Starting /dee2/code/volunteer_pipeline.sh SRR7172480 current disk space = 3058858508288 free memory = 1396233964 SRR7172480 SRAfilesize 3f1fab5689a22b5f229720946d3e9632 SRR7172480.sra SRR7172480.sra file validated SRR7172480 is paired end SRR7172480 is conventional basespace SRR7172480 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172480_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.716 34.0 33.0 34.0 32.0 34.0 2 33.3355 34.0 33.0 34.0 33.0 34.0 3 33.357 34.0 34.0 34.0 33.0 34.0 4 33.4245 34.0 34.0 34.0 33.0 34.0 5 33.51125 34.0 34.0 34.0 33.0 34.0 6 37.142 38.0 38.0 38.0 36.0 38.0 7 37.357 38.0 38.0 38.0 37.0 38.0 8 37.45275 38.0 38.0 38.0 37.0 38.0 9 37.3525 38.0 38.0 38.0 37.0 38.0 10-14 37.435900000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.46169999999999 38.0 38.0 38.0 37.2 38.0 20-24 37.42525 38.0 38.0 38.0 37.6 38.0 25-29 37.449850000000005 38.0 38.0 38.0 37.4 38.0 30-34 37.3964 38.0 38.0 38.0 37.0 38.0 35-39 37.22955 38.0 38.0 38.0 36.8 38.0 40-44 37.02 38.0 38.0 38.0 36.0 38.0 45-49 36.878499999999995 38.0 38.0 38.0 35.6 38.0 50-54 36.7436 38.0 38.0 38.0 35.0 38.0 55-59 36.7025 38.0 38.0 38.0 35.0 38.0 60-64 36.71575 38.0 38.0 38.0 34.8 38.0 65-69 36.6175 38.0 38.0 38.0 34.6 38.0 70-74 36.53315 38.0 38.0 38.0 34.0 38.0 75-79 36.355450000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.2451 38.0 38.0 38.0 33.8 38.0 85-89 36.1057 38.0 37.2 38.0 33.0 38.0 90-94 35.91015 38.0 37.0 38.0 32.4 38.0 95-99 35.674850000000006 38.0 36.8 38.0 30.8 38.0 100-104 35.3477 38.0 36.4 38.0 29.2 38.0 105-109 35.4698 38.0 36.4 38.0 29.8 38.0 110-114 35.11945 38.0 36.0 38.0 28.2 38.0 115-119 34.848400000000005 38.0 35.6 38.0 27.6 38.0 120-124 34.4739 38.0 35.0 38.0 26.2 38.0 125-129 34.205549999999995 38.0 34.8 38.0 24.0 38.0 130-134 33.67475 38.0 34.2 38.0 19.0 38.0 135-139 33.168600000000005 38.0 34.0 38.0 16.2 38.0 140-144 32.38785 38.0 32.4 38.0 14.0 38.0 145-149 31.3521 37.8 31.0 38.0 8.6 38.0 150-151 26.036749999999998 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 4.0 10 1.0 11 0.0 12 1.0 13 2.0 14 5.0 15 6.0 16 1.0 17 5.0 18 5.0 19 7.0 20 11.0 21 9.0 22 11.0 23 15.0 24 18.0 25 28.0 26 28.0 27 26.0 28 37.0 29 53.0 30 58.0 31 79.0 32 100.0 33 132.0 34 202.0 35 339.0 36 863.0 37 1951.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.19667943805875 16.73052362707535 8.173690932311622 32.89910600255428 2 21.45 19.625 35.075 23.849999999999998 3 18.175 26.150000000000002 28.825 26.85 4 21.475 32.925 23.375 22.225 5 21.875 35.75 24.474999999999998 17.9 6 17.599999999999998 37.875 24.95 19.575 7 13.625000000000002 23.25 45.225 17.9 8 16.775000000000002 23.775 30.925000000000004 28.525 9 18.6 24.175 33.625 23.599999999999998 10-14 20.135 29.7 26.740000000000002 23.425 15-19 20.435 28.71 27.455000000000002 23.400000000000002 20-24 19.865 28.475 28.060000000000002 23.599999999999998 25-29 19.744999999999997 29.060000000000002 28.02 23.175 30-34 19.37 29.675 27.01 23.945 35-39 19.954954954954953 29.31931931931932 27.29229229229229 23.433433433433436 40-44 20.605908863294943 28.753129694541812 27.906860290435652 22.734101151727593 45-49 19.993991287366683 29.177307095288167 27.690150718541883 23.138550898803263 50-54 20.215322984476717 28.95343014521783 27.57636454682023 23.25488232348523 55-59 19.964938642624595 28.650137741046834 27.888805409466567 23.496118206862008 60-64 19.874780866516403 29.120961682945158 27.232657150012525 23.771600300525918 