Starting /dee2/code/volunteer_pipeline.sh SRR7172476 current disk space = 3114841120768 free memory = 1571344608 SRR7172476 SRAfilesize 1cc0765334f9588fbe4d20b9c074f2c7 SRR7172476.sra SRR7172476.sra file validated SRR7172476 is paired end SRR7172476 is conventional basespace SRR7172476 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172476_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.13325 34.0 33.0 34.0 32.0 34.0 2 33.191 34.0 33.0 34.0 32.0 34.0 3 33.24525 34.0 33.0 34.0 32.0 34.0 4 33.37575 34.0 33.0 34.0 33.0 34.0 5 33.04975 34.0 33.0 34.0 32.0 34.0 6 36.9325 38.0 37.0 38.0 35.0 38.0 7 37.3055 38.0 38.0 38.0 37.0 38.0 8 37.471 38.0 38.0 38.0 37.0 38.0 9 37.45175 38.0 38.0 38.0 37.0 38.0 10-14 37.272450000000006 38.0 38.0 38.0 36.8 38.0 15-19 37.09910000000001 38.0 38.0 38.0 36.0 38.0 20-24 37.000299999999996 38.0 38.0 38.0 35.6 38.0 25-29 37.2505 38.0 38.0 38.0 36.8 38.0 30-34 37.1687 38.0 38.0 38.0 36.6 38.0 35-39 37.06665 38.0 38.0 38.0 36.0 38.0 40-44 37.082 38.0 38.0 38.0 36.0 38.0 45-49 36.4475 38.0 37.6 38.0 33.4 38.0 50-54 36.8803 38.0 38.0 38.0 35.2 38.0 55-59 36.9069 38.0 38.0 38.0 35.6 38.0 60-64 36.78735 38.0 38.0 38.0 35.0 38.0 65-69 36.69795 38.0 38.0 38.0 34.4 38.0 70-74 36.38865 38.0 37.4 38.0 33.6 38.0 75-79 36.3026 38.0 37.6 38.0 33.2 38.0 80-84 36.156349999999996 38.0 37.0 38.0 32.8 38.0 85-89 35.94235 38.0 37.0 38.0 31.6 38.0 90-94 35.51735 38.0 36.6 38.0 29.8 38.0 95-99 36.074400000000004 38.0 37.0 38.0 33.0 38.0 100-104 35.8466 38.0 37.0 38.0 32.4 38.0 105-109 35.58075 38.0 36.6 38.0 30.6 38.0 110-114 35.4559 38.0 36.0 38.0 30.0 38.0 115-119 35.20815 38.0 36.0 38.0 28.6 38.0 120-124 34.812 38.0 35.4 38.0 26.8 38.0 125-129 34.482350000000004 38.0 35.0 38.0 26.2 38.0 130-134 34.1192 38.0 34.2 38.0 23.6 38.0 135-139 33.44325 38.0 34.0 38.0 19.4 38.0 140-144 32.558350000000004 37.4 32.8 38.0 14.2 38.0 145-149 30.758100000000002 35.8 29.4 38.0 9.0 38.0 150-151 27.4035 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 1.0 14 2.0 15 4.0 16 4.0 17 2.0 18 4.0 19 6.0 20 5.0 21 8.0 22 6.0 23 18.0 24 23.0 25 14.0 26 28.0 27 29.0 28 33.0 29 54.0 30 71.0 31 74.0 32 112.0 33 152.0 34 227.0 35 425.0 36 958.0 37 1738.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.808510638297875 16.34665282823041 8.043591074208614 28.801245459263104 2 22.900000000000002 18.95 34.050000000000004 24.099999999999998 3 17.925 26.575 28.849999999999998 26.650000000000002 4 21.925 32.7 24.099999999999998 21.275 5 20.724999999999998 36.675000000000004 23.375 19.225 6 17.849999999999998 36.0 25.3 20.849999999999998 7 13.625000000000002 22.875 44.7 18.8 8 16.35 23.400000000000002 32.675 27.575 9 17.150000000000002 23.65 32.275 26.924999999999997 10-14 20.544999999999998 29.205 26.450000000000003 23.799999999999997 15-19 20.105 28.21 28.01 23.674999999999997 20-24 20.18 28.275 27.894999999999996 23.65 25-29 20.0 28.605000000000004 27.87 23.525 30-34 19.975 28.62 27.975 23.43 35-39 19.895 29.270000000000003 28.21 22.625 40-44 20.575 28.410000000000004 27.77 23.244999999999997 45-49 20.28 29.365000000000002 26.82 23.535 50-54 20.23 28.299999999999997 27.47 24.0 55-59 19.89 28.494999999999997 27.615000000000002 24.0 