Starting /dee2/code/volunteer_pipeline.sh SRR7172474 current disk space = 3059259527168 free memory = 1433568940 SRR7172474 SRAfilesize 0d90c8c0189a058f21d49534415e8359 SRR7172474.sra SRR7172474.sra file validated SRR7172474 is paired end SRR7172474 is conventional basespace SRR7172474 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172474_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8405 34.0 34.0 34.0 33.0 34.0 2 33.50525 34.0 34.0 34.0 33.0 34.0 3 33.53725 34.0 34.0 34.0 33.0 34.0 4 33.64 34.0 34.0 34.0 33.0 34.0 5 33.6635 34.0 34.0 34.0 33.0 34.0 6 37.46325 38.0 38.0 38.0 37.0 38.0 7 37.60975 38.0 38.0 38.0 38.0 38.0 8 37.6595 38.0 38.0 38.0 38.0 38.0 9 37.658 38.0 38.0 38.0 38.0 38.0 10-14 37.6268 38.0 38.0 38.0 38.0 38.0 15-19 37.65065 38.0 38.0 38.0 38.0 38.0 20-24 37.66345 38.0 38.0 38.0 38.0 38.0 25-29 37.62045 38.0 38.0 38.0 38.0 38.0 30-34 37.5849 38.0 38.0 38.0 38.0 38.0 35-39 37.43955 38.0 38.0 38.0 37.6 38.0 40-44 37.2202 38.0 38.0 38.0 37.0 38.0 45-49 37.124050000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.032 38.0 38.0 38.0 36.0 38.0 55-59 37.028949999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.93465 38.0 38.0 38.0 36.0 38.0 65-69 36.863150000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.764599999999994 38.0 38.0 38.0 35.4 38.0 75-79 36.413349999999994 38.0 38.0 38.0 34.0 38.0 80-84 36.33925000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.16125 38.0 38.0 38.0 33.8 38.0 90-94 36.1514 38.0 38.0 38.0 34.0 38.0 95-99 35.9283 38.0 37.6 38.0 33.2 38.0 100-104 35.606399999999994 38.0 37.0 38.0 31.4 38.0 105-109 35.447700000000005 38.0 37.0 38.0 30.6 38.0 110-114 35.125550000000004 38.0 36.4 38.0 28.6 38.0 115-119 35.00675 38.0 36.0 38.0 28.4 38.0 120-124 34.851800000000004 38.0 36.0 38.0 28.2 38.0 125-129 34.37435000000001 38.0 35.2 38.0 24.6 38.0 130-134 33.906800000000004 38.0 33.8 38.0 22.8 38.0 135-139 33.2752 38.0 33.0 38.0 18.6 38.0 140-144 32.366 38.0 32.6 38.0 13.8 38.0 145-149 31.42955 38.0 31.4 38.0 8.6 38.0 150-151 25.792625 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 3.0 12 6.0 13 4.0 14 3.0 15 5.0 16 6.0 17 3.0 18 14.0 19 19.0 20 9.0 21 7.0 22 9.0 23 10.0 24 21.0 25 21.0 26 29.0 27 29.0 28 26.0 29 34.0 30 39.0 31 54.0 32 63.0 33 104.0 34 170.0 35 326.0 36 835.0 37 2149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.16525532460867 15.29381575570952 9.545804464973056 26.99512445470875 2 22.650000000000002 16.575 33.575 27.200000000000003 3 19.375 25.025 28.325 27.275 4 22.2 30.349999999999998 25.374999999999996 22.075 5 23.0 34.725 23.65 18.625 6 18.275 34.975 26.5 20.25 7 14.625 24.075 41.85 19.45 8 15.85 24.825 32.925 26.400000000000002 9 16.5 23.45 33.5 26.55 10-14 19.646964696469645 29.982998299829983 26.43764376437644 23.932393239323932 15-19 19.625 28.67 28.29 23.415 20-24 19.925 28.449999999999996 27.439999999999998 24.185000000000002 25-29 19.89 28.865000000000002 27.884999999999998 23.36 30-34 19.615 29.505 27.555000000000003 23.325000000000003 35-39 19.61892378475695 29.43088617723545 27.340468093618725 23.609721944388877 40-44 20.246196957566053 28.813050440352285 27.562049639711773 23.378702962369896 45-49 19.943960772540777 28.710097067947565 27.639347543280294 23.70659461623136 50-54 19.913896676011213 28.594313175810974 27.65818982779335 23.833600320384463 55-59 19.662189254210105 28.66880513231756 27.691459502806737 23.9775461106656 60-64 20.154378226655307 28.374517568041703 