Starting /dee2/code/volunteer_pipeline.sh SRR7172479 current disk space = 3058891857920 free memory = 1410159308 SRR7172479 SRAfilesize b6e6b6603c76be36edf41412f5f1117b SRR7172479.sra SRR7172479.sra file validated SRR7172479 is paired end SRR7172479 is conventional basespace SRR7172479 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172479_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.36775 34.0 33.0 34.0 32.0 34.0 2 33.30425 34.0 33.0 34.0 33.0 34.0 3 33.40625 34.0 34.0 34.0 33.0 34.0 4 33.5205 34.0 34.0 34.0 33.0 34.0 5 33.51025 34.0 34.0 34.0 33.0 34.0 6 37.30675 38.0 38.0 38.0 36.0 38.0 7 37.49625 38.0 38.0 38.0 37.0 38.0 8 37.54275 38.0 38.0 38.0 38.0 38.0 9 37.57275 38.0 38.0 38.0 38.0 38.0 10-14 37.5034 38.0 38.0 38.0 37.8 38.0 15-19 37.5531 38.0 38.0 38.0 38.0 38.0 20-24 37.5826 38.0 38.0 38.0 38.0 38.0 25-29 37.455349999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.4812 38.0 38.0 38.0 37.4 38.0 35-39 37.35455 38.0 38.0 38.0 37.0 38.0 40-44 37.117399999999996 38.0 38.0 38.0 36.0 38.0 45-49 37.0774 38.0 38.0 38.0 36.0 38.0 50-54 36.914049999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.803650000000005 38.0 38.0 38.0 35.2 38.0 60-64 36.8307 38.0 38.0 38.0 35.4 38.0 65-69 36.7442 38.0 38.0 38.0 35.0 38.0 70-74 36.548300000000005 38.0 38.0 38.0 34.2 38.0 75-79 36.443099999999994 38.0 38.0 38.0 34.0 38.0 80-84 36.380250000000004 38.0 37.8 38.0 34.0 38.0 85-89 36.26545 38.0 37.8 38.0 34.0 38.0 90-94 36.1589 38.0 37.0 38.0 33.6 38.0 95-99 36.0095 38.0 37.0 38.0 33.0 38.0 100-104 35.77565 38.0 37.0 38.0 32.2 38.0 105-109 35.5195 38.0 36.8 38.0 30.2 38.0 110-114 35.057849999999995 38.0 36.0 38.0 28.2 38.0 115-119 35.07985 38.0 36.0 38.0 28.0 38.0 120-124 34.944100000000006 38.0 35.6 38.0 27.8 38.0 125-129 34.4769 38.0 35.0 38.0 26.0 38.0 130-134 34.0168 38.0 34.4 38.0 23.0 38.0 135-139 33.323249999999994 38.0 33.8 38.0 17.8 38.0 140-144 32.5304 38.0 32.2 38.0 14.2 38.0 145-149 31.14035 37.0 30.6 38.0 8.4 38.0 150-151 26.109375 32.5 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 5.0 11 3.0 12 2.0 13 7.0 14 1.0 15 2.0 16 2.0 17 1.0 18 2.0 19 3.0 20 4.0 21 4.0 22 11.0 23 8.0 24 19.0 25 23.0 26 17.0 27 25.0 28 37.0 29 54.0 30 57.0 31 67.0 32 109.0 33 161.0 34 176.0 35 371.0 36 896.0 37 1932.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.063179699637494 14.629725530813051 8.751941998964268 38.55515277058519 2 20.549999999999997 18.6 37.65 23.200000000000003 3 18.475 24.325 28.1 29.099999999999998 4 20.474999999999998 33.050000000000004 24.075 22.400000000000002 5 20.75 36.15 24.25 18.85 6 17.349999999999998 37.275000000000006 26.025 19.35 7 13.425 23.275000000000002 44.324999999999996 18.975 8 17.25 23.25 31.574999999999996 27.925 9 17.375 22.475 33.6 26.55 10-14 19.615 29.945 26.915 23.525 15-19 19.220000000000002 28.52 28.33 23.93 20-24 19.505 28.449999999999996 27.865000000000002 24.18 25-29 19.905 28.494999999999997 28.01 23.59 30-34 19.865 28.375 28.000000000000004 23.76 35-39 20.111033309992997 28.39351805541662 27.65329598879664 23.84215264579374 40-44 20.02301495972382 28.99884925201381 27.577925651673592 23.400210136588782 