65-69 20.19534184823441 29.10092662158778 27.28274480340596 23.42098672677185 70-74 20.435762584522916 29.07588279489106 27.232657150012525 23.2556974705735 75-79 20.60105184072126 28.61006761833208 27.62334084648134 23.165539694465316 80-84 20.430753819183572 28.61006761833208 27.793638868019034 23.165539694465316 85-89 20.82143751565239 28.469822188830452 27.06235912847483 23.646381167042325 90-94 20.100175306786877 28.33458552466817 27.778612572001 23.786626596543954 95-99 20.751314800901575 28.46481342349111 27.488104182319056 23.295767593288254 100-104 20.651684268481908 28.424846088392812 27.53891586165474 23.384553781470544 105-109 20.235411970949162 29.025795141497625 26.952166291009267 23.786626596543954 110-114 20.80016023233689 28.566421310900807 27.50488207901457 23.128536377747736 115-119 20.49369116763469 28.194472261165632 27.688764269977966 23.623072301221708 120-124 20.485 28.82 26.85 23.845 125-129 20.62 27.85 27.47 24.060000000000002 130-134 21.075 28.294999999999998 27.089999999999996 23.54 135-139 20.812081208120812 28.30783078307831 27.40774077407741 23.472347234723472 140-144 20.595 28.139999999999997 27.279999999999998 23.985 145-149 20.62 28.71 27.089999999999996 23.580000000000002 150-151 20.6125 28.075 27.6125 23.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.5 14 3.0 15 2.0 16 0.5 17 0.0 18 0.5 19 1.5 20 1.5 21 4.0 22 4.5 23 4.0 24 7.5 25 6.5 26 7.0 27 10.0 28 13.5 29 18.5 30 20.0 31 31.5 32 44.0 33 50.5 34 69.5 35 90.5 36 102.0 37 117.5 38 134.0 39 152.0 40 184.0 41 214.0 42 220.0 43 225.0 44 247.0 45 247.0 46 251.5 47 254.5 48 236.5 49 209.5 50 174.0 51 138.5 52 119.5 53 93.5 54 61.0 55 61.5 56 49.5 57 32.0 58 25.0 59 17.5 60 14.5 61 10.5 62 5.0 63 3.5 64 3.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.1 40-44 0.15 45-49 0.145 50-54 0.15 55-59 0.17500000000000002 60-64 0.17500000000000002 65-69 0.17500000000000002 70-74 0.17500000000000002 75-79 0.17500000000000002 80-84 0.17500000000000002 85-89 0.17500000000000002 90-94 0.17500000000000002 95-99 0.17500000000000002 100-104 0.105 105-109 0.17500000000000002 110-114 0.145 115-119 0.13999999999999999 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.4500000000000002 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.975 0.0 0.0 0.0 0.0 120-121 3.2875 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.8499999999999996 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.9125 0.0 0.0 0.0 0.0 130-131 5.325 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 6.0 0.0 0.0 0.0 0.0 136-137 6.525 0.0 0.0 0.0 0.0 138-139 7.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATACAA 10 0.006959184 144.1 5 >>END_MODULE SRR7172480 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172480_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6275 33.0 33.0 34.0 32.0 34.0 2 32.675 34.0 33.0 34.0 32.0 34.0 3 32.7015 34.0 33.0 34.0 32.0 34.0 4 32.5865 34.0 33.0 34.0 32.0 34.0 5 32.49675 34.0 33.0 34.0 32.0 34.0 6 36.65575 38.0 38.0 38.0 35.0 38.0 7 36.78675 38.0 38.0 38.0 36.0 38.0 8 36.705 38.0 38.0 38.0 36.0 38.0 9 36.73425 38.0 38.0 38.0 36.0 38.0 10-14 36.64855 38.0 38.0 38.0 35.8 38.0 15-19 36.6841 38.0 38.0 38.0 36.0 38.0 20-24 36.718 38.0 38.0 38.0 36.0 38.0 25-29 36.6287 38.0 38.0 38.0 36.0 38.0 30-34 36.649950000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.480549999999994 38.0 38.0 38.0 35.6 38.0 40-44 36.52140000000001 38.0 38.0 38.0 35.8 38.0 45-49 36.51615 38.0 