60-64 20.395 28.57 27.744999999999997 23.29 65-69 19.825 28.345 28.04 23.79 70-74 20.330000000000002 28.494999999999997 27.634999999999998 23.54 75-79 20.115 28.845 27.655 23.385 80-84 19.535 28.83 27.534999999999997 24.099999999999998 85-89 20.155 28.93 27.224999999999998 23.69 90-94 20.23 28.715000000000003 27.845 23.21 95-99 20.495 28.205000000000002 27.865000000000002 23.435 100-104 20.880000000000003 28.835 27.284999999999997 23.0 105-109 20.505000000000003 28.185 28.08 23.23 110-114 20.655 28.53 27.275 23.54 115-119 21.005 28.48 27.12 23.395 120-124 20.665 28.365000000000002 27.46 23.51 125-129 20.575 28.155 27.415 23.855 130-134 21.07 28.575 26.974999999999998 23.380000000000003 135-139 21.27 28.62 26.584999999999997 23.525 140-144 21.055 28.9 26.540000000000003 23.505000000000003 145-149 20.465 28.935 26.61 23.990000000000002 150-151 20.3875 29.099999999999998 27.175 23.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 1.5 22 4.0 23 3.5 24 2.0 25 4.5 26 8.0 27 10.5 28 16.0 29 19.5 30 23.0 31 24.0 32 26.5 33 50.5 34 63.0 35 71.5 36 100.0 37 116.5 38 138.0 39 165.5 40 193.0 41 222.5 42 246.5 43 268.5 44 261.5 45 253.0 46 246.0 47 226.5 48 215.5 49 192.0 50 163.5 51 141.0 52 115.0 53 91.0 54 75.5 55 62.5 56 45.0 57 34.5 58 28.0 59 18.5 60 13.0 61 11.5 62 10.0 63 6.0 64 3.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36980085707083 98.55000000000001 2 0.4789513486261659 0.95 3 0.12603982858583312 0.375 4 0.0 0.0 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.2750000000000004 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.0375 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.6375 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.3875 0.0 0.0 0.0 0.0 132-133 4.9375 0.0 0.0 0.0 0.0 134-135 5.45 0.0 0.0 0.0 0.0 136-137 6.05 0.0 0.0 0.0 0.0 138-139 6.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172476 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172476_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79725 33.0 33.0 34.0 32.0 34.0 2 32.9295 34.0 33.0 34.0 32.0 34.0 3 32.9675 34.0 33.0 34.0 32.0 34.0 4 32.992 34.0 33.0 34.0 33.0 34.0 5 32.96075 34.0 33.0 34.0 32.0 34.0 6 37.08375 38.0 38.0 38.0 37.0 38.0 7 37.05075 38.0 38.0 38.0 37.0 38.0 8 37.0965 38.0 38.0 38.0 37.0 38.0 9 36.83875 38.0 38.0 38.0 36.0 38.0 10-14 36.9385 38.0 38.0 38.0 36.2 38.0 15-19 37.06505 38.0 38.0 38.0 37.0 38.0 20-24 36.7708 38.0 38.0 38.0 35.6 38.0 25-29 36.733999999999995 38.0 38.0 38.0 35.4 38.0 30-34 36.8253 38.0 38.0 38.0 36.0 38.0 35-39 36.874550000000006 38.0 38.0 38.0 36.2 38.0 40-44 36.633500000000005 38.0 38.0 38.0 35.0 38.0 45-49 36.646249999999995 38.0 38.0 38.0 35.4 38.0 50-54 36.30305 38.0 37.8 38.0 33.6 38.0 55-59 36.68145 38.0 38.0 38.0 35.6 38.0 60-64 36.65335 38.0 38.0 38.0 35.6 38.0 65-69 36.3355 38.0 37.8 38.0 33.8 38.0 70-74 36.55995 38.0 38.0 38.0 35.0 38.0 75-79 36.58725 38.0 38.0 38.0 35.0 38.0 80-84 36.4568 38.0 38.0 38.0 34.8 38.0 85-89 35.8301 38.0 37.4 38.0 32.0 38.0 90-94 36.209799999999994 38.0 38.0 38.0 33.8 38.0 95-99 36.227999999999994 38.0 38.0 38.0 34.0 38.0 100-104 35.7313 38.0 37.4 38.0 31.6 38.0 105-109 35.7813 38.0 37.2 38.0 32.6 38.0 110-114 35.583450000000006 