45-49 20.05603081694932 28.440642353294308 28.065435989794384 23.437890839961977 50-54 19.881929157494497 28.877326395837503 27.476485891534917 23.76425855513308 55-59 19.796674679487182 28.465544871794872 28.580729166666668 23.157051282051285 60-64 20.315552216378663 27.73353368394691 28.444778362133732 23.506135737540696 65-69 20.3656398697721 28.384673178061608 27.838717756073127 23.410969196093163 70-74 20.367680208385515 28.642989530631667 27.430746881731206 23.558583379251615 75-79 21.000951856119432 28.721005961625167 27.628876308802162 22.649165873453235 80-84 19.917864476386036 28.547102719487157 28.0012019832724 23.53383082085441 85-89 21.103766025641026 28.205128205128204 27.453926282051285 23.23717948717949 90-94 20.480841472577012 28.8404708239419 27.56824442774856 23.110443275732532 95-99 20.209303490060588 28.125782384457466 27.474838515847978 24.19007560963397 100-104 19.866786858974358 28.48056891025641 28.125 23.527644230769234 105-109 21.04208416833667 28.106212424849698 27.595190380761526 23.256513026052104 110-114 20.870479815686668 27.84734047881398 28.02764699989983 23.25453270559952 115-119 20.597956730769234 28.881209935897434 27.05829326923077 23.462540064102562 120-124 20.794999999999998 28.634999999999998 27.284999999999997 23.285 125-129 20.771617293835067 28.042433947157726 27.091673338670937 24.09427542033627 130-134 20.698154016397567 28.263165836728533 27.478497057492078 23.560183089381823 135-139 20.58200524510793 28.1974984869881 26.906394996973976 24.314101270929996 140-144 20.92381764381363 28.3263955062942 26.83685239981945 23.912934450072722 145-149 20.837083708370837 28.30783078307831 26.907690769076908 23.94739473947395 150-151 20.5875 28.5875 26.8125 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 2.0 23 3.0 24 3.0 25 2.5 26 8.0 27 13.0 28 10.5 29 12.5 30 22.0 31 29.5 32 34.0 33 46.5 34 62.0 35 83.5 36 102.5 37 122.5 38 140.5 39 160.5 40 188.0 41 226.0 42 252.5 43 266.0 44 265.0 45 244.0 46 248.5 47 242.0 48 211.5 49 192.5 50 166.0 51 136.0 52 111.0 53 86.0 54 70.5 55 60.5 56 48.0 57 34.5 58 26.0 59 19.0 60 13.0 61 7.5 62 5.0 63 3.5 64 3.5 65 2.5 66 1.5 67 0.5 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.065 45-49 0.055 50-54 0.06 55-59 0.16 60-64 0.17500000000000002 65-69 0.17500000000000002 70-74 0.185 75-79 0.19499999999999998 80-84 0.165 85-89 0.16 90-94 0.17500000000000002 95-99 0.145 100-104 0.16 105-109 0.2 110-114 0.16999999999999998 115-119 0.16 120-124 0.0 125-129 0.08 130-134 0.5950000000000001 135-139 0.86 140-144 0.305 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.4781077000503271 0.95 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025163563160543533 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5249999999999999 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.8499999999999996 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.5250000000000004 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.4875 0.0 0.0 0.0 0.0 126-127 4.875 0.0 0.0 0.0 0.0 128-129 5.300000000000001 0.0 0.0 0.0 0.0 130-131 5.9 0.0 0.0 0.0 0.0 132-133 6.25 0.0 0.0 0.0 0.0 134-135 6.625 0.0 0.0 0.0 0.0 136-137 7.0625 0.0 0.0 0.0 0.0 138-139 7.