Starting /dee2/code/volunteer_pipeline.sh SRR7172475 current disk space = 3059229569024 free memory = 1405655040 SRR7172475 SRAfilesize 3762b59f103e64b12f7f32fb02d8a499 SRR7172475.sra SRR7172475.sra file validated SRR7172475 is paired end SRR7172475 is conventional basespace SRR7172475 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172475_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9805 34.0 33.0 34.0 33.0 34.0 2 33.3485 34.0 33.0 34.0 33.0 34.0 3 33.422 34.0 34.0 34.0 33.0 34.0 4 33.3965 34.0 34.0 34.0 33.0 34.0 5 33.342 34.0 33.0 34.0 33.0 34.0 6 37.00725 38.0 38.0 38.0 36.0 38.0 7 37.3285 38.0 38.0 38.0 37.0 38.0 8 37.4095 38.0 38.0 38.0 37.0 38.0 9 37.45525 38.0 38.0 38.0 37.0 38.0 10-14 37.433550000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.42115 38.0 38.0 38.0 37.4 38.0 20-24 37.435050000000004 38.0 38.0 38.0 37.4 38.0 25-29 37.443799999999996 38.0 38.0 38.0 37.2 38.0 30-34 37.3966 38.0 38.0 38.0 37.0 38.0 35-39 37.27335 38.0 38.0 38.0 36.8 38.0 40-44 37.1378 38.0 38.0 38.0 36.2 38.0 45-49 37.08295 38.0 38.0 38.0 36.0 38.0 50-54 36.9467 38.0 38.0 38.0 36.0 38.0 55-59 36.890100000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.90405 38.0 38.0 38.0 35.8 38.0 65-69 36.86275 38.0 38.0 38.0 35.6 38.0 70-74 36.724000000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.58495 38.0 38.0 38.0 34.2 38.0 80-84 36.449400000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.36905 38.0 38.0 38.0 34.0 38.0 90-94 36.311400000000006 38.0 38.0 38.0 33.8 38.0 95-99 36.172399999999996 38.0 37.6 38.0 33.6 38.0 100-104 35.933949999999996 38.0 37.0 38.0 33.0 38.0 105-109 35.8554 38.0 37.0 38.0 32.2 38.0 110-114 35.57885 38.0 37.0 38.0 31.0 38.0 115-119 35.3875 38.0 36.2 38.0 29.6 38.0 120-124 35.313050000000004 38.0 36.0 38.0 30.0 38.0 125-129 34.96465 38.0 35.8 38.0 28.0 38.0 130-134 34.5048 38.0 35.0 38.0 25.8 38.0 135-139 34.04615 38.0 34.8 38.0 23.0 38.0 140-144 33.53240000000001 38.0 34.2 38.0 18.6 38.0 145-149 32.69845 38.0 33.2 38.0 13.4 38.0 150-151 28.291 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 2.0 10 2.0 11 0.0 12 0.0 13 2.0 14 4.0 15 4.0 16 2.0 17 2.0 18 3.0 19 5.0 20 6.0 21 8.0 22 6.0 23 14.0 24 15.0 25 14.0 26 16.0 27 28.0 28 29.0 29 42.0 30 69.0 31 77.0 32 79.0 33 119.0 34 157.0 35 292.0 36 703.0 37 2298.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.61889085844518 15.16839706254748 9.774626487718411 30.43808559128893 2 23.474999999999998 19.2 31.65 25.674999999999997 3 20.025000000000002 25.05 26.875 28.050000000000004 4 22.125 33.550000000000004 22.95 21.375 5 22.416812609457093 36.15211408556417 23.842882161621215 17.588191143357516 6 17.875 35.9 25.924999999999997 20.3 7 14.549999999999999 22.85 44.175 18.425 8 17.599999999999998 24.099999999999998 31.424999999999997 26.875 9 16.650000000000002 23.7 33.300000000000004 26.35 10-14 20.73 28.904999999999998 27.0 23.365 15-19 20.27 28.475 28.13 23.125 20-24 20.23 28.410000000000004 27.74 23.62 25-29 19.605 28.92 27.6 23.875 30-34 19.994999999999997 28.595 27.915 23.494999999999997 35-39 20.126132439061013 28.680114119825816 27.238600530557083 23.955152910556084 40-44 20.32837763427942 28.252490363918508 27.62176502978425 23.79736697201782 45-49 20.446580554721137 28.882547311504958 27.110243316311205 