Starting /dee2/code/volunteer_pipeline.sh SRR7172478 current disk space = 3058819633152 free memory = 1328724220 SRR7172478 SRAfilesize ca6b5424d762cc5f021053eefd6ed8d2 SRR7172478.sra SRR7172478.sra file validated SRR7172478 is paired end SRR7172478 is conventional basespace SRR7172478 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172478_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97675 34.0 34.0 34.0 33.0 34.0 2 33.46525 34.0 34.0 34.0 33.0 34.0 3 33.45425 34.0 34.0 34.0 33.0 34.0 4 33.52575 34.0 34.0 34.0 33.0 34.0 5 33.529 34.0 34.0 34.0 33.0 34.0 6 37.229 38.0 38.0 38.0 36.0 38.0 7 37.50425 38.0 38.0 38.0 37.0 38.0 8 37.54225 38.0 38.0 38.0 38.0 38.0 9 37.59425 38.0 38.0 38.0 38.0 38.0 10-14 37.543 38.0 38.0 38.0 38.0 38.0 15-19 37.5641 38.0 38.0 38.0 38.0 38.0 20-24 37.59685 38.0 38.0 38.0 38.0 38.0 25-29 37.5397 38.0 38.0 38.0 38.0 38.0 30-34 37.48035 38.0 38.0 38.0 37.8 38.0 35-39 37.42635 38.0 38.0 38.0 37.4 38.0 40-44 37.261900000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.2121 38.0 38.0 38.0 36.6 38.0 50-54 37.05365 38.0 38.0 38.0 36.0 38.0 55-59 37.060050000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.037549999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.921850000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.891549999999995 38.0 38.0 38.0 35.6 38.0 75-79 36.7217 38.0 38.0 38.0 35.0 38.0 80-84 36.6284 38.0 38.0 38.0 34.2 38.0 85-89 36.52065 38.0 38.0 38.0 34.4 38.0 90-94 36.3987 38.0 38.0 38.0 34.0 38.0 95-99 36.295899999999996 38.0 37.8 38.0 33.8 38.0 100-104 36.04255 38.0 37.2 38.0 32.8 38.0 105-109 35.81445 38.0 37.0 38.0 31.6 38.0 110-114 35.4154 38.0 36.0 38.0 29.8 38.0 115-119 35.578450000000004 38.0 36.6 38.0 31.0 38.0 120-124 35.26955 38.0 36.0 38.0 29.2 38.0 125-129 34.91495 38.0 35.8 38.0 28.0 38.0 130-134 34.51875 38.0 35.0 38.0 25.8 38.0 135-139 34.22305 38.0 34.8 38.0 24.6 38.0 140-144 33.56525 38.0 33.8 38.0 21.6 38.0 145-149 32.46865 38.0 33.2 38.0 13.6 38.0 150-151 28.0785 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 1.0 14 4.0 15 1.0 16 3.0 17 5.0 18 3.0 19 4.0 20 5.0 21 6.0 22 11.0 23 11.0 24 12.0 25 15.0 26 22.0 27 25.0 28 23.0 29 38.0 30 45.0 31 68.0 32 75.0 33 106.0 34 168.0 35 302.0 36 776.0 37 2267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.55360325948561 14.642220524573466 8.276037687802393 38.52813852813853 2 21.0 20.3 35.6 23.1 3 19.0 24.625 26.474999999999998 29.9 4 22.125 33.550000000000004 22.75 21.575 5 20.75 36.925000000000004 24.75 17.575 6 16.400000000000002 36.9 26.5 20.200000000000003 7 14.674999999999999 22.6 44.125 18.6 8 16.25 23.225 32.725 27.800000000000004 9 17.275 23.799999999999997 32.9 26.025 10-14 20.1 29.26 26.840000000000003 23.799999999999997 15-19 20.06 27.495000000000005 28.4 24.044999999999998 20-24 20.064999999999998 28.765 27.500000000000004 23.669999999999998 25-29 20.125 28.455000000000002 27.339999999999996 24.08 30-34 19.675 28.73 27.169999999999998 24.425 35-39 19.975 28.655 27.705000000000002 23.665 40-44 20.135 28.199999999999996 28.115000000000002 23.549999999999997 45-49 20.225 28.865000000000002 27.875 23.035 50-54 20.485 28.189999999999998 28.265 23.06 55-59 19.900000000000002 28.499999999999996 27.665 23.935000000000002 60-64 20.16 28.71 27.185 23.945 65-69 19.865 28.804999999999996 27.37 23.96 70-74 19.895 28.999999999999996 27.365000000000002 23.74 75-79 20.085 28.98 27.21 23.724999999999998 80-84 20.24 28.599999999999998 27.894999999999996 23.265 85-89 19.814999999999998 28.955 27.810000000000002 23.419999999999998 90-94 20.26 28.665000000000003 27.63 23.445 95-99 20.565 28.27 28.09 23.075000000000003 100-104 20.187112267360416 29.142485491294778 26.776065639383628 23.89433660196118 