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGACTT 10 0.0070318864 143.6 2 >>END_MODULE SRR7172479 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172479_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79325 33.0 33.0 34.0 32.0 34.0 2 32.87025 34.0 33.0 34.0 32.0 34.0 3 32.90075 34.0 33.0 34.0 32.0 34.0 4 32.90225 34.0 33.0 34.0 32.0 34.0 5 32.8675 34.0 33.0 34.0 32.0 34.0 6 37.0455 38.0 38.0 38.0 37.0 38.0 7 37.06325 38.0 38.0 38.0 37.0 38.0 8 37.07125 38.0 38.0 38.0 37.0 38.0 9 36.91875 38.0 38.0 38.0 36.0 38.0 10-14 37.08695 38.0 38.0 38.0 37.0 38.0 15-19 37.06115 38.0 38.0 38.0 37.0 38.0 20-24 36.9791 38.0 38.0 38.0 36.8 38.0 25-29 37.057249999999996 38.0 38.0 38.0 37.0 38.0 30-34 36.99925 38.0 38.0 38.0 37.0 38.0 35-39 37.012 38.0 38.0 38.0 37.0 38.0 40-44 36.922000000000004 38.0 38.0 38.0 36.8 38.0 45-49 36.92235 38.0 38.0 38.0 36.8 38.0 50-54 36.869550000000004 38.0 38.0 38.0 36.2 38.0 55-59 36.82275 38.0 38.0 38.0 36.0 38.0 60-64 36.8132 38.0 38.0 38.0 36.0 38.0 65-69 36.6676 38.0 38.0 38.0 36.0 38.0 70-74 36.63485 38.0 38.0 38.0 35.6 38.0 75-79 36.56025 38.0 38.0 38.0 35.0 38.0 80-84 36.4177 38.0 38.0 38.0 34.6 38.0 85-89 36.219849999999994 38.0 38.0 38.0 33.8 38.0 90-94 36.0424 38.0 38.0 38.0 33.4 38.0 95-99 35.98115 38.0 38.0 38.0 33.6 38.0 100-104 35.87115 38.0 37.8 38.0 33.2 38.0 105-109 35.743900000000004 38.0 37.8 38.0 32.4 38.0 110-114 35.5851 38.0 37.0 38.0 31.8 38.0 115-119 35.29165 38.0 37.0 38.0 29.6 38.0 120-124 35.05355 38.0 36.4 38.0 28.2 38.0 125-129 34.81105 38.0 36.0 38.0 27.6 38.0 130-134 34.4053 38.0 35.4 38.0 24.8 38.0 135-139 33.73205 38.0 34.2 38.0 21.4 38.0 140-144 33.0724 38.0 33.2 38.0 16.8 38.0 145-149 32.0323 38.0 33.0 38.0 8.6 38.0 150-151 27.34975 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 5.0 5 1.0 6 3.0 7 4.0 8 1.0 9 2.0 10 4.0 11 0.0 12 4.0 13 5.0 14 3.0 15 2.0 16 4.0 17 5.0 18 7.0 19 12.0 20 5.0 21 11.0 22 19.0 23 12.0 24 11.0 25 27.0 26 16.0 27 35.0 28 39.0 29 38.0 30 56.0 31 53.0 32 84.0 33 85.0 34 144.0 35 247.0 36 562.0 37 2484.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.225 21.85 12.725 28.199999999999996 2 25.31898924193145 26.069552164123095 32.44933700275207 16.162121591193397 3 20.695695695695697 28.02802802802803 31.23123123123123 20.045045045045047 4 23.3983983983984 35.38538538538539 23.373373373373376 17.842842842842842 5 22.7977977977978 37.312312312312315 22.54754754754755 17.34234234234234 6 20.225 36.6 24.325 18.85 7 18.725 18.85 42.75 19.675 8 20.549999999999997 23.95 30.325000000000003 25.174999999999997 9 20.875 24.925 29.4 24.8 10-14 22.325 29.07 26.884999999999998 21.72 15-19 22.78 28.060000000000002 28.025 21.135 20-24 22.720000000000002 28.075 28.194999999999997 21.01 25-29 22.125 28.310000000000002 28.470000000000002 21.095 30-34 22.6 28.765 27.865000000000002 20.77 35-39 22.735 28.055000000000003 28.405 20.805 40-44 22.564999999999998 28.27 28.015 21.15 45-49 22.2 28.075 28.7 21.025 50-54 22.475 28.189999999999998 28.275 21.060000000000002 55-59 22.475 27.29 28.93 21.305 60-64 23.385 27.275 28.215 21.125 65-69 22.770000000000003 