27.662773795799712 23.808330409503284 65-69 19.6191430719118 28.16336757704836 28.00300676522175 24.21448258581809 70-74 19.572953736654807 28.986015738559473 27.95348604079996 23.487544483985765 75-79 19.858618269327184 28.958187105183995 27.18339516695077 23.99979945853805 80-84 19.763420379930828 28.56498421131773 27.49235627286853 24.179239135882913 85-89 20.572316327553374 28.68597774882229 27.382980855968732 23.35872506765561 90-94 20.219482862297053 27.866305872920428 28.367408298256162 23.546802966526357 95-99 20.18137181221504 28.778996943734658 27.346059421814722 23.693571822235583 100-104 20.595458874241892 28.945917497869782 26.935993183299082 23.522630444589243 105-109 20.893277858539275 28.698180359917792 27.159256103062813 23.249285678480124 110-114 21.367993175089076 29.081146183570027 26.396346665328448 23.154513976012446 115-119 20.874880994137396 28.636568622538455 26.70742095505336 23.78112942827078 120-124 20.86 29.37 26.334999999999997 23.435 125-129 20.599999999999998 28.58 27.169999999999998 23.65 130-134 20.985 28.854999999999997 26.784999999999997 23.375 135-139 20.599999999999998 28.96 26.400000000000002 24.04 140-144 20.830000000000002 28.849999999999998 26.11 24.21 145-149 20.585 28.945 26.405 24.065 150-151 20.5375 28.825 26.775 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 2.0 18 1.5 19 0.5 20 0.5 21 2.0 22 6.5 23 6.5 24 4.0 25 4.0 26 7.0 27 12.0 28 18.0 29 25.5 30 27.5 31 40.5 32 60.0 33 58.5 34 74.5 35 103.0 36 118.5 37 128.5 38 146.5 39 167.0 40 174.0 41 196.0 42 205.5 43 214.0 44 221.0 45 206.5 46 217.0 47 218.5 48 198.0 49 186.5 50 155.0 51 123.0 52 116.0 53 112.0 54 96.5 55 81.5 56 62.5 57 46.0 58 42.0 59 37.0 60 26.5 61 16.0 62 12.0 63 5.5 64 2.5 65 2.0 66 1.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.08 45-49 0.06999999999999999 50-54 0.12 55-59 0.24 60-64 0.245 65-69 0.22499999999999998 70-74 0.245 75-79 0.27 80-84 0.245 85-89 0.22999999999999998 90-94 0.22 95-99 0.20500000000000002 100-104 0.245 105-109 0.255 110-114 0.365 115-119 0.215 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.59406952965234 96.42500000000001 2 1.1247443762781186 2.1999999999999997 3 0.10224948875255625 0.3 4 0.15337423312883436 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025562372188139063 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATATAATCTCGTATGC 19 0.475 TruSeq Adapter, Index 9 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.175 0.0 0.0 0.0 0.0 92-93 1.5 0.0 0.0 0.0 0.0 94-95 1.8375 0.0 0.0 0.0 0.0 96-97 2.25 0.0 0.0 0.0 0.0 98-99 2.6125 0.0 0.0 0.0 0.0 100-101 3.0625 0.0 0.0 0.0 0.0 102-103 3.375 0.0 0.0 0.0 0.0 104-105 3.65 0.0 0.0 0.0 0.0 106-107 4.2 0.0 0.0 0.0 0.0 108-109 4.6625 0.0 0.0 0.0 0.0 110-111 5.0375 0.0 0.0 0.0 0.0 112-113 5.5375 0.0 0.0 0.0 0.0 114-115 6.225 0.0 0.0 0.0 0.0 116-117 6.8 0.0 0.0 0.0 0.0 118-119 7.2875 0.0 0.0 0.0 0.0 120-121 7.925 0.0 0.0 0.0 0.0 122-123 8.7375 0.0 0.0 0.0 0.0 124-125 9.575 0.0 0.0 0.0 0.0 126-127 10.524999999999999 0.0 0.0 0.0 0.0 128-129 11.1 0.0 0.0 0.0 0.0 130-131 11.850000000000001 0.0 0.0 0.0 0.0 132-133 12.587499999999999 0.0 0.0 0.0 0.0 134-135 13.5625 0.0 0.0 0.0 0.0 136-137 14.575 0.0 0.0 0.0 0.0 138-139 15.