Starting /dee2/code/volunteer_pipeline.sh SRR7172477 current disk space = 3058797170688 free memory = 1354476284 SRR7172477 SRAfilesize b2efbd1b34dc311329615d6177ae9255 SRR7172477.sra SRR7172477.sra file validated SRR7172477 is paired end SRR7172477 is conventional basespace SRR7172477 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172477_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18175 34.0 33.0 34.0 33.0 34.0 2 33.44225 34.0 34.0 34.0 33.0 34.0 3 33.46 34.0 34.0 34.0 33.0 34.0 4 33.47725 34.0 34.0 34.0 33.0 34.0 5 33.358 34.0 34.0 34.0 33.0 34.0 6 37.045 38.0 38.0 38.0 36.0 38.0 7 37.37125 38.0 38.0 38.0 37.0 38.0 8 37.45975 38.0 38.0 38.0 37.0 38.0 9 37.50125 38.0 38.0 38.0 37.0 38.0 10-14 37.4531 38.0 38.0 38.0 37.2 38.0 15-19 37.485749999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.50515 38.0 38.0 38.0 38.0 38.0 25-29 37.50515 38.0 38.0 38.0 38.0 38.0 30-34 37.4533 38.0 38.0 38.0 37.6 38.0 35-39 37.32785 38.0 38.0 38.0 37.0 38.0 40-44 37.22035 38.0 38.0 38.0 37.0 38.0 45-49 37.14829999999999 38.0 38.0 38.0 36.6 38.0 50-54 37.01225000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.89185 38.0 38.0 38.0 36.0 38.0 60-64 36.93435 38.0 38.0 38.0 36.0 38.0 65-69 36.94495 38.0 38.0 38.0 36.0 38.0 70-74 36.8233 38.0 38.0 38.0 35.4 38.0 75-79 36.607150000000004 38.0 38.0 38.0 34.6 38.0 80-84 36.4474 38.0 38.0 38.0 34.0 38.0 85-89 36.470000000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.3396 38.0 38.0 38.0 34.0 38.0 95-99 36.23065 38.0 38.0 38.0 33.8 38.0 100-104 35.98895 38.0 37.0 38.0 33.0 38.0 105-109 35.9621 38.0 37.2 38.0 33.0 38.0 110-114 35.71655 38.0 37.0 38.0 31.2 38.0 115-119 35.5137 38.0 36.6 38.0 30.2 38.0 120-124 35.35209999999999 38.0 36.2 38.0 30.0 38.0 125-129 35.0496 38.0 36.0 38.0 28.2 38.0 130-134 34.63355 38.0 35.4 38.0 27.0 38.0 135-139 34.233999999999995 38.0 35.0 38.0 23.8 38.0 140-144 33.6971 38.0 34.6 38.0 21.4 38.0 145-149 32.90585 38.0 33.2 38.0 15.4 38.0 150-151 28.50575 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 2.0 6 0.0 7 0.0 8 0.0 9 3.0 10 1.0 11 1.0 12 2.0 13 1.0 14 4.0 15 0.0 16 1.0 17 2.0 18 8.0 19 7.0 20 4.0 21 6.0 22 7.0 23 16.0 24 8.0 25 21.0 26 28.0 27 26.0 28 34.0 29 38.0 30 39.0 31 47.0 32 85.0 33 104.0 34 165.0 35 283.0 36 646.0 37 2411.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.98486759142497 15.662042875157628 9.508196721311474 30.84489281210593 2 22.3 19.675 33.5 24.525 3 18.625 27.075 27.650000000000002 26.650000000000002 4 23.525 32.074999999999996 23.549999999999997 20.849999999999998 5 20.816633266533067 36.92384769539078 23.321643286573146 18.937875751503004 6 16.8 34.849999999999994 27.224999999999998 21.125 7 13.775 22.5 45.324999999999996 18.4 8 17.275 24.45 30.55 27.725 9 18.75 22.900000000000002 32.95 25.4 10-14 19.405 29.5 26.71 24.385 15-19 20.03 28.76 27.97 23.24 20-24 19.53 28.310000000000002 28.54 23.62 25-29 19.665 29.49 27.644999999999996 23.200000000000003 30-34 19.5 28.315 28.335 23.849999999999998 35-39 19.889944972486244 28.854427213606805 27.423711855927962 23.83191595797899 40-44 20.332199319591755 28.412047228337002 27.776665999599757 23.479087452471482 45-49 20.67240344206524 28.797278367020212 27.141284770862516 23.38903342005203 50-54 20.513333666883472 28.758693150547852 