27.865000000000002 28.48 20.885 70-74 23.22 27.96 28.060000000000002 20.76 75-79 22.805 28.1 27.744999999999997 21.349999999999998 80-84 22.89 28.634999999999998 27.275 21.2 85-89 23.365 27.395000000000003 28.12 21.12 90-94 23.582358235823584 27.912791279127912 27.88278827882788 20.622062206220622 95-99 23.544999999999998 28.075 27.61 20.77 100-104 23.415 28.139999999999997 27.395000000000003 21.05 105-109 23.169999999999998 28.18 28.055000000000003 20.595 110-114 23.605 28.044999999999998 27.565 20.785 115-119 24.245 27.845 27.705000000000002 20.205000000000002 120-124 24.205 28.38 27.32 20.095 125-129 24.095 28.044999999999998 27.589999999999996 20.27 130-134 24.816093679627684 27.858679877896215 27.11805034279137 20.20717609968473 135-139 24.872282880897526 27.737153160372635 27.757187218271064 19.63337674045878 140-144 25.174999999999997 27.91 27.01 19.905 145-149 25.4 28.28 27.055 19.265 150-151 25.837500000000002 28.299999999999997 26.85 19.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 1.5 18 1.5 19 0.5 20 1.5 21 2.5 22 4.5 23 4.0 24 2.5 25 4.0 26 5.5 27 7.5 28 11.0 29 21.0 30 25.5 31 24.0 32 29.5 33 44.0 34 64.0 35 73.0 36 84.0 37 105.5 38 130.5 39 164.5 40 206.5 41 213.0 42 215.5 43 257.5 44 289.0 45 292.0 46 259.5 47 242.0 48 229.5 49 182.5 50 156.5 51 132.0 52 103.0 53 100.5 54 89.5 55 63.0 56 45.0 57 31.0 58 19.0 59 17.0 60 13.5 61 8.5 62 7.0 63 4.0 64 4.0 65 3.0 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.1 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.08499999999999999 135-139 0.16999999999999998 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31835395102246 98.35000000000001 2 0.5301691492047462 1.05 3 0.07573844988639232 0.22499999999999998 4 0.025246149962130777 0.1 5 0.025246149962130777 0.125 6 0.025246149962130777 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.025 0.0 0.0 5 0.0 0.0 0.025 0.0 0.0 6 0.0 0.0 0.025 0.0 0.0 7 0.0 0.0 0.025 0.0 0.0 8 0.0 0.0 0.025 0.0 0.0 9 0.0 0.0 0.025 0.0 0.0 10-11 0.0 0.0 0.025 0.0 0.0 12-13 0.0 0.0 0.025 0.0 0.0 14-15 0.0 0.0 0.025 0.0 0.0 16-17 0.0 0.0 0.025 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0125 0.0 0.025 0.0 0.0 52-53 0.025 0.0 0.025 0.0 0.0 54-55 0.025 0.0 0.025 0.0 0.0 56-57 0.025 0.0 0.025 0.0 0.0 58-59 0.025 0.0 0.025 0.0 0.0 60-61 0.025 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.075 0.0 0.025 0.0 0.0 66-67 0.0875 0.0 0.025 0.0 0.0 68-69 0.1125 0.0 0.025 0.0 0.0 70-71 0.125 0.0 0.025 0.0 0.0 72-73 0.125 0.0 0.025 0.0 0.0 74-75 0.1375 0.0 0.025 0.0 0.0 76-77 0.175 0.0 0.025 0.0 0.0 78-79 0.1875 0.0 0.025 0.0 0.0 80-81 0.225 0.0 0.025 0.0 0.0 82-83 0.2375 0.0 0.025 0.0 0.0 84-85 0.275 0.0 0.025 0.0 0.0 86-87 0.3125 0.0 0.025 0.0 0.0 88-89 0.325 0.0 0.025 0.0 0.0 90-91 0.3625 0.0 0.025 0.0 0.0 92-93 0.3875 0.0 0.025 0.0 0.0 94-95 0.5249999999999999 0.0 0.025 0.0 0.0 96-97 0.625 0.0 0.025 0.0 0.0 98-99 0.725 0.0 0.025 0.0 0.0 100-101 0.9 0.0 0.025 0.0 0.0 102-103 1.15 0.0 0.025 0.0 0.0 104-105 1.375 0.0 0.025 0.0 0.0 106-107 1.5 0.0 0.025 0.0 0.0 108-109 1.825 0.0 0.025 0.0 0.0 110-111 2.1125 0.0 0.025 0.0 0.0 112-113 2.45 0.0 0.025 0.0 0.0 114-115 