Starting /dee2/code/volunteer_pipeline.sh SRR7172481 current disk space = 3059104731136 free memory = 1569343832 SRR7172481 SRAfilesize 82b99fd45456c5a878a143fec544353d SRR7172481.sra SRR7172481.sra file validated SRR7172481 is paired end SRR7172481 is conventional basespace SRR7172481 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172481_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77 34.0 33.0 34.0 33.0 34.0 2 33.34775 34.0 33.0 34.0 33.0 34.0 3 33.40925 34.0 34.0 34.0 33.0 34.0 4 33.4885 34.0 34.0 34.0 33.0 34.0 5 33.5235 34.0 34.0 34.0 33.0 34.0 6 37.26225 38.0 38.0 38.0 36.0 38.0 7 37.42125 38.0 38.0 38.0 37.0 38.0 8 37.578 38.0 38.0 38.0 37.0 38.0 9 37.5225 38.0 38.0 38.0 38.0 38.0 10-14 37.5215 38.0 38.0 38.0 38.0 38.0 15-19 37.5058 38.0 38.0 38.0 38.0 38.0 20-24 37.5209 38.0 38.0 38.0 38.0 38.0 25-29 37.4847 38.0 38.0 38.0 38.0 38.0 30-34 37.49505 38.0 38.0 38.0 38.0 38.0 35-39 37.3972 38.0 38.0 38.0 37.6 38.0 40-44 37.188849999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.1092 38.0 38.0 38.0 36.4 38.0 50-54 37.0366 38.0 38.0 38.0 36.0 38.0 55-59 36.99705 38.0 38.0 38.0 36.0 38.0 60-64 36.9841 38.0 38.0 38.0 36.0 38.0 65-69 36.9588 38.0 38.0 38.0 36.0 38.0 70-74 36.81375 38.0 38.0 38.0 35.2 38.0 75-79 36.634350000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.55605 38.0 38.0 38.0 34.4 38.0 85-89 36.52255 38.0 38.0 38.0 34.0 38.0 90-94 36.3378 38.0 38.0 38.0 34.0 38.0 95-99 36.101549999999996 38.0 37.4 38.0 33.4 38.0 100-104 35.88815 38.0 37.0 38.0 32.2 38.0 105-109 35.9086 38.0 37.0 38.0 33.0 38.0 110-114 35.59325 38.0 37.0 38.0 31.0 38.0 115-119 35.35395 38.0 36.4 38.0 29.6 38.0 120-124 35.019450000000006 38.0 36.0 38.0 28.0 38.0 125-129 34.843900000000005 38.0 35.6 38.0 27.6 38.0 130-134 34.45975 38.0 35.0 38.0 25.4 38.0 135-139 34.028800000000004 38.0 34.8 38.0 23.2 38.0 140-144 33.29495000000001 38.0 33.6 38.0 18.6 38.0 145-149 32.4414 38.0 33.0 38.0 11.2 38.0 150-151 27.305625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 5.0 10 0.0 11 0.0 12 2.0 13 2.0 14 2.0 15 4.0 16 2.0 17 1.0 18 5.0 19 6.0 20 8.0 21 7.0 22 6.0 23 15.0 24 14.0 25 24.0 26 16.0 27 34.0 28 33.0 29 28.0 30 43.0 31 68.0 32 84.0 33 100.0 34 141.0 35 292.0 36 775.0 37 2282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.44742900997697 14.300332565873624 9.746738296239448 36.505500127909954 2 22.650000000000002 17.849999999999998 35.175 24.325 3 19.400000000000002 23.5 28.299999999999997 28.799999999999997 4 21.575 31.924999999999997 23.875 22.625 5 21.2 35.875 23.799999999999997 19.125 6 18.475 35.625 26.275 19.625 7 13.925 23.549999999999997 44.65 17.875 8 17.9 23.825 31.025000000000002 27.250000000000004 9 17.125 23.95 33.800000000000004 25.124999999999996 10-14 19.744999999999997 29.89 26.57 23.794999999999998 15-19 20.13 28.7 27.779999999999998 23.39 20-24 19.61 29.244999999999997 27.750000000000004 23.395 25-29 19.66098304915246 29.121456072803642 27.551377568878443 23.666183309165458 30-34 19.28596429821491 29.256462823141156 27.681384069203457 23.77618880944047 35-39 19.865892714171338 28.95816653322658 27.161729383506806 24.014211369095275 40-44 20.07007007007007 29.404404404404406 26.756756756756754 23.76876876876877 45-49 20.26026026026026 28.95895895895896 27.26226226226226 23.51851851851852 50-54 20.13013013013013 29.20920920920921 26.726726726726728 23.933933933933936 