27.01255816280582 23.715415019762844 55-59 19.979969954932397 29.43415122684026 27.29594391587381 23.28993490235353 60-64 19.684447783621337 28.214375156523918 27.998998246932132 24.102178812922613 65-69 19.718521486527095 28.2981067815286 28.05769808674747 23.925673645196834 70-74 20.139271579580182 28.25008767095837 28.00961875657532 23.60102199288613 75-79 20.550964187327825 28.81041823190584 27.337841222138742 23.300776358627598 80-84 20.45568352528793 28.41762643965949 27.681522283425135 23.44516775162744 85-89 20.00400480576692 28.313976772126555 27.6031237484982 24.078894673608332 90-94 20.552469599159284 27.763599059200324 28.178952109292897 23.504979232347495 95-99 21.09504028827386 28.121715629848353 27.100745708423002 23.682498373454784 100-104 21.076637762518168 28.31938248709338 27.25176682873039 23.35221292165806 105-109 20.570999248685197 28.549962434259957 27.783621337340346 23.0954169797145 110-114 21.00566501228255 28.66095152153206 26.826089136210957 23.50729432997443 115-119 21.14460244342079 28.369717604646503 26.947726817544567 23.537953134388143 120-124 21.44 28.470000000000002 26.6 23.49 125-129 20.77707770777078 28.69286928692869 26.912691269126913 23.617361736173617 130-134 20.83479656850449 28.204485024833193 26.589073395876184 24.371645010786132 135-139 20.831030497914888 28.623825553936594 26.468371602271013 24.076772345877508 140-144 20.90881793614253 28.560704634170754 26.628966069462518 23.9015113602242 145-149 20.71 28.050000000000004 26.924999999999997 24.315 150-151 21.0 28.1625 26.325 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 1.0 19 1.5 20 2.0 21 1.5 22 2.0 23 3.0 24 4.5 25 5.5 26 6.0 27 11.5 28 13.0 29 17.0 30 20.0 31 30.5 32 44.0 33 47.5 34 64.0 35 78.0 36 87.5 37 112.0 38 129.5 39 149.0 40 184.5 41 220.0 42 237.5 43 251.5 44 269.0 45 272.0 46 254.0 47 225.5 48 212.0 49 205.5 50 184.5 51 136.0 52 107.0 53 89.0 54 72.5 55 64.5 56 46.0 57 37.0 58 28.5 59 20.0 60 17.5 61 13.5 62 6.5 63 4.0 64 4.0 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.05 40-44 0.06 45-49 0.06 50-54 0.065 55-59 0.15 60-64 0.17500000000000002 65-69 0.16999999999999998 70-74 0.19499999999999998 75-79 0.17500000000000002 80-84 0.15 85-89 0.12 90-94 0.08499999999999999 95-99 0.095 100-104 0.245 105-109 0.17500000000000002 110-114 0.265 115-119 0.13999999999999999 120-124 0.0 125-129 0.01 130-134 0.335 135-139 0.485 140-144 0.09 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.7000000000000002 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.5250000000000004 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.1625 0.0 0.0 0.0 0.0 114-115 3.65 0.0 0.0 0.0 0.0 116-117 4.0875 0.0 0.0 0.0 0.0 118-119 4.675000000000001 0.0 0.0 0.0 0.0 120-121 4.9875 0.0 0.0 0.0 0.0 122-123 5.4625 0.0 0.0 0.0 0.0 124-125 5.9375 0.0 0.0 0.0 0.0 126-127 6.300000000000001 0.0 0.0 0.0 0.0 128-129 6.775 0.0 0.0 0.0 0.0 130-131 7.1875 0.0 0.0 0.0 0.0 132-133 7.725 0.0 0.0 0.0 0.0 134-135 8.3875 0.0 0.0 0.0 0.0 136-137 9.0125 0.0 0.0 0.0 0.0 138-139 9.