38.0 38.0 35.8 38.0 50-54 36.43405 38.0 38.0 38.0 35.0 38.0 55-59 36.33135 38.0 38.0 38.0 34.6 38.0 60-64 36.342 38.0 38.0 38.0 34.8 38.0 65-69 36.2019 38.0 38.0 38.0 34.2 38.0 70-74 36.1086 38.0 38.0 38.0 33.8 38.0 75-79 36.0989 38.0 38.0 38.0 34.0 38.0 80-84 36.0295 38.0 38.0 38.0 34.0 38.0 85-89 35.92815 38.0 38.0 38.0 33.2 38.0 90-94 35.802049999999994 38.0 38.0 38.0 33.0 38.0 95-99 35.562650000000005 38.0 38.0 38.0 31.0 38.0 100-104 35.4721 38.0 37.4 38.0 31.0 38.0 105-109 35.23805 38.0 37.0 38.0 29.4 38.0 110-114 35.03385000000001 38.0 37.0 38.0 28.2 38.0 115-119 34.735749999999996 38.0 36.2 38.0 27.0 38.0 120-124 34.585 38.0 36.0 38.0 25.8 38.0 125-129 34.227199999999996 38.0 35.6 38.0 23.4 38.0 130-134 33.42635 38.0 34.8 38.0 15.0 38.0 135-139 32.9199 38.0 33.0 38.0 14.2 38.0 140-144 32.2154 38.0 32.8 38.0 13.0 38.0 145-149 30.999149999999997 38.0 31.4 38.0 2.0 38.0 150-151 26.15425 33.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 9.0 4 4.0 5 5.0 6 2.0 7 3.0 8 9.0 9 3.0 10 4.0 11 3.0 12 2.0 13 3.0 14 7.0 15 8.0 16 6.0 17 9.0 18 8.0 19 16.0 20 13.0 21 10.0 22 11.0 23 27.0 24 17.0 25 22.0 26 32.0 27 32.0 28 33.0 29 45.0 30 54.0 31 64.0 32 69.0 33 115.0 34 147.0 35 273.0 36 584.0 37 2330.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.25 22.5 11.625 23.625 2 26.724999999999998 24.675 32.475 16.125 3 21.675 26.900000000000002 32.375 19.05 4 24.330413016270338 34.69336670838548 22.92866082603254 18.04755944931164 5 23.849999999999998 38.675 21.2 16.275000000000002 6 20.225 37.45 24.375 17.95 7 20.424999999999997 19.75 39.675 20.150000000000002 8 20.674999999999997 24.9 27.900000000000002 26.525 9 22.325 24.4 28.925 24.349999999999998 10-14 23.9 28.42 26.029999999999998 21.65 15-19 24.25 27.384999999999998 27.73 20.635 20-24 23.36 28.455000000000002 27.445000000000004 20.74 25-29 23.44 27.994999999999997 27.950000000000003 20.615 30-34 22.85 28.110000000000003 28.144999999999996 20.895 35-39 23.34 27.21 28.23 21.22 40-44 23.3 28.29 27.634999999999998 20.775 45-49 22.91 27.6 28.389999999999997 21.099999999999998 50-54 23.06 27.675 28.115000000000002 21.15 55-59 23.535 27.865000000000002 27.74 20.86 60-64 23.695 27.415 28.155 20.735 65-69 23.735 27.85 27.255000000000003 21.16 70-74 23.305 28.09 27.284999999999997 21.32 75-79 23.52 27.595 27.544999999999998 21.34 80-84 23.715 28.044999999999998 27.91 20.330000000000002 85-89 23.505000000000003 27.93 28.18 20.385 90-94 24.315 27.79 27.325 20.57 95-99 23.565 27.705000000000002 28.65 20.080000000000002 100-104 23.845 27.634999999999998 27.905 20.615 105-109 23.849999999999998 28.115000000000002 27.994999999999997 20.04 110-114 23.555 27.855 27.889999999999997 20.7 115-119 23.875 28.244999999999997 27.825 20.055 120-124 23.865 27.915 28.144999999999996 20.075000000000003 125-129 24.605 27.775 27.455000000000002 20.165 130-134 24.43 27.66 27.950000000000003 19.96 135-139 24.42 27.865000000000002 28.08 19.634999999999998 140-144 25.365 27.05 27.450000000000003 20.135 145-149 25.019999999999996 28.07 27.395000000000003 19.515 150-151 25.224999999999998 27.500000000000004 27.900000000000002 19.