23.5606288174627 50-54 20.23428113736484 28.28394072887465 27.492991589907888 23.988786543852623 55-59 20.508839585315773 28.772474583062053 27.330094656182702 23.388591175439473 60-64 20.366659987978363 28.51632939290723 27.4694450010018 23.647565618112605 65-69 20.392628205128204 28.971354166666668 27.488982371794872 23.147035256410255 70-74 20.05310089169422 28.84981464783088 27.176635607654543 23.920448852820357 75-79 20.487902619846714 28.317387166257575 27.911636527576018 23.283073686319693 80-84 20.00100155240623 28.539235815514047 27.357403976163052 24.10235865591667 85-89 20.350525788683026 28.44266399599399 27.46119178768152 23.745618427641464 90-94 20.104151018977518 29.16228531370487 27.23449001051525 23.499073656802363 95-99 20.350525788683026 28.13219829744617 28.12218327491237 23.395092638958438 100-104 20.291817087845967 28.534897713598074 27.757721620537506 23.415563578018453 105-109 20.60812503130792 28.21219255622902 27.641136101788312 23.53854631067475 110-114 20.312891741463172 28.481171338314194 27.72401343829915 23.48192348192348 115-119 20.926621587778612 27.853744052091162 27.563235662409213 23.656398697721013 120-124 20.755000000000003 28.63 26.83 23.785 125-129 20.745 28.215 27.650000000000002 23.39 130-134 21.331058020477816 28.061634209997994 26.93234290303152 23.674964866492672 135-139 21.184693518378843 28.536229697792525 27.193644089103437 23.085432694725196 140-144 21.082920482410046 28.22399039183306 26.957914227093028 23.735174898663864 145-149 20.585 28.43 27.200000000000003 23.785 150-151 20.849999999999998 28.762500000000003 27.075 23.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 1.0 18 1.5 19 2.5 20 2.5 21 1.0 22 1.0 23 2.5 24 2.0 25 3.5 26 7.5 27 9.0 28 10.5 29 12.5 30 20.5 31 27.0 32 30.0 33 47.5 34 72.0 35 78.0 36 91.0 37 115.5 38 139.5 39 178.5 40 192.5 41 211.0 42 226.0 43 234.0 44 253.0 45 249.5 46 242.0 47 233.0 48 220.5 49 197.5 50 169.5 51 152.0 52 123.0 53 94.0 54 80.5 55 67.5 56 62.0 57 45.5 58 28.0 59 21.0 60 11.5 61 8.0 62 6.0 63 2.5 64 2.5 65 1.5 66 0.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.105 40-44 0.11499999999999999 45-49 0.13 50-54 0.12 55-59 0.165 60-64 0.18 65-69 0.16 70-74 0.19 75-79 0.185 80-84 0.155 85-89 0.15 90-94 0.145 95-99 0.15 100-104 0.27999999999999997 105-109 0.185 110-114 0.28500000000000003 115-119 0.17500000000000002 120-124 0.0 125-129 0.0 130-134 0.38 135-139 0.565 140-144 0.08499999999999999 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93617021276596 97.65 2 0.8358662613981762 1.6500000000000001 3 0.2026342451874367 0.6 4 0.025329280648429587 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0250000000000004 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.4 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.4 0.0 0.0 0.0 0.0 130-131 3.8375000000000004 0.0 0.0 0.0 0.0 132-133 4.175 0.0 0.0 0.0 0.0 134-135 4.4625 0.0 0.0 0.0 0.0 136-137 5.012499999999999 0.0 0.0 0.0 0.0 138-139 5.