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTCAC 10 0.006832588 144.9875 2 >>END_MODULE SRR7172474 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172474_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80475 34.0 33.0 34.0 32.0 34.0 2 32.83375 34.0 33.0 34.0 32.0 34.0 3 32.86725 34.0 33.0 34.0 33.0 34.0 4 32.75225 34.0 33.0 34.0 33.0 34.0 5 32.816 34.0 33.0 34.0 33.0 34.0 6 36.97 38.0 38.0 38.0 37.0 38.0 7 36.9685 38.0 38.0 38.0 37.0 38.0 8 36.882 38.0 38.0 38.0 37.0 38.0 9 36.98725 38.0 38.0 38.0 37.0 38.0 10-14 36.9597 38.0 38.0 38.0 37.4 38.0 15-19 36.9242 38.0 38.0 38.0 38.0 38.0 20-24 36.883399999999995 38.0 38.0 38.0 37.4 38.0 25-29 36.8551 38.0 38.0 38.0 37.8 38.0 30-34 36.834799999999994 38.0 38.0 38.0 37.4 38.0 35-39 36.807399999999994 38.0 38.0 38.0 37.4 38.0 40-44 36.7829 38.0 38.0 38.0 37.2 38.0 45-49 36.74490000000001 38.0 38.0 38.0 37.0 38.0 50-54 36.754850000000005 38.0 38.0 38.0 37.2 38.0 55-59 36.704950000000004 38.0 38.0 38.0 37.0 38.0 60-64 36.66605 38.0 38.0 38.0 37.0 38.0 65-69 36.5943 38.0 38.0 38.0 37.0 38.0 70-74 36.4319 38.0 38.0 38.0 36.6 38.0 75-79 36.31565 38.0 38.0 38.0 36.0 38.0 80-84 36.28335 38.0 38.0 38.0 36.0 38.0 85-89 36.18615 38.0 38.0 38.0 35.8 38.0 90-94 36.133649999999996 38.0 38.0 38.0 35.0 38.0 95-99 35.95345 38.0 38.0 38.0 34.2 38.0 100-104 35.81105 38.0 38.0 38.0 34.0 38.0 105-109 35.69754999999999 38.0 38.0 38.0 33.4 38.0 110-114 35.59825 38.0 38.0 38.0 33.6 38.0 115-119 35.3949 38.0 38.0 38.0 31.8 38.0 120-124 35.1117 38.0 37.6 38.0 30.6 38.0 125-129 34.691599999999994 38.0 36.6 38.0 28.2 38.0 130-134 34.12785 38.0 36.0 38.0 24.2 38.0 135-139 33.4655 38.0 34.4 38.0 17.8 38.0 140-144 32.77025 38.0 33.2 38.0 12.8 38.0 145-149 31.4943 38.0 33.0 38.0 3.8 38.0 150-151 25.871375 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 42.0 3 11.0 4 4.0 5 1.0 6 3.0 7 3.0 8 2.0 9 2.0 10 2.0 11 4.0 12 3.0 13 4.0 14 6.0 15 0.0 16 1.0 17 24.0 18 7.0 19 8.0 20 9.0 21 11.0 22 9.0 23 20.0 24 13.0 25 11.0 26 15.0 27 19.0 28 25.0 29 28.0 30 36.0 31 30.0 32 64.0 33 71.0 34 125.0 35 200.0 36 526.0 37 2661.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.81440443213297 22.085117098967512 11.911357340720222 19.189121128179302 2 25.573192239858905 23.456790123456788 31.494079113126734 19.47593852355757 3 22.071050642479214 25.673973293020914 33.40891912320484 18.846056941295036 4 24.439405391786345 34.18997228521038 22.323003275384227 19.047619047619047 5 25.119677500629884 37.515747039556565 22.19702695893172 15.167548500881834 6 21.59033719174635 35.958731756416704 24.383492702566684 18.067438349270258 7 19.78353888749056 20.33727661716587 39.01334004530582 20.865844450037756 8 21.59033719174635 24.458983392048314 28.43482637141419 25.515853044791143 9 23.477604428787117 24.836436839456468 27.93155510820332 23.754403623553095 10-14 23.756544502617803 28.51892871526379 25.850785340314136 21.87374144180427 15-19 23.53474320241692 28.167170191339373 27.99093655589124 20.30715005035247 20-24 24.01188258395851 27.58672775791753 27.974422234529982 20.42696742359398 25-29 23.774287727776098 28.999295278365047 26.708949964763917 20.517467029094934 30-34 23.190375515956912 27.791201047015 28.500956407933153 20.517467029094934 35-39 23.688714386388803 27.378435517970402 28.526125037752948 20.406725057887847 40-44 23.891042747092293 27.435677961834752 28.266451840290014 20.40682745078294 45-49 23.37865055387714 28.353474320241688 27.739174219536757 20.52870090634441 50-54 23.52970795568983 28.429003021148034 27.764350453172206 20.27693856998993 55-59 22.739174219536757 27.608257804632423 28.86203423967774 20.790533736153073 60-64 23.26974379624503 28.192479991946445 