105-109 20.62 27.944999999999997 28.155 23.28 110-114 20.432800681260332 28.07694234333517 27.886590191854932 23.603666783549567 115-119 20.985 28.59 27.365000000000002 23.06 120-124 21.415 28.185 27.334999999999997 23.064999999999998 125-129 21.085 27.99 27.265 23.66 130-134 21.0 28.904999999999998 26.565 23.53 135-139 20.9 28.050000000000004 27.32 23.73 140-144 20.880000000000003 28.605000000000004 26.884999999999998 23.630000000000003 145-149 21.15 28.95 26.634999999999998 23.265 150-151 20.6875 29.349999999999998 27.125 22.8375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 1.5 23 3.0 24 6.0 25 9.0 26 7.5 27 7.5 28 13.5 29 20.0 30 24.0 31 27.0 32 32.0 33 42.0 34 62.5 35 78.0 36 86.5 37 103.5 38 130.5 39 154.0 40 191.0 41 233.0 42 238.0 43 236.0 44 250.5 45 283.0 46 281.5 47 240.5 48 223.0 49 203.5 50 169.0 51 139.0 52 110.0 53 88.5 54 68.5 55 59.5 56 51.0 57 28.0 58 21.5 59 19.0 60 12.5 61 10.5 62 8.5 63 6.5 64 5.0 65 3.0 66 0.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 0.0 110-114 0.185 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.42767295597484273 0.8500000000000001 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.3499999999999996 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.9124999999999996 0.0 0.0 0.0 0.0 118-119 3.3 0.0 0.0 0.0 0.0 120-121 3.5625 0.0 0.0 0.0 0.0 122-123 3.95 0.0 0.0 0.0 0.0 124-125 4.3375 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.3125 0.0 0.0 0.0 0.0 130-131 5.7125 0.0 0.0 0.0 0.0 132-133 6.1625 0.0 0.0 0.0 0.0 134-135 6.5125 0.0 0.0 0.0 0.0 136-137 6.887499999999999 0.0 0.0 0.0 0.0 138-139 7.387499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGTGA 10 0.0068590776 144.79999 9 TGCAGTG 10 0.0068590776 144.79999 8 >>END_MODULE SRR7172478 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172478_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6395 33.0 33.0 34.0 32.0 34.0 2 32.77125 34.0 33.0 34.0 32.0 34.0 3 32.80425 34.0 33.0 34.0 32.0 34.0 4 32.66125 34.0 33.0 34.0 32.0 34.0 5 32.7795 34.0 33.0 34.0 32.0 34.0 6 36.96725 38.0 38.0 38.0 37.0 38.0 7 36.97575 38.0 38.0 38.0 37.0 38.0 8 37.00575 38.0 38.0 38.0 37.0 38.0 9 37.0565 38.0 38.0 38.0 37.0 38.0 10-14 36.9809 38.0 38.0 38.0 37.0 38.0 15-19 36.975649999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.02230000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.0102 38.0 38.0 38.0 37.0 38.0 30-34 36.9739 38.0 38.0 38.0 37.0 38.0 35-39 36.9291 38.0 38.0 38.0 37.0 38.0 40-44 36.910000000000004 38.0 38.0 38.0 37.0 38.0 45-49 36.89785 38.0 38.0 38.0 37.0 38.0 50-54 36.8266 38.0 38.0 38.0 37.0 38.0 55-59 36.74845 38.0 38.0 38.0 36.2 38.0 60-64 36.733799999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.69199999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.67575 38.0 38.0 38.0 36.0 38.0 75-79 36.4437 38.0 38.0 38.0 34.8 38.0 80-84 36.48015 38.0 38.0 38.0 35.0 38.0 85-89 36.5036 38.0 38.0 38.0 35.0 38.0 90-94 36.3116 38.0 38.0 38.0 34.4 38.0 95-99 36.1048 38.0 38.0 38.0 33.8 38.0 100-104 36.13695 38.0 38.0 38.0 34.0 38.0 105-109 35.85105 38.0 38.0 38.0 33.2 38.0 110-114 35.8166 38.0 38.0 38.0 33.2 38.0 115-119 35.6233 38.0 37.8 38.0 31.8 38.0 120-124 35.29175 38.0 37.0 38.0 30.6 38.0 125-129 35.0948 38.0 36.6 38.0 29.0 38.0 130-134 34.66510000000001 38.0 36.0 38.0 27.0 38.0 135-139 34.144400000000005 38.0 35.4 38.0 23.2 38.0 140-144 33.4257 38.0 33.8 38.0 18.2 38.0 145-149 32.56765 38.0 33.0 38.0 10.8 38.0 150-151 28.706625000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 2.0 4 1.0 5 1.0 6 5.0 7 5.0 8 1.0 9 0.0 10 2.0 11 2.0 12 1.0 13 5.0 14 5.0 15 2.0 16 3.0 17 5.0 18 7.0 19 6.0 20 7.0 21 9.0 22 8.0 23 14.0 24 10.0 25 15.0 26 22.0 27 34.0 28 26.0 29 38.0 30 60.0 31 52.0 32 68.0 33 84.0 34 103.0 35 213.0 36 491.0 37 2670.