0.0 0.0 132-133 6.5625 0.0 0.0 0.0 0.0 134-135 7.0875 0.0 0.0 0.0 0.0 136-137 7.4125 0.0 0.0 0.0 0.0 138-139 8.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCTCC 25 8.7132835E-4 87.0 5 >>END_MODULE SRR7172473 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172473_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5595 33.0 33.0 34.0 32.0 34.0 2 32.67475 33.0 33.0 34.0 32.0 34.0 3 32.70825 34.0 33.0 34.0 32.0 34.0 4 32.59 34.0 33.0 34.0 32.0 34.0 5 32.561 34.0 33.0 34.0 32.0 34.0 6 36.6105 38.0 38.0 38.0 36.0 38.0 7 36.77125 38.0 38.0 38.0 36.0 38.0 8 36.70875 38.0 38.0 38.0 36.0 38.0 9 36.7 38.0 38.0 38.0 36.0 38.0 10-14 36.75685 38.0 38.0 38.0 36.0 38.0 15-19 36.7387 38.0 38.0 38.0 36.0 38.0 20-24 36.7369 38.0 38.0 38.0 36.2 38.0 25-29 36.71545 38.0 38.0 38.0 36.2 38.0 30-34 36.63825 38.0 38.0 38.0 36.0 38.0 35-39 36.5715 38.0 38.0 38.0 36.0 38.0 40-44 36.502050000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.55715 38.0 38.0 38.0 35.8 38.0 50-54 36.5452 38.0 38.0 38.0 36.0 38.0 55-59 36.52025 38.0 38.0 38.0 36.0 38.0 60-64 36.4224 38.0 38.0 38.0 35.2 38.0 65-69 36.38185 38.0 38.0 38.0 35.2 38.0 70-74 36.287 38.0 38.0 38.0 34.8 38.0 75-79 36.2073 38.0 38.0 38.0 34.2 38.0 80-84 36.09655 38.0 38.0 38.0 34.0 38.0 85-89 36.00375 38.0 38.0 38.0 34.0 38.0 90-94 35.83045 38.0 38.0 38.0 33.0 38.0 95-99 35.7471 38.0 38.0 38.0 33.0 38.0 100-104 35.609 38.0 37.8 38.0 32.0 38.0 105-109 35.47945 38.0 37.8 38.0 31.0 38.0 110-114 35.22705 38.0 37.0 38.0 29.8 38.0 115-119 35.00425 38.0 36.8 38.0 28.6 38.0 120-124 34.7251 38.0 36.0 38.0 27.4 38.0 125-129 34.4644 38.0 36.0 38.0 25.4 38.0 130-134 34.02405 38.0 35.0 38.0 22.6 38.0 135-139 33.55765 38.0 33.8 38.0 19.8 38.0 140-144 32.847350000000006 38.0 33.2 38.0 13.6 38.0 145-149 32.0057 38.0 32.4 38.0 8.6 38.0 150-151 27.410375000000002 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 10.0 4 4.0 5 2.0 6 7.0 7 2.0 8 2.0 9 4.0 10 0.0 11 7.0 12 5.0 13 4.0 14 4.0 15 6.0 16 5.0 17 6.0 18 7.0 19 9.0 20 8.0 21 13.0 22 11.0 23 13.0 24 18.0 25 16.0 26 19.0 27 24.0 28 36.0 29 54.0 30 55.0 31 57.0 32 73.0 33 87.0 34 162.0 35 242.0 36 561.0 37 2441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.83967935871743 21.59318637274549 11.047094188376754 22.52004008016032 2 25.739348370927317 25.46365914786967 31.654135338345863 17.142857142857142 3 19.9899673940306 28.36719337848006 33.107599699021826 18.53523952846752 4 24.70529219964886 34.33659393027339 22.648607975921745 18.309505894156004 5 24.103335841484828 38.39979934788062 20.59192375219463 16.904941058439928 6 18.18866031108881 38.7606623181134 23.98394380331159 19.066733567486203 7 19.49322629202208 19.242348218765677 41.244355243351734 20.02007024586051 8 21.224284997491218 24.611138986452584 27.395885599598596 26.768690416457602 9 21.24937280481686 25.33868539889614 30.055193176116408 23.3567486201706 10-14 23.366783743100854 28.58003010536879 26.578023080782742 21.475163070747616 15-19 22.734570998494732 28.253888610135476 28.078273958856 20.933266432513797 20-24 22.453587556447566 28.273958855995986 28.449573507275467 20.822880080280985 25-29 22.865027596588057 28.444555945810336 28.173607626693425 20.51680883090818 30-34 23.024434298329236 27.83603431839847 28.257488334754903 20.882043048517385 35-39 22.57789373338016 28.071847875169336 28.553509608148108 20.796748783302395 40-44 23.53354408148929 27.61804405640022 