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGAAA 10 0.006830828 145.0 1 CTCAACA 10 0.006830828 145.0 2 >>END_MODULE SRR7172475 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172475_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.45025 33.0 33.0 34.0 32.0 34.0 2 32.52575 33.0 33.0 34.0 32.0 34.0 3 32.55425 34.0 33.0 34.0 32.0 34.0 4 32.4385 34.0 33.0 34.0 32.0 34.0 5 32.437 34.0 33.0 34.0 32.0 34.0 6 36.483 38.0 38.0 38.0 35.0 38.0 7 36.5935 38.0 38.0 38.0 36.0 38.0 8 36.554 38.0 38.0 38.0 36.0 38.0 9 36.546 38.0 38.0 38.0 36.0 38.0 10-14 36.46975 38.0 38.0 38.0 35.2 38.0 15-19 36.47275 38.0 38.0 38.0 35.6 38.0 20-24 36.480000000000004 38.0 38.0 38.0 35.8 38.0 25-29 36.51135 38.0 38.0 38.0 36.0 38.0 30-34 36.48545 38.0 38.0 38.0 36.0 38.0 35-39 36.38055000000001 38.0 38.0 38.0 35.2 38.0 40-44 36.380100000000006 38.0 38.0 38.0 35.0 38.0 45-49 36.3368 38.0 38.0 38.0 35.2 38.0 50-54 36.312250000000006 38.0 38.0 38.0 35.0 38.0 55-59 36.3286 38.0 38.0 38.0 35.0 38.0 60-64 36.259699999999995 38.0 38.0 38.0 34.6 38.0 65-69 36.16205 38.0 38.0 38.0 34.6 38.0 70-74 36.04985 38.0 38.0 38.0 34.0 38.0 75-79 36.02675 38.0 38.0 38.0 34.0 38.0 80-84 35.921899999999994 38.0 38.0 38.0 33.6 38.0 85-89 35.773250000000004 38.0 38.0 38.0 33.2 38.0 90-94 35.6144 38.0 38.0 38.0 32.2 38.0 95-99 35.43075 38.0 38.0 38.0 31.0 38.0 100-104 35.2572 38.0 37.8 38.0 29.4 38.0 105-109 35.297549999999994 38.0 37.4 38.0 30.6 38.0 110-114 34.966100000000004 38.0 37.0 38.0 28.2 38.0 115-119 34.783249999999995 38.0 37.0 38.0 27.6 38.0 120-124 34.5286 38.0 36.0 38.0 25.6 38.0 125-129 34.243399999999994 38.0 35.8 38.0 23.6 38.0 130-134 33.92829999999999 38.0 35.2 38.0 22.2 38.0 135-139 33.3647 38.0 33.8 38.0 17.0 38.0 140-144 32.68019999999999 38.0 33.2 38.0 13.2 38.0 145-149 31.77325 38.0 32.8 38.0 6.4 38.0 150-151 27.302625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 14.0 4 5.0 5 2.0 6 1.0 7 7.0 8 3.0 9 4.0 10 5.0 11 2.0 12 5.0 13 7.0 14 7.0 15 9.0 16 8.0 17 5.0 18 6.0 19 14.0 20 12.0 21 6.0 22 17.0 23 21.0 24 12.0 25 15.0 26 24.0 27 31.0 28 30.0 29 42.0 30 43.0 31 70.0 32 78.0 33 115.0 34 141.0 35 238.0 36 513.0 37 2454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.38014042126379 21.890672016048143 13.76629889669007 20.962888665997994 2 28.48545636910732 23.771313941825476 29.989969909729187 17.753259779338016 3 22.15253386853989 26.166583040642248 31.986954340190664 19.693928750627197 4 23.707977922729555 34.470647265429 23.05569493226292 18.765679879578524 5 23.206221776216758 37.73206221776217 21.37481184144506 17.686904164576017 6 19.44792973651192 36.91342534504392 24.065244667503137 19.573400250941027 7 20.225846925972395 18.89585947302384 40.200752823086574 20.677540777917187 8 20.898143502257902 23.75815353738083 28.324134470647266 27.019568489713997 9 21.3801756587202 24.843161856963615 29.686323713927226 24.090338770388957 10-14 23.044111005168865 27.96707984142119 26.863050132985393 22.12575902042455 15-19 23.35792061819459 27.718400321140045 28.225199458076172 20.69847960258919 20-24 22.90129961362838 27.939184103567666 27.61804405640022 21.541472226403734 25-29 23.49222277972905 28.3843452082288 27.491219267436023 20.63221274460612 30-34 22.523833416959356 28.128449573507275 28.52985449071751 20.817862518815854 35-39 23.15720808871494 27.096191479753124 28.60153545085052 21.14506498068142 40-44 23.481882966977818 27.908260564087122 28.159188999297402 20.450667469637658 45-49 22.739134798755394 27.822944896115626 28.314764629127776 21.123155676001204 50-54 22.6900878293601 27.46298619824341 28.28607277289837 