27.92067247193839 20.617103739870135 65-69 23.45449053564237 27.985300040273863 28.24204591220298 20.31816351188079 70-74 23.950256771724902 27.07683012788239 28.229785520088612 20.743127580304098 75-79 23.36858006042296 27.542799597180263 27.94058408862034 21.148036253776432 80-84 23.34340382678751 28.353474320241688 28.036253776435043 20.26686807653575 85-89 23.751258811681772 28.26283987915408 28.08157099697885 19.904330312185298 90-94 23.727277305000253 27.75064202628531 28.098091545395036 20.4239891233194 95-99 24.028197381671703 28.08157099697885 27.754279959718026 20.13595166163142 100-104 24.358199939595288 28.269405013591058 27.28279472465519 20.089600322158464 105-109 24.56696878147029 28.147029204431018 27.467270896273916 19.818731117824772 110-114 25.161127895266866 27.814702920443104 26.782477341389725 20.241691842900302 115-119 24.745745644950155 28.849058503675362 27.142281744033838 19.262914107340652 120-124 25.52227535867103 28.718852252705762 26.816008054366975 18.942864334256228 125-129 25.50835514395007 27.914233944030602 27.28004831890477 19.297362593114556 130-134 25.465525918470057 28.500251635631606 26.57775541016608 19.45646703573226 135-139 26.114745848012078 27.684952189229996 26.728736789129343 19.471565173628587 140-144 26.291410734065053 28.083778068673848 26.533078239855 19.0917329574061 145-149 26.253776435045317 28.600201409869086 25.9214501510574 19.224572004028197 150-151 27.341389728096676 28.6631419939577 26.17069486404834 17.82477341389728 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 26.0 1 13.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 1.5 16 0.0 17 0.5 18 2.0 19 3.0 20 2.5 21 4.0 22 5.0 23 3.5 24 5.0 25 6.0 26 5.5 27 9.5 28 15.0 29 15.5 30 20.0 31 27.0 32 41.0 33 59.0 34 67.5 35 82.0 36 92.5 37 106.0 38 135.0 39 163.0 40 180.0 41 187.5 42 213.0 43 238.5 44 240.0 45 227.0 46 227.0 47 215.0 48 199.0 49 190.0 50 165.5 51 134.0 52 124.0 53 122.0 54 99.0 55 78.5 56 62.0 57 52.5 58 39.5 59 27.0 60 19.5 61 18.5 62 16.5 63 9.5 64 4.5 65 2.0 66 1.5 67 2.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.775 3 0.775 4 0.775 5 0.775 6 0.65 7 0.675 8 0.65 9 0.65 10-14 0.6799999999999999 15-19 0.7000000000000001 20-24 0.695 25-29 0.67 30-34 0.67 35-39 0.67 40-44 0.695 45-49 0.7000000000000001 50-54 0.7000000000000001 55-59 0.7000000000000001 60-64 0.6649999999999999 65-69 0.6799999999999999 70-74 0.69 75-79 0.7000000000000001 80-84 0.7000000000000001 85-89 0.7000000000000001 90-94 0.705 95-99 0.7000000000000001 100-104 0.67 105-109 0.7000000000000001 110-114 0.7000000000000001 115-119 0.69 120-124 0.675 125-129 0.66 130-134 0.65 135-139 0.65 140-144 0.69 145-149 0.7000000000000001 150-151 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.16300129366105 94.85 2 1.3454075032341526 2.6 3 0.31047865459249674 0.8999999999999999 4 0.1034928848641656 0.4 5 0.0258732212160414 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0517464424320828 1.125 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 26 0.65 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 19 0.475 Illumina Single End PCR Primer 1 (100% over 50bp) GTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAACAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.6625 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 1.0125 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.3875 0.0 0.0 0.0 0.0 94-95 1.7 0.0 0.0 0.0 0.0 96-97 2.1125 0.0 0.0 0.0 0.0 98-99 