2.9000000000000004 0.0 0.025 0.0 0.0 116-117 3.2249999999999996 0.0 0.025 0.0 0.0 118-119 3.575 0.0 0.025 0.0 0.0 120-121 3.8375 0.0 0.025 0.0 0.0 122-123 4.175000000000001 0.0 0.025 0.0 0.0 124-125 4.5375 0.0 0.025 0.0 0.0 126-127 4.95 0.0 0.025 0.0 0.0 128-129 5.3875 0.0 0.025 0.0 0.0 130-131 5.9375 0.0 0.025 0.0 0.0 132-133 6.275 0.0 0.025 0.0 0.0 134-135 6.675000000000001 0.0 0.025 0.0 0.0 136-137 7.1 0.0 0.025 0.0 0.0 138-139 7.575 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra Read 744540 spots for SRR7172479.sra Written 744540 spots for SRR7172479.sra Read 744536 spots for SRR7172479.sra Written 744536 spots for SRR7172479.sra SRR ids: ['SRR7172479.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6d3dj_vm SRR7172479.sra spots: 14890724 blocks: [[1, 744536], [744537, 1489072], [1489073, 2233608], [2233609, 2978144], [2978145, 3722680], [3722681, 4467216], [4467217, 5211752], [5211753, 5956288], [5956289, 6700824], [6700825, 7445360], [7445361, 8189896], [8189897, 8934432], [8934433, 9678968], [9678969, 10423504], [10423505, 11168040], [11168041, 11912576], [11912577, 12657112], [12657113, 13401648], [13401649, 14146184], [14146185, 14890724]] SRR7172479 file size 5024277 SRR7172479 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172479 SRR7172479_1.fastq SRR7172479_2.fastq Input file: SRR7172479_1.fastq Paired file: SRR7172479_2.fastq trimmed: SRR7172479-trimmed-pair1.fastq, SRR7172479-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:13:46 2025 >> started Mon Feb 10 11:14:01 2025 >> done (15.732s) 14890724 read pairs processed; of these: 23714 ( 0.16%) short read pairs filtered out after trimming by size control 73853 ( 0.50%) empty read pairs filtered out after trimming by size control 14793157 (99.34%) read pairs available; of these: 7875967 (53.24%) trimmed read pairs available after processing 6917190 (46.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 9 0.00% 21 10 0.00% 22 6 0.00% 23 6 0.00% 24 13 0.00% 25 10 0.00% 26 7 0.00% 27 14 0.00% 28 10 0.00% 29 13 0.00% 30 12 0.00% 31 12 0.00% 32 10 0.00% 33 17 0.00% 34 14 0.00% 35 24 0.00% 36 20 0.00% 37 28 0.00% 38 28 0.00% 39 34 0.00% 40 22 0.00% 41 46 0.00% 42 35 0.00% 43 37 0.00% 44 37 0.00% 45 67 0.00% 46 51 0.00% 47 60 0.00% 48 73 0.00% 49 97 0.00% 50 92 0.00% 51 116 0.00% 52 136 0.00% 53 133 0.00% 54 165 0.00% 55 158 0.00% 56 219 0.00% 57 218 0.00% 58 247 0.00% 59 274 0.00% 60 360 0.00% 61 421 0.00% 62 447 0.00% 63 521 0.00% 64 546 0.00% 65 620 0.00% 66 706 0.00% 67 827 0.01% 68 898 0.01% 69 987 0.01% 70 1294 0.01% 71 1341 0.01% 72 1481 0.01% 73 1702 0.01% 74 1883 0.01% 75 2067 0.01% 76 2258 0.02% 77 2524 0.02% 78 2720 0.02% 79 3176 0.02% 80 3569 0.02% 81 4063 0.03% 82 4666 0.03% 83 5409 0.04% 84 6621 0.04% 85 7297 0.05% 86 7894 0.05% 87 8199 0.06% 88 8689 0.06% 89 9223 0.06% 90 10087 0.07% 91 10942 0.07% 92 12340 0.08% 93 13177 0.09% 94 13238 0.09% 95 14355 0.10% 96 14372 0.10% 97 14853 0.10% 98 15139 0.10% 99 15793 0.11% 100 17203 0.12% 101 17877 0.12% 102 19570 0.13% 103 20685 0.14% 104 21189 0.14% 105 21928 0.15% 106 22943 0.16% 107 23125 0.16% 108 24335 0.16% 109 24826 0.17% 