21.560853199498116 55-59 23.0228823765556 27.694700923323968 28.151344841429143 21.13107185869129 60-64 23.366783743100854 26.94430506773708 28.595082789764177 21.093828399397893 65-69 23.41044813569529 27.761328850303606 27.921914989712448 20.906308024288652 70-74 23.06032319582455 27.44655224330021 27.737629228144133 21.755495332731105 75-79 22.98389120289055 27.721182315451397 27.59572439403824 21.699202087619813 80-84 23.60734718458296 27.757703502960958 28.018669075579645 20.616280236876445 85-89 23.33249686323714 27.869510664993726 27.603513174404014 21.194479297365117 90-94 23.221368680022092 27.248079530049708 28.573580358487728 20.956971431440476 95-99 23.846810219344476 27.330221352205992 27.726747979721928 21.0962204487276 100-104 23.948609856468934 27.822944896115626 27.125363846231053 21.103081401184383 105-109 23.460631304260552 27.46022983891203 28.303307070808454 20.77583178601897 110-114 23.738083291520322 28.289011540391368 27.345709984947312 20.62719518314099 115-119 23.821950117930445 28.08250112912129 28.07246449540824 20.02308425754002 120-124 24.165621079046424 28.095357590966124 27.59849435382685 20.140526976160604 125-129 23.766748632508655 27.972098158277714 27.716163998594872 20.54498921061876 130-134 24.39538384345208 27.180130456598096 27.792272955343705 20.63221274460612 135-139 24.099347717009532 27.992975413948823 27.867536377320622 20.040140491721022 140-144 24.486825595984943 27.483061480552067 27.543287327478044 20.486825595984946 145-149 24.953566588022692 28.271673108779684 26.881180663621308 19.893579639576327 150-151 25.0094114694441 28.38499184339315 27.368553143430795 19.23704354373196 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 12.0 1 6.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 3.0 19 2.0 20 3.0 21 3.5 22 1.5 23 2.0 24 3.5 25 4.5 26 4.5 27 4.5 28 10.0 29 16.5 30 16.5 31 18.5 32 24.5 33 29.0 34 45.5 35 69.5 36 88.5 37 111.5 38 128.5 39 142.5 40 162.5 41 198.0 42 234.0 43 261.0 44 283.0 45 276.5 46 263.5 47 250.0 48 235.5 49 207.0 50 165.5 51 140.5 52 117.5 53 92.5 54 76.0 55 68.5 56 62.5 57 44.0 58 29.0 59 24.0 60 16.5 61 14.0 62 10.5 63 6.5 64 3.5 65 1.0 66 2.0 67 2.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.3 3 0.35000000000000003 4 0.35000000000000003 5 0.35000000000000003 6 0.375 7 0.375 8 0.35000000000000003 9 0.375 10-14 0.365 15-19 0.35500000000000004 20-24 0.35500000000000004 25-29 0.35000000000000003 30-34 0.35000000000000003 35-39 0.35500000000000004 40-44 0.37 45-49 0.37 50-54 0.375 55-59 0.36 60-64 0.35000000000000003 65-69 0.365 70-74 0.37 75-79 0.365 80-84 0.37 85-89 0.375 90-94 0.415 95-99 0.385 100-104 0.37 105-109 0.365 110-114 0.35000000000000003 115-119 0.365 120-124 0.375 125-129 0.365 130-134 0.35000000000000003 135-139 0.35000000000000003 140-144 0.375 145-149 0.395 150-151 0.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.90222108756701 96.85000000000001 2 0.7403625223385244 1.4500000000000002 3 0.15317845289762574 0.44999999999999996 4 0.10211896859841717 0.4 5 0.025529742149604292 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025529742149604292 0.2 9 0.025529742149604292 0.22499999999999998 >10 0.025529742149604292 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 9 0.22499999999999998 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.8250000000000002 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.6375 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.975 0.0 0.0 0.0 0.0 132-133 4.3 0.0 0.0 0.0 0.0 134-135 4.5625 0.0 0.0 0.0 0.0 136-137 5.0875 0.0 0.0 0.0 0.0 138-139 5.