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 2.5 20 2.0 21 2.0 22 2.0 23 2.5 24 6.0 25 6.5 26 9.0 27 9.5 28 9.0 29 9.5 30 13.0 31 23.0 32 30.5 33 34.5 34 47.0 35 63.5 36 85.5 37 109.5 38 127.5 39 162.5 40 187.0 41 201.5 42 227.0 43 253.0 44 258.5 45 248.5 46 247.5 47 251.0 48 236.0 49 209.5 50 179.0 51 146.0 52 125.0 53 112.5 54 91.0 55 62.0 56 49.5 57 43.5 58 32.0 59 20.0 60 11.0 61 9.0 62 11.0 63 9.5 64 5.0 65 3.0 66 2.5 67 1.0 68 1.0 69 0.5 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.125 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0897597977244 97.975 2 0.7332490518331226 1.4500000000000002 3 0.12642225031605564 0.375 4 0.05056890012642225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.4249999999999998 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.5875000000000004 0.0 0.0 0.0 0.0 124-125 3.8874999999999997 0.0 0.0 0.0 0.0 126-127 4.4 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.35 0.0 0.0 0.0 0.0 132-133 5.6625 0.0 0.0 0.0 0.0 134-135 6.074999999999999 0.0 0.0 0.0 0.0 136-137 6.5875 0.0 0.0 0.0 0.0 138-139 7.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCAT 10 0.006830828 145.0 1 TCCATTG 10 0.006830828 145.0 7 >>END_MODULE Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra Read 705406 spots for SRR7172480.sra Written 705406 spots for SRR7172480.sra Read 705405 spots for SRR7172480.sra Written 705405 spots for SRR7172480.sra SRR ids: ['SRR7172480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3_g2kkkd SRR7172480.sra spots: 14108101 blocks: [[1, 705405], [705406, 1410810], [1410811, 2116215], [2116216, 2821620], [2821621, 3527025], [3527026, 4232430], [4232431, 4937835], [4937836, 5643240], [5643241, 6348645], [6348646, 7054050], [7054051, 7759455], [7759456, 8464860], [8464861, 9170265], [9170266, 9875670], [9875671, 10581075], [10581076, 11286480], [11286481, 11991885], [11991886, 12697290], [12697291, 13402695], [13402696, 14108101]] SRR7172480 file size 4759072 SRR7172480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172480 SRR7172480_1.fastq SRR7172480_2.fastq Input file: SRR7172480_1.fastq Paired file: SRR7172480_2.fastq trimmed: SRR7172480-trimmed-pair1.fastq, SRR7172480-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:16:51 2025 >> started Mon Feb 10 11:17:06 2025 >> done (15.690s) 14108101 read pairs processed; of these: 36749 ( 0.26%) short read pairs filtered out after trimming by size control 89056 ( 0.63%) empty read pairs filtered out after trimming by size control 13982296 (99.11%) read pairs available; of these: 7369606 (52.71%) trimmed read pairs available after processing 6612690 (47.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 10 0.00% 20 3 0.00% 21 10 0.00% 22 6 0.00% 23 8 0.00% 24 8 0.00% 25 14 0.00% 26 18 0.00% 27 9 0.00% 28 12 0.00% 29 12 0.00% 30 17 0.00% 31 14 0.00% 32 14 0.00% 33 13 0.00% 34 14 0.00% 35 24 0.00% 36 12 0.00% 37 24 0.00% 38 29 0.00% 39 32 0.00% 40 30 0.00% 41 26 0.00% 42 34 0.00% 43 48 0.00% 44 37 0.00% 45 48 0.00% 46 52 0.00% 47 62 0.00% 48 67 0.00% 49 81 0.00% 50 73 0.00% 51 91 0.00% 52 116 0.00% 53 142 0.00% 54 137 0.00% 55 147 0.00% 56 157 0.00% 57 174 0.00% 58 193 0.00% 59 240 0.00% 60 249 0.00% 61 343 0.00% 62 346 0.00% 63 421 0.00% 64 439 0.00% 65 519 0.00% 66 579 0.00% 67 641 0.00% 68 744 0.01% 69 853 0.01% 70 1077 0.01% 71 1015 0.01% 72 1133 0.01% 73 1278 0.01% 74 1418 0.01% 75 1600 0.01% 76 1680 0.01% 77 1919 0.01% 78 2099 0.02% 79 2429 0.02% 80 2707 0.02% 81 2994 0.02% 82 3516 0.03% 83 4005 0.03% 84 5530 0.04% 85 6714 0.05% 86 6950 0.05% 87 7092 0.05% 88 7526 0.05% 89 7825 0.06% 90 8540 0.06% 91 9214 0.07% 92 9810 0.07% 93 10773 0.08% 94 10871 0.08% 95 11616 0.08% 96 12242 0.09% 97 12443 0.09% 98 13067 0.09% 99 13666 0.10% 100 14735 0.11% 101 15331 0.11% 102 