38.0 37.0 38.0 31.0 38.0 115-119 35.64765 38.0 37.2 38.0 32.2 38.0 120-124 35.40025000000001 38.0 36.6 38.0 31.0 38.0 125-129 35.19065 38.0 36.2 38.0 30.0 38.0 130-134 34.31705 38.0 35.0 38.0 23.8 38.0 135-139 34.09065 38.0 35.0 38.0 23.0 38.0 140-144 33.8191 38.0 35.0 38.0 22.2 38.0 145-149 33.2183 38.0 34.2 38.0 17.8 38.0 150-151 29.47175 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 3.0 5 5.0 6 2.0 7 2.0 8 1.0 9 2.0 10 3.0 11 1.0 12 2.0 13 7.0 14 3.0 15 4.0 16 4.0 17 4.0 18 10.0 19 5.0 20 12.0 21 9.0 22 10.0 23 10.0 24 13.0 25 15.0 26 18.0 27 24.0 28 24.0 29 45.0 30 44.0 31 57.0 32 78.0 33 114.0 34 160.0 35 264.0 36 622.0 37 2410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.975 20.65 10.2 21.175 2 25.85 24.5 31.924999999999997 17.724999999999998 3 20.275000000000002 28.775000000000002 30.8 20.150000000000002 4 22.925 35.925000000000004 23.3 17.849999999999998 5 24.15 37.325 21.325 17.2 6 21.099999999999998 37.475 23.275000000000002 18.15 7 19.025 19.625 41.675000000000004 19.675 8 19.425 23.775 28.849999999999998 27.950000000000003 9 22.425 25.424999999999997 28.749999999999996 23.400000000000002 10-14 22.6 28.345 26.955000000000002 22.1 15-19 22.384999999999998 28.095 28.915000000000003 20.605 20-24 22.475 28.645 27.845 21.035 25-29 22.84 28.310000000000002 28.110000000000003 20.74 30-34 22.625 28.535 28.144999999999996 20.695 35-39 22.1 28.465 28.455000000000002 20.979999999999997 40-44 22.865 28.18 27.955000000000002 21.0 45-49 22.785 28.455000000000002 27.894999999999996 20.865000000000002 50-54 22.325 28.52 28.215 20.94 55-59 23.14 27.150000000000002 28.46 21.25 60-64 23.125 27.644999999999996 28.485 20.745 65-69 23.22 27.415 27.77 21.595 70-74 22.735 27.87 27.994999999999997 21.4 75-79 22.96 27.950000000000003 27.705000000000002 21.385 80-84 23.355 27.615000000000002 28.03 21.0 85-89 23.53 27.985 27.694999999999997 20.79 90-94 23.925 28.075 27.52 20.48 95-99 23.425 27.925 27.589999999999996 21.060000000000002 100-104 23.32 28.185 27.565 20.93 105-109 23.51 27.950000000000003 28.189999999999998 20.349999999999998 110-114 23.885 27.79 27.575 20.75 115-119 23.34 28.255000000000003 28.375 20.03 120-124 23.94 27.675 27.889999999999997 20.495 125-129 23.815 27.71 27.750000000000004 20.724999999999998 130-134 24.615000000000002 27.615000000000002 27.615000000000002 20.155 135-139 24.12 27.98 27.52 20.380000000000003 140-144 24.099999999999998 28.12 27.735 20.044999999999998 145-149 24.560000000000002 27.955000000000002 27.41 20.075000000000003 150-151 25.05 28.275 26.75 19.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 3.0 25 5.5 26 5.0 27 6.5 28 14.0 29 17.0 30 19.5 31 26.0 32 27.5 33 28.5 34 44.5 35 67.5 36 81.0 37 98.0 38 128.5 39 163.0 40 198.5 41 237.0 42 263.0 43 287.0 44 276.5 45 256.0 46 260.5 47 246.5 48 229.0 49 204.0 50 165.0 51 133.5 52 107.0 53 86.0 54 78.0 55 62.5 56 48.0 57 34.5 58 26.0 59 20.5 60 8.5 61 7.5 62 7.0 63 4.5 64 2.0 65 0.5 66 1.5 67 1.