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAGGA 10 0.006830828 145.0 145 CATTCAT 10 0.006830828 145.0 5 ACACATT 10 0.006830828 145.0 2 ACATTCA 10 0.006830828 145.0 4 GGATAAG 10 0.006830828 145.0 145 CATACTC 10 0.006830828 145.0 9 ATTCATA 10 0.006830828 145.0 6 AACACAT 10 0.006830828 145.0 1 AATCAAT 20 0.00593511 29.0 45-49 >>END_MODULE Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822965 spots for SRR7172475.sra Written 822965 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra Read 822962 spots for SRR7172475.sra Written 822962 spots for SRR7172475.sra SRR ids: ['SRR7172475.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cn5kgiq3 SRR7172475.sra spots: 16459243 blocks: [[1, 822962], [822963, 1645924], [1645925, 2468886], [2468887, 3291848], [3291849, 4114810], [4114811, 4937772], [4937773, 5760734], [5760735, 6583696], [6583697, 7406658], [7406659, 8229620], [8229621, 9052582], [9052583, 9875544], [9875545, 10698506], [10698507, 11521468], [11521469, 12344430], [12344431, 13167392], [13167393, 13990354], [13990355, 14813316], [14813317, 15636278], [15636279, 16459243]] SRR7172475 file size 5555797 SRR7172475 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172475 SRR7172475_1.fastq SRR7172475_2.fastq Input file: SRR7172475_1.fastq Paired file: SRR7172475_2.fastq trimmed: SRR7172475-trimmed-pair1.fastq, SRR7172475-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:32:00 2025 >> started Mon Feb 10 10:32:18 2025 >> done (17.461s) 16459243 read pairs processed; of these: 45181 ( 0.27%) short read pairs filtered out after trimming by size control 88586 ( 0.54%) empty read pairs filtered out after trimming by size control 16325476 (99.19%) read pairs available; of these: 8092441 (49.57%) trimmed read pairs available after processing 8233035 (50.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 12 0.00% 20 9 0.00% 21 11 0.00% 22 11 0.00% 23 18 0.00% 24 14 0.00% 25 20 0.00% 26 16 0.00% 27 18 0.00% 28 12 0.00% 29 18 0.00% 30 22 0.00% 31 13 0.00% 32 20 0.00% 33 21 0.00% 34 22 0.00% 35 21 0.00% 36 32 0.00% 37 39 0.00% 38 27 0.00% 39 34 0.00% 40 26 0.00% 41 36 0.00% 42 40 0.00% 43 53 0.00% 44 49 0.00% 45 125 0.00% 46 95 0.00% 47 114 0.00% 48 77 0.00% 49 87 0.00% 50 87 0.00% 51 120 0.00% 52 121 0.00% 53 120 0.00% 54 126 0.00% 55 160 0.00% 56 156 0.00% 57 156 0.00% 58 217 0.00% 59 229 0.00% 60 313 0.00% 61 307 0.00% 62 355 0.00% 63 424 0.00% 64 472 0.00% 65 487 0.00% 66 575 0.00% 67 734 0.00% 68 863 0.01% 69 1554 0.01% 70 1563 0.01% 71 1166 0.01% 72 1229 0.01% 73 1360 0.01% 74 1493 0.01% 75 1626 0.01% 76 1781 0.01% 77 1840 0.01% 78 2151 0.01% 79 2447 0.01% 80 2750 0.02% 81 3184 0.02% 82 3600 0.02% 83 4243 0.03% 84 6071 0.04% 85 7544 0.05% 86 7448 0.05% 87 7995 0.05% 88 8374 0.05% 89 8652 0.05% 90 9175 0.06% 91 9792 0.06% 92 10505 0.06% 93 11552 0.07% 94 12022 0.07% 95 12153 0.07% 96 12706 0.08% 97 12790 0.08% 98 13628 0.08% 99 14123 0.09% 100 15155 0.09% 101 16183 0.10% 102 16784 