27.974308796226605 20.874103065883887 45-49 23.158370132476914 27.549177037334406 28.306904857486952 20.985547972701728 50-54 22.66546239148979 27.68327562848111 28.656731396457424 20.99453058357168 55-59 23.677872553938787 27.732062217762167 27.71700953336678 20.873055694932262 60-64 23.231309583542398 27.77220270948319 27.802308078273956 21.194179628700454 65-69 23.27646763672855 27.175112895132962 28.103361766181635 21.44505770195685 70-74 23.39806312409052 27.788649706457925 28.06964724772944 20.743639921722114 75-79 22.955343702960363 27.52634219769192 28.334169593577524 21.184144505770195 80-84 23.227457474032818 27.959255356515634 27.527723418134375 21.285563751317177 85-89 23.49959855479727 28.6029706945002 26.76134082697712 21.13608992372541 90-94 22.864599016360536 27.893204857974506 28.455284552845526 20.786911572819434 95-99 23.045267489711936 27.41142226237077 28.26959751078992 21.27371273712737 100-104 23.28148519819368 27.71700953336678 27.987957852483692 21.01354741595585 105-109 23.69292523833417 27.45609633718013 28.40441545408931 20.446562970396386 110-114 23.32664325137983 28.26392373306573 28.078273958856 20.331159056698446 115-119 23.707977922729555 28.048168590065224 27.937782237832415 20.306071249372803 120-124 24.475664826894132 27.72704465629704 27.255393878575013 20.54189663823382 125-129 23.923733065730055 28.11339688911189 27.742097340692425 20.22077270446563 130-134 24.824402970098333 27.252659040738507 28.030303030303028 19.892634958860125 135-139 24.88460766606462 27.468392534617703 27.513546056592414 20.133453742725266 140-144 24.71774800541924 28.124843193336346 27.11626273270109 20.041146068543327 145-149 25.308641975308642 28.04878048780488 26.99488105992171 19.647696476964768 150-151 25.99749058971142 26.70012547051443 27.99247176913425 19.3099121706399 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 6.0 2 2.5 3 1.0 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.5 12 1.0 13 1.0 14 2.0 15 1.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 0.0 24 3.5 25 8.0 26 8.0 27 7.5 28 9.5 29 12.0 30 12.0 31 20.5 32 32.0 33 38.5 34 50.0 35 55.0 36 76.5 37 118.5 38 144.0 39 165.5 40 184.5 41 214.5 42 248.0 43 261.5 44 265.0 45 264.0 46 266.0 47 255.5 48 224.0 49 189.5 50 167.0 51 131.5 52 105.5 53 100.5 54 81.5 55 64.5 56 55.0 57 41.0 58 25.0 59 20.0 60 21.0 61 12.0 62 5.0 63 4.5 64 2.0 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.25 3 0.325 4 0.325 5 0.325 6 0.35000000000000003 7 0.35000000000000003 8 0.35000000000000003 9 0.35000000000000003 10-14 0.35000000000000003 15-19 0.35000000000000003 20-24 0.35000000000000003 25-29 0.35000000000000003 30-34 0.345 35-39 0.345 40-44 0.35500000000000004 45-49 0.36 50-54 0.35500000000000004 55-59 0.35000000000000003 60-64 0.35000000000000003 65-69 0.35000000000000003 70-74 0.35500000000000004 75-79 0.35000000000000003 80-84 0.35500000000000004 85-89 0.36 90-94 0.37 95-99 0.37 100-104 0.35000000000000003 105-109 0.35000000000000003 110-114 0.35000000000000003 115-119 0.35000000000000003 120-124 0.35000000000000003 125-129 0.35000000000000003 130-134 0.33999999999999997 135-139 0.33999999999999997 140-144 0.35500000000000004 145-149 0.37 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14076320444781 98.075 2 0.7834217841799342 1.55 3 0.025271670457417232 0.075 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025271670457417232 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.1125 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.65 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.550000000000001 0.0 0.0 0.0 0.0 126-127 5.025 0.0 0.0 0.0 0.0 128-129 5.5625 0.0 0.0 0.0 0.0 130-131 5.975 0.0 0.0 0.0 0.0 132-133 6.525 0.0 0.0 0.0 0.0 134-135 7.05 0.0 0.0 0.0 0.0 136-137 7.4 0.0 0.0 0.0 0.0 138-139 7.