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGGAT 10 0.0069899606 143.8875 6 >>END_MODULE SRR7172477 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172477_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.51575 33.0 33.0 34.0 32.0 34.0 2 32.577 34.0 33.0 34.0 32.0 34.0 3 32.565 34.0 33.0 34.0 32.0 34.0 4 32.49925 34.0 33.0 34.0 32.0 34.0 5 32.5165 34.0 33.0 34.0 32.0 34.0 6 36.438 38.0 38.0 38.0 35.0 38.0 7 36.62775 38.0 38.0 38.0 36.0 38.0 8 36.6555 38.0 38.0 38.0 36.0 38.0 9 36.5635 38.0 38.0 38.0 36.0 38.0 10-14 36.55195 38.0 38.0 38.0 36.0 38.0 15-19 36.5318 38.0 38.0 38.0 36.0 38.0 20-24 36.5334 38.0 38.0 38.0 36.0 38.0 25-29 36.533550000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.474000000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.445800000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.392450000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.3512 38.0 38.0 38.0 35.8 38.0 50-54 36.400850000000005 38.0 38.0 38.0 35.8 38.0 55-59 36.304050000000004 38.0 38.0 38.0 35.6 38.0 60-64 36.26835 38.0 38.0 38.0 35.2 38.0 65-69 36.2313 38.0 38.0 38.0 35.0 38.0 70-74 36.1485 38.0 38.0 38.0 34.4 38.0 75-79 36.0855 38.0 38.0 38.0 34.4 38.0 80-84 35.9889 38.0 38.0 38.0 34.0 38.0 85-89 35.8456 38.0 38.0 38.0 34.0 38.0 90-94 35.65665 38.0 38.0 38.0 33.2 38.0 95-99 35.5704 38.0 38.0 38.0 33.0 38.0 100-104 35.4067 38.0 38.0 38.0 31.2 38.0 105-109 35.28085 38.0 37.6 38.0 30.4 38.0 110-114 35.0271 38.0 37.0 38.0 28.4 38.0 115-119 34.9027 38.0 37.0 38.0 28.2 38.0 120-124 34.55785 38.0 36.2 38.0 26.2 38.0 125-129 34.278499999999994 38.0 36.0 38.0 24.2 38.0 130-134 33.814150000000005 38.0 35.2 38.0 19.4 38.0 135-139 33.360800000000005 38.0 33.8 38.0 15.0 38.0 140-144 32.7247 38.0 33.2 38.0 13.2 38.0 145-149 31.666999999999994 38.0 32.2 38.0 6.4 38.0 150-151 26.9675 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 14.0 4 7.0 5 6.0 6 3.0 7 7.0 8 2.0 9 3.0 10 3.0 11 4.0 12 6.0 13 6.0 14 5.0 15 6.0 16 2.0 17 8.0 18 7.0 19 9.0 20 8.0 21 11.0 22 15.0 23 15.0 24 13.0 25 21.0 26 18.0 27 33.0 28 31.0 29 39.0 30 52.0 31 64.0 32 68.0 33 88.0 34 124.0 35 237.0 36 558.0 37 2470.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.08224674022066 21.113340020060182 12.36208625877633 22.442326980942827 2 26.15461847389558 24.673694779116463 31.852409638554217 17.319277108433734 3 21.351419241396634 27.781964330570208 31.298668676212003 19.567947751821148 4 24.34673366834171 35.77889447236181 21.608040201005025 18.266331658291456 5 22.883697563426274 37.779452398894755 23.21024868123587 16.126601356443103 6 20.39225546894644 36.333920040231334 24.490822227809907 18.78300226301232 7 20.361990950226243 20.28657616892911 38.863750628456515 20.487682252388133 8 20.105554159336517 24.327720532797183 28.625282734355366 26.941442573510933 9 21.750062861453358 24.893135529293435 28.84083480010058 24.51596680915263 10-14 23.708955599135116 28.626741087142353 26.047166490672296 21.617136823050235 15-19 23.269143747800292 28.588667102418423 27.4372768867213 20.70491226305998 20-24 22.99145299145299 28.320764203117143 27.682252388134742 21.005530417295123 25-29 23.639105302839912 27.811007790902238 27.650163357627545 20.89972354863031 30-34 22.756055885013566 28.76168459141622 27.560558850135692 20.921700673434515 35-39 23.096255340537823 27.986931389796432 28.007036943955764 20.909776325709977 40-44 22.794931107311676 27.748164537865833 28.432062757719002 21.02484159710349 45-49 23.325286662643332 27.534701267350638 28.082880708107023 