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.79245283018868 20.955974842767294 10.69182389937107 29.559748427672954 2 23.50868361439718 27.46035741253461 34.15554996224516 14.875409010823057 3 21.369242386106215 27.71205638056884 30.933803171407 19.984898061917946 4 23.68487289202114 35.187515731185506 22.124339290208912 19.003272086584445 5 23.105965265542412 38.937830354895546 21.5706015605336 16.385602819028442 6 18.914845516201957 38.10600351670435 24.415975885455914 18.563175081637777 7 17.985430796282344 19.417231851293646 41.748304446119064 20.84903290630495 8 20.07537688442211 24.07035175879397 30.025125628140703 25.829145728643216 9 21.482412060301506 26.231155778894472 28.79396984924623 23.492462311557787 10-14 23.169322008342967 28.345981806302454 26.843242699904508 21.641453485450068 15-19 22.552913377909608 27.751244281333264 28.35453220049268 21.34131014026444 20-24 22.996130458817028 27.961204080607065 28.1421176943565 20.900547766219407 25-29 22.06148282097649 28.00884066706851 28.767329716696803 21.162346795258188 30-34 22.069311903566046 28.242089402310395 28.513309894525364 21.175288799598192 35-39 22.24622030237581 28.062685217740718 28.534833492390376 21.156260987493095 40-44 23.0428880285585 27.980290612901605 28.30207652471215 20.674744833827745 45-49 23.106708236950617 27.974454390023133 27.934225082972947 20.984612290053303 50-54 22.725444857746055 28.114004222378608 28.480949029858248 20.67960189001709 55-59 22.740290408481133 27.634025021353565 28.402753353765764 21.222931216399537 60-64 22.984924623115578 27.869346733668344 28.33668341708543 20.809045226130653 65-69 23.374535222590694 27.64043814691991 28.21826952065119 20.766757109838206 70-74 23.327469213370193 27.439055038954514 28.35385775320432 20.879617994470973 75-79 23.493037051933037 27.74118948268061 27.705997687396312 21.059775777990044 80-84 23.433571356733378 28.472292064769185 27.69284924067183 20.401287337825604 85-89 23.393342049683195 27.994569043548225 27.964397063260588 20.647691843507996 90-94 22.806135277847623 27.648981644455624 28.292682926829265 21.252200150867488 95-99 23.122957002765904 28.116670857430226 27.799849132511945 20.96052300729193 100-104 23.430036703705564 28.09090452008648 28.080848710342398 20.398210065865555 105-109 23.771687201408096 27.78979129997485 28.177017852652753 20.261503645964293 110-114 23.534144624358845 27.914110429447852 27.934225082972947 20.61751986322036 115-119 24.314810158410864 28.151873271310034 27.347246668342972 20.186069901936133 120-124 23.999597828272673 27.769957771968627 27.87050070380052 20.359943695958176 125-129 24.425677373950634 27.607701201427638 27.43678680943045 20.529834615191273 130-134 24.96608551474652 28.22187609908054 26.759784957041653 20.052253429131287 135-139 25.006280460232126 27.523488921268154 27.563683866753756 19.906546751745967 140-144 25.01885843600704 28.30274075936636 26.869499622831277 19.808901181795324 145-149 25.204928337943173 27.799849132511945 27.4528539099824 19.542368619562485 150-151 26.31380437515715 28.187075685189843 26.26351521247171 19.235604727181293 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 18.0 1 9.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.5 18 1.0 19 1.5 20 2.0 21 1.0 22 0.5 23 1.5 24 2.0 25 7.0 26 13.0 27 11.5 28 11.5 29 12.0 30 19.5 31 27.0 32 26.5 33 39.5 34 54.5 35 62.0 36 84.5 37 105.0 38 137.0 39 174.0 40 198.0 41 225.0 42 252.0 43 278.5 44 280.0 45 269.0 46 265.0 47 246.5 48 212.5 49 181.0 50 149.0 51 116.5 52 94.0 53 87.5 54 89.0 55 70.5 56 45.0 57 32.0 58 20.5 59 17.5 60 18.5 61 14.0 62 8.5 63 5.0 64 3.0 65 2.5 66 1.