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATAC 10 0.006830828 145.0 7 CACATTC 10 0.006830828 145.0 3 AACCTCT 10 0.006830828 145.0 145 ACACATT 10 0.006830828 145.0 2 CATACTC 10 0.006830828 145.0 9 ATTCATA 10 0.006830828 145.0 6 TCATACT 10 0.006830828 145.0 8 AACACAT 10 0.006830828 145.0 1 >>END_MODULE Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711404 spots for SRR7172473.sra Written 711404 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra Read 711390 spots for SRR7172473.sra Written 711390 spots for SRR7172473.sra SRR ids: ['SRR7172473.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_44j2vhp6 SRR7172473.sra spots: 14227814 blocks: [[1, 711390], [711391, 1422780], [1422781, 2134170], [2134171, 2845560], [2845561, 3556950], [3556951, 4268340], [4268341, 4979730], [4979731, 5691120], [5691121, 6402510], [6402511, 7113900], [7113901, 7825290], [7825291, 8536680], [8536681, 9248070], [9248071, 9959460], [9959461, 10670850], [10670851, 11382240], [11382241, 12093630], [12093631, 12805020], [12805021, 13516410], [13516411, 14227814]] SRR7172473 file size 4799638 SRR7172473 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172473 SRR7172473_1.fastq SRR7172473_2.fastq Input file: SRR7172473_1.fastq Paired file: SRR7172473_2.fastq trimmed: SRR7172473-trimmed-pair1.fastq, SRR7172473-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:50:32 2025 >> started Mon Feb 10 10:50:55 2025 >> done (23.185s) 14227814 read pairs processed; of these: 30812 ( 0.22%) short read pairs filtered out after trimming by size control 72878 ( 0.51%) empty read pairs filtered out after trimming by size control 14124124 (99.27%) read pairs available; of these: 7213667 (51.07%) trimmed read pairs available after processing 6910457 (48.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 6 0.00% 21 5 0.00% 22 14 0.00% 23 8 0.00% 24 10 0.00% 25 6 0.00% 26 4 0.00% 27 11 0.00% 28 14 0.00% 29 17 0.00% 30 14 0.00% 31 11 0.00% 32 11 0.00% 33 18 0.00% 34 17 0.00% 35 25 0.00% 36 12 0.00% 37 40 0.00% 38 22 0.00% 39 37 0.00% 40 26 0.00% 41 30 0.00% 42 44 0.00% 43 44 0.00% 44 39 0.00% 45 120 0.00% 46 100 0.00% 47 99 0.00% 48 76 0.00% 49 78 0.00% 50 86 0.00% 51 130 0.00% 52 128 0.00% 53 130 0.00% 54 141 0.00% 55 142 0.00% 56 163 0.00% 57 217 0.00% 58 251 0.00% 59 275 0.00% 60 328 0.00% 61 416 0.00% 62 445 0.00% 63 456 0.00% 64 544 0.00% 65 627 0.00% 66 672 0.00% 67 863 0.01% 68 958 0.01% 69 1418 0.01% 70 1589 0.01% 71 1331 0.01% 72 1524 0.01% 73 1715 0.01% 74 1829 0.01% 75 1998 0.01% 76 2237 0.02% 77 2450 0.02% 78 2631 0.02% 79 3005 0.02% 80 3308 0.02% 81 3828 0.03% 82 4224 0.03% 83 4932 0.03% 84 6404 0.05% 85 7306 0.05% 86 7750 0.05% 87 8105 0.06% 88 8336 0.06% 89 8753 0.06% 90 9383 0.07% 91 10172 0.07% 92 10971 0.08% 93 12158 0.09% 94 12558 0.09% 95 12896 0.09% 96 13456 0.10% 97 14066 0.10% 98 14241 0.10% 99 15070 0.11% 100 15924 0.11% 101 16628 0.12% 102 17584 0.12% 103 18684 0.13% 104 19465 0.14% 105 20557 0.15% 106 21425 0.15% 107 21695 