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24089068825911 98.05 2 0.5060728744939271 1.0 3 0.15182186234817813 0.44999999999999996 4 0.05060728744939271 0.2 5 0.025303643724696356 0.125 6 0.0 0.0 7 0.025303643724696356 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.0250000000000004 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.7125 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.737500000000001 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.362500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra Read 1163180 spots for SRR7172476.sra Written 1163180 spots for SRR7172476.sra SRR ids: ['SRR7172476.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fxq4op2f SRR7172476.sra spots: 23263600 blocks: [[1, 1163180], [1163181, 2326360], [2326361, 3489540], [3489541, 4652720], [4652721, 5815900], [5815901, 6979080], [6979081, 8142260], [8142261, 9305440], [9305441, 10468620], [10468621, 11631800], [11631801, 12794980], [12794981, 13958160], [13958161, 15121340], [15121341, 16284520], [16284521, 17447700], [17447701, 18610880], [18610881, 19774060], [19774061, 20937240], [20937241, 22100420], [22100421, 23263600]] SRR7172476 file size 7861570 SRR7172476 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172476 SRR7172476_1.fastq SRR7172476_2.fastq Input file: SRR7172476_1.fastq Paired file: SRR7172476_2.fastq trimmed: SRR7172476-trimmed-pair1.fastq, SRR7172476-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:18:22 2025 >> started Fri Feb 14 11:18:48 2025 >> done (25.844s) 23263600 read pairs processed; of these: 37777 ( 0.16%) short read pairs filtered out after trimming by size control 21453 ( 0.09%) empty read pairs filtered out after trimming by size control 23204370 (99.75%) read pairs available; of these: 11392612 (49.10%) trimmed read pairs available after processing 11811758 (50.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 14 0.00% 20 7 0.00% 21 14 0.00% 22 12 0.00% 23 17 0.00% 24 18 0.00% 25 16 0.00% 26 17 0.00% 27 22 0.00% 28 13 0.00% 29 13 0.00% 30 23 0.00% 31 16 0.00% 32 17 0.00% 33 15 0.00% 34 11 0.00% 35 20 0.00% 36 23 0.00% 37 32 0.00% 38 27 0.00% 39 37 0.00% 40 37 0.00% 41 34 0.00% 42 53 0.00% 43 38 0.00% 44 48 0.00% 45 64 0.00% 46 68 0.00% 47 76 0.00% 48 95 0.00% 49 87 0.00% 50 121 0.00% 51 135 0.00% 52 125 0.00% 53 155 0.00% 54 174 0.00% 55 192 0.00% 56 211 0.00% 57 236 0.00% 58 282 0.00% 59 297 0.00% 60 369 0.00% 61 406 0.00% 62 496 0.00% 63 546 0.00% 64 625 0.00% 65 621 0.00% 66 748 0.00% 67 930 0.00% 68 1155 0.00% 69 1864 0.01% 70 1717 0.01% 71 1532 0.01% 72 1673 0.01% 73 1790 0.01% 74 2055 0.01% 75 2226 0.01% 76 2498 0.01% 77 2751 0.01% 78 3057 0.01% 79 3477 0.01% 80 3870 0.02% 81 4368 0.02% 82 4949 0.02% 83 5613 0.02% 84 7736 0.03% 85 8955 0.04% 86 9494 0.04% 87 9956 0.04% 88 10425 0.04% 89 11040 0.05% 90 11882 0.05% 91 12687 0.05% 92 13437 0.06% 93 14654 0.06% 94 15192 0.07% 95 16453 0.07% 96 17435 0.08% 97 18009 0.08% 98 18698 0.08% 99 19680 0.08% 100 21104 0.09% 101 22140 0.10% 102 23813 0.10% 103 25016 0.11% 104 25901 0.11% 105 27637 0.12% 106 28927 0.12% 107 29615 0.13% 108 30816 0.13% 109 32410 0.14% 110 33711 0.15% 111 34929 0.15% 112 37131 0.16% 113 39281 0.17% 114 40836 0.18% 115 43143 0.19% 116 44809 0.19% 117 46753 0.20% 118 47341 0.20% 119 49607 0.21% 120 51156 0.22% 121 53322 0.23% 122 55171 0.24% 123 59021 0.25% 124 62093 0.27% 125 64141 0.28% 126 66779 0.29% 