21.057131361899014 50-54 23.44213649851632 27.249409042900968 28.632500125735554 20.675954332847155 55-59 23.641208708331238 27.527779174418022 28.04062547136608 20.79038664588466 60-64 23.117522871217453 27.96320498642807 27.8878053684528 21.031466773901677 65-69 23.57437393140903 27.411244091320526 27.863823795635117 21.150558181635322 70-74 22.71561478501383 28.136786522504398 28.001005783253706 21.146592909228062 75-79 23.575845944994718 27.59816984262658 28.04062547136608 20.78535874101262 80-84 23.649803882128133 28.462234738006636 26.93352107009957 20.954440309765666 85-89 23.58770561899492 27.682478997937523 27.813270285225617 20.916545097841944 90-94 23.198832763131414 28.18977661501308 27.867780237472328 20.743610384383178 95-99 23.5874213836478 28.085534591194968 27.275471698113208 21.051572327044024 100-104 23.756600452602463 28.12672868996731 27.784762383706312 20.33190847372391 105-109 24.17416662476746 27.397053647744983 28.337271858816433 20.091507868671123 110-114 24.497285340840538 27.588980494671222 27.50351900261412 20.41021516187412 115-119 24.813958165728078 27.74537409493162 27.353177795655668 20.087489943684634 120-124 24.659325187308294 27.520490772866697 27.636144214813697 20.18403982501131 125-129 24.57516339869281 28.03921568627451 27.07390648567119 20.311714429361487 130-134 25.341777241656615 27.98552472858866 27.261761158021713 19.41093687173301 135-139 24.644383010806735 27.29328977129932 27.48931892435285 20.57300829354109 140-144 25.266599597585515 27.48993963782696 27.263581488933603 19.97987927565392 145-149 25.822682902284395 27.659253295763307 26.904498339539096 19.613565462413206 150-151 25.735849056603772 27.660377358490567 26.528301886792455 20.075471698113205 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 13.0 1 9.5 2 3.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 2.0 21 2.5 22 1.0 23 2.0 24 4.0 25 4.5 26 5.0 27 5.0 28 10.5 29 14.5 30 16.5 31 24.5 32 27.5 33 29.0 34 51.0 35 68.5 36 76.5 37 95.5 38 121.5 39 159.5 40 205.5 41 225.5 42 222.5 43 257.5 44 273.5 45 243.5 46 244.5 47 247.0 48 224.5 49 218.0 50 185.0 51 138.5 52 119.0 53 103.0 54 90.5 55 74.5 56 54.0 57 34.5 58 24.5 59 20.0 60 13.5 61 10.5 62 8.0 63 4.0 64 4.0 65 2.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.4 3 0.475 4 0.5 5 0.475 6 0.575 7 0.5499999999999999 8 0.525 9 0.575 10-14 0.565 15-19 0.555 20-24 0.5499999999999999 25-29 0.525 30-34 0.51 35-39 0.525 40-44 0.5700000000000001 45-49 0.58 50-54 0.585 55-59 0.555 60-64 0.53 65-69 0.5700000000000001 70-74 0.575 75-79 0.555 80-84 0.5700000000000001 85-89 0.605 90-94 0.62 95-99 0.625 100-104 0.575 105-109 0.555 110-114 0.54 115-119 0.5599999999999999 120-124 0.565 125-129 0.5499999999999999 130-134 0.52 135-139 0.525 140-144 0.6 145-149 0.63 150-151 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2412746585736 98.1 2 0.6322711178553364 1.25 3 0.05058168942842691 0.15 4 0.05058168942842691 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025290844714213456 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.9874999999999998 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.75 0.0 0.0 0.0 0.0 112-113 3.0875 0.0 0.0 0.0 0.0 114-115 3.525 0.0 0.0 0.0 0.0 116-117 4.0375 0.0 0.0 0.0 0.0 118-119 4.65 0.0 0.0 0.0 0.0 120-121 4.9875 0.0 0.0 0.0 0.0 122-123 5.4875 0.0 0.0 0.0 0.0 124-125 5.9375 0.0 0.0 0.0 0.0 126-127 6.300000000000001 0.0 0.0 0.0 0.0 128-129 6.7625 0.0 0.0 0.0 0.0 130-131 7.175000000000001 0.0 0.0 0.0 0.0 132-133 7.675000000000001 0.0 0.0 0.0 0.0 134-135 8.3625 0.0 0.0 0.0 0.0 136-137 8.962499999999999 0.0 0.0 0.0 0.0 138-139 9.