0.15% 108 22738 0.16% 109 23700 0.17% 110 24485 0.17% 111 25730 0.18% 112 26718 0.19% 113 28138 0.20% 114 29258 0.21% 115 30238 0.21% 116 31763 0.22% 117 32662 0.23% 118 33674 0.24% 119 33942 0.24% 120 35369 0.25% 121 36820 0.26% 122 38192 0.27% 123 40239 0.28% 124 41717 0.30% 125 43331 0.31% 126 44945 0.32% 127 46510 0.33% 128 48102 0.34% 129 49864 0.35% 130 51639 0.37% 131 52875 0.37% 132 55135 0.39% 133 58370 0.41% 134 61314 0.43% 135 64915 0.46% 136 67660 0.48% 137 72303 0.51% 138 75857 0.54% 139 80661 0.57% 140 85713 0.61% 141 92444 0.65% 142 100306 0.71% 143 111316 0.79% 144 127054 0.90% 145 150050 1.06% 146 181513 1.29% 147 240649 1.70% 148 362261 2.56% 149 716250 5.07% 150 3267700 23.14% 151 6910457 48.93% 14124124 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=21 prefix-density=0.66 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=47.55 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.8 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=22 prefix-density=0.75 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=43.55 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.1 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7172473 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:51:39 Started mapping on | Feb 10 10:51:39 Finished on | Feb 10 10:53:38 Mapping speed, Million of reads per hour | 427.28 Number of input reads | 14124124 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12997876 Uniquely mapped reads % | 92.03% Average mapped length | 291.61 Number of splices: Total | 12128847 Number of splices: Annotated (sjdb) | 11846341 Number of splices: GT/AG | 11889881 Number of splices: GC/AG | 187420 Number of splices: AT/AC | 6933 Number of splices: Non-canonical | 44613 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433340 % of reads mapped to multiple loci | 3.07% Number of reads mapped to too many loci | 39301 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.53% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718151 718151 718151 N_multimapping 433340 433340 433340 N_noFeature 482263 12717704 608529 N_ambiguous 251631 1154 96999 UnstrandedReadsAssigned:12263982 PositiveStrandReadsAssigned:279018 NegativeStrandReadsAssigned:12292348 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172473 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172473-trimmed-pair1.fastq SRR7172473-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,124,124 reads, 12,275,638 reads pseudoaligned [quant] estimated average fragment length: 238.546 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7172473.ke.tsv 34699 SRR7172473.se.tsv 87100 total ==> SRR7172473.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.45 973 37.2238 Potri.005G024800.1.v4.1 1035 797.454 234 19.9871 Potri.004G059700.1.v4.1 961 723.525 2 0.188285 Potri.007G009000.2.v4.1 1416 1178.45 0 0 Potri.003G141000.2.v4.1 2943 2705.45 790.501 19.9022 Potri.016G087400.1.v4.1 270 85.7564 716 568.703 Potri.015G069301.1.v4.1 564 333.533 0 0 Potri.010G195200.1.v4.1 1773 1535.45 622.845 27.6301 Potri.012G127500.1.v4.1 977 739.5 170 15.6585 ==> SRR7172473.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 451 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 81 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 34 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7172473 completed mapping pipeline successfully