110 25530 0.17% 111 27093 0.18% 112 28062 0.19% 113 29798 0.20% 114 31384 0.21% 115 32895 0.22% 116 33612 0.23% 117 34413 0.23% 118 35521 0.24% 119 35556 0.24% 120 37269 0.25% 121 38742 0.26% 122 40016 0.27% 123 42117 0.28% 124 44421 0.30% 125 45676 0.31% 126 47474 0.32% 127 48955 0.33% 128 50598 0.34% 129 51721 0.35% 130 53236 0.36% 131 54884 0.37% 132 58062 0.39% 133 61587 0.42% 134 64295 0.43% 135 68296 0.46% 136 72471 0.49% 137 76191 0.52% 138 81248 0.55% 139 85951 0.58% 140 91961 0.62% 141 99748 0.67% 142 109509 0.74% 143 123333 0.83% 144 143682 0.97% 145 172409 1.17% 146 214430 1.45% 147 285032 1.93% 148 419201 2.83% 149 802987 5.43% 150 3533623 23.89% 151 6917190 46.76% 14793157 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=26 prefix-density=0.44 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=381.41 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=11 prefix-density=0.42 prefix-fanout=2.6 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=58.81 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.9 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7172479 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:14:48 Started mapping on | Feb 10 11:14:49 Finished on | Feb 10 11:16:28 Mapping speed, Million of reads per hour | 537.93 Number of input reads | 14793157 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13813244 Uniquely mapped reads % | 93.38% Average mapped length | 291.64 Number of splices: Total | 12815772 Number of splices: Annotated (sjdb) | 12510551 Number of splices: GT/AG | 12568655 Number of splices: GC/AG | 197000 Number of splices: AT/AC | 7374 Number of splices: Non-canonical | 42743 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399442 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 84981 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 599211 599211 599211 N_multimapping 399442 399442 399442 N_noFeature 609664 13564855 719578 N_ambiguous 243495 1202 104166 UnstrandedReadsAssigned:12960085 PositiveStrandReadsAssigned:247187 NegativeStrandReadsAssigned:12989500 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7172479 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172479-trimmed-pair1.fastq SRR7172479-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,793,157 reads, 13,024,457 reads pseudoaligned [quant] estimated average fragment length: 245.978 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,023 rounds 52401 SRR7172479.ke.tsv 34699 SRR7172479.se.tsv 87100 total ==> SRR7172479.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.02 737 30.26 Potri.005G024800.1.v4.1 1035 790.022 100 9.2146 Potri.004G059700.1.v4.1 961 716.146 15 1.52477 Potri.007G009000.2.v4.1 1416 1171.02 0 0 Potri.003G141000.2.v4.1 2943 2698.02 615.745 16.6139 Potri.016G087400.1.v4.1 270 86.4425 435 366.334 Potri.015G069301.1.v4.1 564 328.151 0 0 Potri.010G195200.1.v4.1 1773 1528.02 57 2.71557 Potri.012G127500.1.v4.1 977 732.095 59 5.86679 ==> SRR7172479.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1262 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR7172479 completed mapping pipeline successfully