127 69211 0.30% 128 71241 0.31% 129 74475 0.32% 130 77542 0.33% 131 80077 0.35% 132 85017 0.37% 133 89873 0.39% 134 94956 0.41% 135 101535 0.44% 136 106849 0.46% 137 114023 0.49% 138 121116 0.52% 139 130121 0.56% 140 138774 0.60% 141 151001 0.65% 142 166443 0.72% 143 187035 0.81% 144 214328 0.92% 145 253431 1.09% 146 312539 1.35% 147 417235 1.80% 148 616521 2.66% 149 1159460 5.00% 150 5195219 22.39% 151 11811758 50.90% 23204370 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=18 prefix-density=0.69 prefix-fanout=1.1 sequence=TAGTTCTTCTCGGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=473.20 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=21.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=12 prefix-density=0.50 prefix-fanout=2.5 sequence=GAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=35.35 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.1 sequence=GGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGT SRR7172476 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:19:47 Started mapping on | Feb 14 11:19:47 Finished on | Feb 14 11:22:37 Mapping speed, Million of reads per hour | 491.39 Number of input reads | 23204370 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 21380918 Uniquely mapped reads % | 92.14% Average mapped length | 292.79 Number of splices: Total | 20036005 Number of splices: Annotated (sjdb) | 19526992 Number of splices: GT/AG | 19640663 Number of splices: GC/AG | 315715 Number of splices: AT/AC | 13113 Number of splices: Non-canonical | 66514 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 614497 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 160558 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.35% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1246627 1246627 1246627 N_multimapping 614497 614497 614497 N_noFeature 1039405 20965877 1222161 N_ambiguous 381333 1967 147622 UnstrandedReadsAssigned:19960180 PositiveStrandReadsAssigned:413074 NegativeStrandReadsAssigned:20011135 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172476 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172476-trimmed-pair1.fastq SRR7172476-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,204,370 reads, 20,098,360 reads pseudoaligned [quant] estimated average fragment length: 249.85 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 988 rounds 52401 SRR7172476.ke.tsv 34699 SRR7172476.se.tsv 87100 total ==> SRR7172476.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.15 1127 28.7588 Potri.005G024800.1.v4.1 1035 786.15 318 18.2613 Potri.004G059700.1.v4.1 961 712.292 15 0.950702 Potri.007G009000.2.v4.1 1416 1167.15 0 0 Potri.003G141000.2.v4.1 2943 2694.15 959.34 16.0754 Potri.016G087400.1.v4.1 270 82.5969 1092 596.856 Potri.015G069301.1.v4.1 564 325.336 0 0 Potri.010G195200.1.v4.1 1773 1524.15 141 4.1764 Potri.012G127500.1.v4.1 977 728.233 228 14.1343 ==> SRR7172476.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1479 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 61 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 62 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 1 SRR7172476 completed mapping pipeline successfully