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.675 3 0.675 4 0.675 5 0.675 6 0.475 7 0.475 8 0.5 9 0.5 10-14 0.515 15-19 0.545 20-24 0.505 25-29 0.45999999999999996 30-34 0.44999999999999996 35-39 0.455 40-44 0.555 45-49 0.5700000000000001 50-54 0.53 55-59 0.485 60-64 0.5 65-69 0.49 70-74 0.525 75-79 0.545 80-84 0.5700000000000001 85-89 0.5700000000000001 90-94 0.575 95-99 0.575 100-104 0.555 105-109 0.575 110-114 0.5700000000000001 115-119 0.575 120-124 0.54 125-129 0.5349999999999999 130-134 0.485 135-139 0.485 140-144 0.575 145-149 0.575 150-151 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34193874968362 98.125 2 0.5062009617818274 1.0 3 0.07593014426727411 0.22499999999999998 4 0.02531004808909137 0.1 5 0.02531004808909137 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02531004808909137 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 17 0.42500000000000004 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 1.7999999999999998 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.9625000000000004 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.6375 0.0 0.0 0.0 0.0 122-123 4.0 0.0 0.0 0.0 0.0 124-125 4.3875 0.0 0.0 0.0 0.0 126-127 4.85 0.0 0.0 0.0 0.0 128-129 5.3625 0.0 0.0 0.0 0.0 130-131 5.775 0.0 0.0 0.0 0.0 132-133 6.2 0.0 0.0 0.0 0.0 134-135 6.525 0.0 0.0 0.0 0.0 136-137 6.8625 0.0 0.0 0.0 0.0 138-139 7.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTGCT 10 0.00682755 145.0 8 >>END_MODULE Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835208 spots for SRR7172478.sra Written 835208 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra Read 835197 spots for SRR7172478.sra Written 835197 spots for SRR7172478.sra SRR ids: ['SRR7172478.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_18cvbchy SRR7172478.sra spots: 16703951 blocks: [[1, 835197], [835198, 1670394], [1670395, 2505591], [2505592, 3340788], [3340789, 4175985], [4175986, 5011182], [5011183, 5846379], [5846380, 6681576], [6681577, 7516773], [7516774, 8351970], [8351971, 9187167], [9187168, 10022364], [10022365, 10857561], [10857562, 11692758], [11692759, 12527955], [12527956, 13363152], [13363153, 14198349], [14198350, 15033546], [15033547, 15868743], [15868744, 16703951]] SRR7172478 file size 5638720 SRR7172478 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172478 SRR7172478_1.fastq SRR7172478_2.fastq Input file: SRR7172478_1.fastq Paired file: SRR7172478_2.fastq trimmed: SRR7172478-trimmed-pair1.fastq, SRR7172478-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:01:52 2025 >> started Mon Feb 10 11:02:09 2025 >> done (17.420s) 16703951 read pairs processed; of these: 19631 ( 0.12%) short read pairs filtered out after trimming by size control 108606 ( 0.65%) empty read pairs filtered out after trimming by size control 16575714 (99.23%) read pairs available; of these: 8901265 (53.70%) trimmed read pairs available after processing 7674449 (46.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 5 0.00% 21 10 0.00% 22 7 0.00% 23 11 0.00% 24 8 0.00% 25 8 0.00% 26 8 0.00% 27 13 0.00% 28 9 0.00% 29 10 0.00% 30 13 0.00% 31 12 0.00% 32 8 0.00% 33 10 0.00% 34 12 0.00% 35 17 0.00% 36 15 0.00% 37 14 0.00% 38 21 0.00% 39 24 0.00% 40 36 0.00% 41 33 0.00% 42 28 0.00% 43 33 0.00% 44 36 0.00% 45 56 0.00% 46 48 0.00% 47 53 0.00% 48 86 0.00% 49 61 0.00% 50 95 0.00% 51 107 0.00% 52 129 0.00% 53 125 0.00% 54 123 0.00% 55 133 0.00% 56 158 0.00% 57 171 0.00% 58 229 0.00% 59 259 0.00% 60 287 0.00% 61 371 0.00% 62 404 0.00% 63 435 0.00% 64 558 0.00% 65 585 0.00% 66 671 0.00% 67 703 0.00% 68 825 0.00% 69 998 0.01% 70 1039 0.01% 71 1260 0.01% 72 1313 0.01% 73 1481 0.01% 74 1657 0.01% 75 1938 0.01% 76 2043 0.01% 77 2201 0.01% 78 2477 0.01% 79 2844 0.02% 80 3098 0.02% 