2.525 0.0 0.0 0.0 0.0 100-101 2.9749999999999996 0.0 0.0 0.0 0.0 102-103 3.275 0.0 0.0 0.0 0.0 104-105 3.5625 0.0 0.0 0.0 0.0 106-107 4.112500000000001 0.0 0.0 0.0 0.0 108-109 4.5875 0.0 0.0 0.0 0.0 110-111 4.925 0.0 0.0 0.0 0.0 112-113 5.4625 0.0 0.0 0.0 0.0 114-115 6.112500000000001 0.0 0.0 0.0 0.0 116-117 6.7 0.0 0.0 0.0 0.0 118-119 7.2625 0.0 0.0 0.0 0.0 120-121 7.862500000000001 0.0 0.0 0.0 0.0 122-123 8.625 0.0 0.0 0.0 0.0 124-125 9.5 0.0 0.0 0.0 0.0 126-127 10.4625 0.0 0.0 0.0 0.0 128-129 11.025 0.0 0.0 0.0 0.0 130-131 11.7125 0.0 0.0 0.0 0.0 132-133 12.475 0.0 0.0 0.0 0.0 134-135 13.425 0.0 0.0 0.0 0.0 136-137 14.4625 0.0 0.0 0.0 0.0 138-139 15.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933297 spots for SRR7172474.sra Written 933297 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra Read 933292 spots for SRR7172474.sra Written 933292 spots for SRR7172474.sra SRR ids: ['SRR7172474.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bs65gwks SRR7172474.sra spots: 18665845 blocks: [[1, 933292], [933293, 1866584], [1866585, 2799876], [2799877, 3733168], [3733169, 4666460], [4666461, 5599752], [5599753, 6533044], [6533045, 7466336], [7466337, 8399628], [8399629, 9332920], [9332921, 10266212], [10266213, 11199504], [11199505, 12132796], [12132797, 13066088], [13066089, 13999380], [13999381, 14932672], [14932673, 15865964], [15865965, 16799256], [16799257, 17732548], [17732549, 18665845]] SRR7172474 file size 6303542 SRR7172474 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172474 SRR7172474_1.fastq SRR7172474_2.fastq Input file: SRR7172474_1.fastq Paired file: SRR7172474_2.fastq trimmed: SRR7172474-trimmed-pair1.fastq, SRR7172474-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:31:10 2025 >> started Mon Feb 10 10:31:30 2025 >> done (20.075s) 18665845 read pairs processed; of these: 46329 ( 0.25%) short read pairs filtered out after trimming by size control 205785 ( 1.10%) empty read pairs filtered out after trimming by size control 18413731 (98.65%) read pairs available; of these: 11920636 (64.74%) trimmed read pairs available after processing 6493095 (35.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 23 0.00% 20 20 0.00% 21 29 0.00% 22 27 0.00% 23 38 0.00% 24 36 0.00% 25 46 0.00% 26 55 0.00% 27 55 0.00% 28 65 0.00% 29 57 0.00% 30 48 0.00% 31 65 0.00% 32 58 0.00% 33 60 0.00% 34 63 0.00% 35 75 0.00% 36 68 0.00% 37 80 0.00% 38 94 0.00% 39 105 0.00% 40 118 0.00% 41 145 0.00% 42 156 0.00% 43 154 0.00% 44 156 0.00% 45 224 0.00% 46 285 0.00% 47 295 0.00% 48 344 0.00% 49 389 0.00% 50 469 0.00% 51 480 0.00% 52 532 0.00% 53 617 0.00% 54 673 0.00% 55 677 0.00% 56 802 0.00% 57 910 0.00% 58 973 0.01% 59 1156 0.01% 60 1329 0.01% 61 1508 0.01% 62 1730 0.01% 63 2015 0.01% 64 2198 0.01% 65 2462 0.01% 66 2919 0.02% 67 3325 0.02% 68 4038 0.02% 69 6454 0.04% 70 11549 0.06% 71 12390 0.07% 72 10617 0.06% 73 9066 0.05% 74 8598 0.05% 75 8724 0.05% 76 8938 0.05% 77 9525 0.05% 78 10543 0.06% 79 11525 0.06% 80 12386 0.07% 81 13945 0.08% 82 15810 0.09% 83 17822 0.10% 84 21257 0.12% 85 22807 0.12% 86 24585 0.13% 87 25762 0.14% 88 26796 0.15% 89 28606 0.16% 90 30333 0.16% 91 32440 0.18% 92 34294 0.19% 93 38235 0.21% 94 39636 0.22% 95 42401 0.23% 96 43194 0.23% 97 42271 0.23% 98 43261 0.23% 99 44645 0.24% 100 48919 0.27% 101 48711 0.26% 102 51393 0.28% 103 54603 0.30% 104 57253 0.31% 105 61317 0.33% 106 60723 0.33% 107 60797 0.33% 108 62187 0.34% 109 67112 0.36% 110 