16614 0.12% 103 17136 0.12% 104 17855 0.13% 105 18691 0.13% 106 19317 0.14% 107 20025 0.14% 108 20814 0.15% 109 21720 0.16% 110 22877 0.16% 111 23717 0.17% 112 25028 0.18% 113 26502 0.19% 114 27366 0.20% 115 29120 0.21% 116 30063 0.22% 117 30711 0.22% 118 31950 0.23% 119 33087 0.24% 120 34232 0.24% 121 35379 0.25% 122 36568 0.26% 123 38508 0.28% 124 40918 0.29% 125 42415 0.30% 126 44548 0.32% 127 45959 0.33% 128 47208 0.34% 129 49431 0.35% 130 51310 0.37% 131 53225 0.38% 132 55706 0.40% 133 58522 0.42% 134 61929 0.44% 135 65166 0.47% 136 68768 0.49% 137 73455 0.53% 138 78684 0.56% 139 82777 0.59% 140 88911 0.64% 141 96816 0.69% 142 105457 0.75% 143 118725 0.85% 144 137131 0.98% 145 165530 1.18% 146 201269 1.44% 147 272056 1.95% 148 397115 2.84% 149 760225 5.44% 150 3308854 23.66% 151 6612690 47.29% 13982296 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=23 prefix-density=0.49 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=46.99 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.5 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=21 prefix-density=0.38 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=36.24 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.3 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7172480 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:17:50 Started mapping on | Feb 10 11:17:50 Finished on | Feb 10 11:19:55 Mapping speed, Million of reads per hour | 402.69 Number of input reads | 13982296 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12708226 Uniquely mapped reads % | 90.89% Average mapped length | 292.00 Number of splices: Total | 11597368 Number of splices: Annotated (sjdb) | 11306318 Number of splices: GT/AG | 11367060 Number of splices: GC/AG | 182449 Number of splices: AT/AC | 7425 Number of splices: Non-canonical | 40434 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 395147 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 111205 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.25% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 906400 906400 906400 N_multimapping 395147 395147 395147 N_noFeature 582137 12463940 685946 N_ambiguous 241839 1106 100616 UnstrandedReadsAssigned:11884250 PositiveStrandReadsAssigned:243180 NegativeStrandReadsAssigned:11921664 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172480 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172480-trimmed-pair1.fastq SRR7172480-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,982,296 reads, 12,022,570 reads pseudoaligned [quant] estimated average fragment length: 240.938 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR7172480.ke.tsv 34699 SRR7172480.se.tsv 87100 total ==> SRR7172480.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.06 728 30.7132 Potri.005G024800.1.v4.1 1035 795.062 170 16.0394 Potri.004G059700.1.v4.1 961 721.136 8 0.832175 Potri.007G009000.2.v4.1 1416 1176.06 0 0 Potri.003G141000.2.v4.1 2943 2703.06 411 11.4058 Potri.016G087400.1.v4.1 270 83.7682 621 556.101 Potri.015G069301.1.v4.1 564 330.75 0 0 Potri.010G195200.1.v4.1 1773 1533.06 42 2.05509 Potri.012G127500.1.v4.1 977 737.11 226 22.9995 ==> SRR7172480.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 920 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 53 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 45 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR7172480 completed mapping pipeline successfully