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661751 spots for SRR7172477.sra Written 661751 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra Read 661744 spots for SRR7172477.sra Written 661744 spots for SRR7172477.sra SRR ids: ['SRR7172477.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kjhb_zza SRR7172477.sra spots: 13234887 blocks: [[1, 661744], [661745, 1323488], [1323489, 1985232], [1985233, 2646976], [2646977, 3308720], [3308721, 3970464], [3970465, 4632208], [4632209, 5293952], [5293953, 5955696], [5955697, 6617440], [6617441, 7279184], [7279185, 7940928], [7940929, 8602672], [8602673, 9264416], [9264417, 9926160], [9926161, 10587904], [10587905, 11249648], [11249649, 11911392], [11911393, 12573136], [12573137, 13234887]] SRR7172477 file size 4463168 SRR7172477 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172477 SRR7172477_1.fastq SRR7172477_2.fastq Input file: SRR7172477_1.fastq Paired file: SRR7172477_2.fastq trimmed: SRR7172477-trimmed-pair1.fastq, SRR7172477-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:03:21 2025 >> started Mon Feb 10 11:03:35 2025 >> done (14.335s) 13234887 read pairs processed; of these: 35879 ( 0.27%) short read pairs filtered out after trimming by size control 81655 ( 0.62%) empty read pairs filtered out after trimming by size control 13117353 (99.11%) read pairs available; of these: 6846176 (52.19%) trimmed read pairs available after processing 6271177 (47.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 8 0.00% 21 4 0.00% 22 11 0.00% 23 6 0.00% 24 16 0.00% 25 5 0.00% 26 14 0.00% 27 17 0.00% 28 9 0.00% 29 10 0.00% 30 15 0.00% 31 10 0.00% 32 11 0.00% 33 23 0.00% 34 16 0.00% 35 12 0.00% 36 24 0.00% 37 52 0.00% 38 24 0.00% 39 42 0.00% 40 40 0.00% 41 35 0.00% 42 48 0.00% 43 48 0.00% 44 65 0.00% 45 154 0.00% 46 105 0.00% 47 107 0.00% 48 130 0.00% 49 108 0.00% 50 137 0.00% 51 171 0.00% 52 168 0.00% 53 191 0.00% 54 203 0.00% 55 225 0.00% 56 263 0.00% 57 310 0.00% 58 350 0.00% 59 424 0.00% 60 495 0.00% 61 515 0.00% 62 604 0.00% 63 673 0.01% 64 780 0.01% 65 852 0.01% 66 988 0.01% 67 1153 0.01% 68 1361 0.01% 69 1976 0.02% 70 2303 0.02% 71 2075 0.02% 72 2168 0.02% 73 2448 0.02% 74 2635 0.02% 75 2814 0.02% 76 3011 0.02% 77 3345 0.03% 78 3678 0.03% 79 4184 0.03% 80 4722 0.04% 81 5160 0.04% 82 5814 0.04% 83 6638 0.05% 84 8506 0.06% 85 9525 0.07% 86 9852 0.08% 87 10242 0.08% 88 10616 0.08% 89 11282 0.09% 90 11979 0.09% 91 12818 0.10% 92 13624 0.10% 93 15050 0.11% 94 15983 0.12% 95 16115 0.12% 96 16216 0.12% 97 16812 0.13% 98 17280 0.13% 99 17968 0.14% 100 19304 0.15% 101 19808 0.15% 102 20967 0.16% 103 22406 0.17% 104 23195 0.18% 105 24219 0.18% 106 24932 0.19% 107 25396 0.19% 108 25921 0.20% 109 26693 0.20% 110 27574 0.21% 111 28749 0.22% 112 29897 0.23% 113 31480 0.24% 114 32305 0.25% 115 34298 0.26% 116 34883 0.27% 117 35492 0.27% 118 36015 0.27% 119 36702 0.28% 120 37928 0.29% 121 39193 0.30% 122 40310 0.31% 123 