66688 0.36% 111 65367 0.35% 112 68533 0.37% 113 74832 0.41% 114 74012 0.40% 115 76974 0.42% 116 78782 0.43% 117 77861 0.42% 118 78826 0.43% 119 78765 0.43% 120 81843 0.44% 121 82233 0.45% 122 84746 0.46% 123 88445 0.48% 124 92738 0.50% 125 92823 0.50% 126 95149 0.52% 127 96623 0.52% 128 97761 0.53% 129 100334 0.54% 130 101560 0.55% 131 102328 0.56% 132 107023 0.58% 133 111188 0.60% 134 114926 0.62% 135 122405 0.66% 136 126195 0.69% 137 132736 0.72% 138 138867 0.75% 139 144080 0.78% 140 150234 0.82% 141 162939 0.88% 142 169708 0.92% 143 186232 1.01% 144 208503 1.13% 145 238581 1.30% 146 286394 1.56% 147 373819 2.03% 148 552534 3.00% 149 1035684 5.62% 150 4387668 23.83% 151 6493095 35.26% 18413731 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=20 prefix-density=0.46 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=60.46 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=21 prefix-density=0.52 prefix-fanout=2.3 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=22.22 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=1.5 sequence=TTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7172474 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:32:33 Started mapping on | Feb 10 10:32:33 Finished on | Feb 10 10:36:45 Mapping speed, Million of reads per hour | 263.05 Number of input reads | 18413731 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 15374570 Uniquely mapped reads % | 83.50% Average mapped length | 284.73 Number of splices: Total | 12501676 Number of splices: Annotated (sjdb) | 12181334 Number of splices: GT/AG | 12238111 Number of splices: GC/AG | 210116 Number of splices: AT/AC | 8301 Number of splices: Non-canonical | 45148 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.03% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470605 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 247379 % of reads mapped to too many loci | 1.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.19% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2607980 2607980 2607980 N_multimapping 470605 470605 470605 N_noFeature 711377 15041189 870199 N_ambiguous 284285 1450 108826 UnstrandedReadsAssigned:14378908 PositiveStrandReadsAssigned:331931 NegativeStrandReadsAssigned:14395545 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=137 echo kmer=133 SRR7172474 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172474-trimmed-pair1.fastq SRR7172474-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,413,731 reads, 14,706,996 reads pseudoaligned [quant] estimated average fragment length: 212.966 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR7172474.ke.tsv 34699 SRR7172474.se.tsv 87100 total ==> SRR7172474.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.03 454 17.0017 Potri.005G024800.1.v4.1 1035 823.034 275 22.5984 Potri.004G059700.1.v4.1 961 749.138 21 1.89592 Potri.007G009000.2.v4.1 1416 1204.03 2 0.112345 Potri.003G141000.2.v4.1 2943 2731.03 1031.94 25.5557 Potri.016G087400.1.v4.1 270 100.855 621.137 416.534 Potri.015G069301.1.v4.1 564 358.499 0 0 Potri.010G195200.1.v4.1 1773 1561.03 58 2.51291 Potri.012G127500.1.v4.1 977 765.118 204 18.0328 ==> SRR7172474.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 744 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 57 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 63 Potri.001G416900.v4.1 91 Potri.001G452600.v4.1 6 SRR7172474 completed mapping pipeline successfully