81 3525 0.02% 82 4187 0.03% 83 4608 0.03% 84 5739 0.03% 85 6367 0.04% 86 6957 0.04% 87 7458 0.04% 88 7949 0.05% 89 8436 0.05% 90 8984 0.05% 91 9548 0.06% 92 10537 0.06% 93 11763 0.07% 94 12517 0.08% 95 13350 0.08% 96 13514 0.08% 97 14167 0.09% 98 14563 0.09% 99 15568 0.09% 100 16476 0.10% 101 17195 0.10% 102 18311 0.11% 103 19499 0.12% 104 20768 0.13% 105 21847 0.13% 106 23094 0.14% 107 23667 0.14% 108 24713 0.15% 109 25825 0.16% 110 26647 0.16% 111 27972 0.17% 112 28942 0.17% 113 30917 0.19% 114 32317 0.19% 115 33807 0.20% 116 35008 0.21% 117 36014 0.22% 118 37101 0.22% 119 38483 0.23% 120 39903 0.24% 121 41664 0.25% 122 42973 0.26% 123 45230 0.27% 124 46976 0.28% 125 49032 0.30% 126 51320 0.31% 127 52632 0.32% 128 55144 0.33% 129 57031 0.34% 130 59135 0.36% 131 61481 0.37% 132 64499 0.39% 133 68249 0.41% 134 72410 0.44% 135 76082 0.46% 136 80033 0.48% 137 85293 0.51% 138 91864 0.55% 139 97784 0.59% 140 105030 0.63% 141 115018 0.69% 142 126557 0.76% 143 142422 0.86% 144 164339 0.99% 145 194503 1.17% 146 240308 1.45% 147 321451 1.94% 148 494454 2.98% 149 939983 5.67% 150 4070691 24.56% 151 7674449 46.30% 16575714 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=14 prefix-density=0.38 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=288.23 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=17.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=20 prefix-density=0.37 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=18.88 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.5 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7172478 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:02:55 Started mapping on | Feb 10 11:02:55 Finished on | Feb 10 11:04:47 Mapping speed, Million of reads per hour | 532.79 Number of input reads | 16575714 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15494953 Uniquely mapped reads % | 93.48% Average mapped length | 292.16 Number of splices: Total | 14819353 Number of splices: Annotated (sjdb) | 14432179 Number of splices: GT/AG | 14532872 Number of splices: GC/AG | 225034 Number of splices: AT/AC | 8614 Number of splices: Non-canonical | 52833 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 420038 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 112384 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 678239 678239 678239 N_multimapping 420038 420038 420038 N_noFeature 750129 15214858 870692 N_ambiguous 277650 1172 117315 UnstrandedReadsAssigned:14467174 PositiveStrandReadsAssigned:278923 NegativeStrandReadsAssigned:14506946 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172478 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172478-trimmed-pair1.fastq SRR7172478-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,575,714 reads, 14,524,569 reads pseudoaligned [quant] estimated average fragment length: 241.987 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR7172478.ke.tsv 34699 SRR7172478.se.tsv 87100 total ==> SRR7172478.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.01 709 25.2268 Potri.005G024800.1.v4.1 1035 794.013 136 10.8297 Potri.004G059700.1.v4.1 961 720.16 2 0.175593 Potri.007G009000.2.v4.1 1416 1175.01 0 0 Potri.003G141000.2.v4.1 2943 2702.01 689.378 16.1316 Potri.016G087400.1.v4.1 270 84.3108 654 490.457 Potri.015G069301.1.v4.1 564 331.127 0 0 Potri.010G195200.1.v4.1 1773 1532.01 34 1.40321 Potri.012G127500.1.v4.1 977 736.103 100 8.5895 ==> SRR7172478.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 520 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 283 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 29 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7172478 completed mapping pipeline successfully