42592 0.32% 124 44399 0.34% 125 45557 0.35% 126 47329 0.36% 127 47507 0.36% 128 48981 0.37% 129 50953 0.39% 130 52210 0.40% 131 53471 0.41% 132 56588 0.43% 133 58653 0.45% 134 61137 0.47% 135 64330 0.49% 136 67037 0.51% 137 70518 0.54% 138 74588 0.57% 139 78081 0.60% 140 81658 0.62% 141 87490 0.67% 142 94907 0.72% 143 105872 0.81% 144 119159 0.91% 145 139072 1.06% 146 167884 1.28% 147 221239 1.69% 148 327961 2.50% 149 642098 4.90% 150 2939353 22.41% 151 6271177 47.81% 13117353 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=42 prefix-density=0.55 prefix-fanout=1.3 sequence=GTAATGTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCTGTGCAGGGGTGCGGTTAACTGTGGCAACGGCCGCCGATGAAATCACAGAGGAAGCCATCTCTTACAGGCTACTTAGCTATTACACCCTCTATATGTGGTTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=100.46 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=6.6 sequence=AAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=27 prefix-density=0.39 prefix-fanout=2.9 sequence=ACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=82.36 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCT SRR7172477 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:04:19 Started mapping on | Feb 10 11:04:19 Finished on | Feb 10 11:06:17 Mapping speed, Million of reads per hour | 400.19 Number of input reads | 13117353 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11969137 Uniquely mapped reads % | 91.25% Average mapped length | 290.16 Number of splices: Total | 10541930 Number of splices: Annotated (sjdb) | 10288183 Number of splices: GT/AG | 10326231 Number of splices: GC/AG | 173721 Number of splices: AT/AC | 7653 Number of splices: Non-canonical | 34325 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336895 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 93555 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.31% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 839073 839073 839073 N_multimapping 336895 336895 336895 N_noFeature 526205 11762784 616803 N_ambiguous 205619 1216 88959 UnstrandedReadsAssigned:11237313 PositiveStrandReadsAssigned:205137 NegativeStrandReadsAssigned:11263375 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172477 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172477-trimmed-pair1.fastq SRR7172477-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,117,353 reads, 11,359,369 reads pseudoaligned [quant] estimated average fragment length: 234.162 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR7172477.ke.tsv 34699 SRR7172477.se.tsv 87100 total ==> SRR7172477.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.84 431.625 20.0131 Potri.005G024800.1.v4.1 1035 801.838 321 33.1302 Potri.004G059700.1.v4.1 961 727.895 5 0.568469 Potri.007G009000.2.v4.1 1416 1182.84 0 0 Potri.003G141000.2.v4.1 2943 2709.84 286.643 8.75394 Potri.016G087400.1.v4.1 270 89.8917 559.717 515.293 Potri.015G069301.1.v4.1 564 337.802 0 0 Potri.010G195200.1.v4.1 1773 1539.84 6 0.322464 Potri.012G127500.1.v4.1 977 743.875 292 32.4854 ==> SRR7172477.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 107 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 271 Potri.001G212900.v4.1 190 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7172477 completed mapping pipeline successfully