0.10% 103 17785 0.11% 104 18838 0.12% 105 19669 0.12% 106 20322 0.12% 107 21216 0.13% 108 21656 0.13% 109 22985 0.14% 110 23739 0.15% 111 24731 0.15% 112 25962 0.16% 113 27707 0.17% 114 28385 0.17% 115 29710 0.18% 116 30699 0.19% 117 31693 0.19% 118 32148 0.20% 119 33412 0.20% 120 35257 0.22% 121 35709 0.22% 122 37273 0.23% 123 39375 0.24% 124 41543 0.25% 125 42756 0.26% 126 45343 0.28% 127 46230 0.28% 128 47750 0.29% 129 49986 0.31% 130 51724 0.32% 131 54152 0.33% 132 56400 0.35% 133 60082 0.37% 134 63616 0.39% 135 67946 0.42% 136 70936 0.43% 137 75421 0.46% 138 80222 0.49% 139 85660 0.52% 140 91377 0.56% 141 99708 0.61% 142 109317 0.67% 143 123475 0.76% 144 141932 0.87% 145 167823 1.03% 146 206811 1.27% 147 275825 1.69% 148 419930 2.57% 149 838403 5.14% 150 3848026 23.57% 151 8233035 50.43% 16325476 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=16 prefix-density=0.57 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=93.12 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=23 prefix-density=0.63 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=9.45 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7172475 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:33:03 Started mapping on | Feb 10 10:33:03 Finished on | Feb 10 10:35:22 Mapping speed, Million of reads per hour | 422.82 Number of input reads | 16325476 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14922415 Uniquely mapped reads % | 91.41% Average mapped length | 292.97 Number of splices: Total | 14649312 Number of splices: Annotated (sjdb) | 14348806 Number of splices: GT/AG | 14352314 Number of splices: GC/AG | 240921 Number of splices: AT/AC | 8208 Number of splices: Non-canonical | 47869 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 441373 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 83112 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.25% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1001713 1001713 1001713 N_multimapping 441373 441373 441373 N_noFeature 531028 14565568 661598 N_ambiguous 339893 1132 112941 UnstrandedReadsAssigned:14051494 PositiveStrandReadsAssigned:355715 NegativeStrandReadsAssigned:14147876 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172475 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172475-trimmed-pair1.fastq SRR7172475-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,325,476 reads, 14,112,678 reads pseudoaligned [quant] estimated average fragment length: 254.985 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7172475.ke.tsv 34699 SRR7172475.se.tsv 87100 total ==> SRR7172475.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.01 698 21.0423 Potri.005G024800.1.v4.1 1035 781.015 293 19.9503 Potri.004G059700.1.v4.1 961 707.169 8 0.601598 Potri.007G009000.2.v4.1 1416 1162.01 0 0 Potri.003G141000.2.v4.1 2943 2689.01 1052.03 20.8055 Potri.016G087400.1.v4.1 270 81.005 545 357.787 Potri.015G069301.1.v4.1 564 319.862 0 0 Potri.010G195200.1.v4.1 1773 1519.01 83 2.90574 Potri.012G127500.1.v4.1 977 723.096 45 3.30946 ==> SRR7172475.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 655 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 88 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7172475 completed mapping pipeline successfully