55-59 20.157251602564102 28.90625 26.923076923076923 24.013421474358974 60-64 20.498948001202287 28.34385332131049 27.12654042681094 24.030658250676286 65-69 20.515004258303694 28.445468663894598 27.34832924202194 23.69119783577977 70-74 19.954898521673766 28.48910047607116 27.491856677524428 24.064144324730645 75-79 20.041094517389997 28.41034379071865 27.808960609401623 23.739601082489724 80-84 20.150300601202407 28.406813627254508 27.334669338677354 24.10821643286573 85-89 20.235411970949162 28.58502379163536 26.85199098422239 24.327573253193087 90-94 19.929859719438877 28.071142284569138 27.374749498997996 24.62424849699399 95-99 19.830695251452614 28.72169905830495 27.52454417952314 23.923061510719297 100-104 20.261339741664163 28.762391108440973 27.00010013016922 23.976169019725642 105-109 21.027568922305765 28.045112781954888 26.781954887218046 24.145363408521302 110-114 20.437005111757042 28.079583040994287 27.27773879923825 24.205673048010425 115-119 20.596192384769537 28.697394789579157 26.49799599198397 24.208416833667336 120-124 20.57 28.675 26.255 24.5 125-129 20.7 28.084999999999997 26.8 24.415 130-134 20.9 27.825 27.055 24.22 135-139 21.13 27.744999999999997 26.450000000000003 24.675 140-144 21.16 27.650000000000002 25.990000000000002 25.2 145-149 21.404999999999998 27.66 26.39 24.545 150-151 20.775 28.4375 25.7375 25.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 2.0 17 2.0 18 0.5 19 1.0 20 2.0 21 1.5 22 1.0 23 2.0 24 5.0 25 7.0 26 8.0 27 11.0 28 14.5 29 21.0 30 27.0 31 30.5 32 40.5 33 54.5 34 67.5 35 79.0 36 104.5 37 122.5 38 140.5 39 162.0 40 168.0 41 199.0 42 223.5 43 233.5 44 260.0 45 246.5 46 217.0 47 218.0 48 210.5 49 194.0 50 170.0 51 135.0 52 116.0 53 108.0 54 89.5 55 68.0 56 57.5 57 45.5 58 37.0 59 31.5 60 21.5 61 13.0 62 9.0 63 8.5 64 3.0 65 0.5 66 0.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.08 40-44 0.1 45-49 0.1 50-54 0.1 55-59 0.16 60-64 0.19 65-69 0.19499999999999998 70-74 0.22499999999999998 75-79 0.22999999999999998 80-84 0.2 85-89 0.17500000000000002 90-94 0.2 95-99 0.18 100-104 0.13 105-109 0.25 110-114 0.22999999999999998 115-119 0.2 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96307536671725 97.82499999999999 2 0.9610520991401114 1.9 3 0.05058168942842691 0.15 4 0.0 0.0 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGAAGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 10 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7250000000000001 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.4625 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.075 0.0 0.0 0.0 0.0 112-113 3.45 0.0 0.0 0.0 0.0 114-115 3.8499999999999996 0.0 0.0 0.0 0.0 116-117 4.4 0.0 0.0 0.0 0.0 118-119 4.95 0.0 0.0 0.0 0.0 120-121 5.487500000000001 0.0 0.0 0.0 0.0 122-123 6.0125 0.0 0.0 0.0 0.0 124-125 6.5 0.0 0.0 0.0 0.0 126-127 7.1375 0.0 0.0 0.0 0.0 128-129 7.55 0.0 0.0 0.0 0.0 130-131 8.05 0.0 0.0 0.0 0.0 132-133 8.662500000000001 0.0 0.0 0.0 0.0 134-135 9.1375 0.0 0.0 0.0 0.0 136-137 9.6375 0.0 0.0 0.0 0.0 138-139 10.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTCA 10 0.006846698 144.88751 4 >>END_MODULE SRR7172481 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172481_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77975 33.0 33.0 34.0 32.0 34.0 2 32.81925 34.0 33.0 34.0 32.0 34.0 3 32.847 34.0 33.0 34.0 32.0 34.0 4 32.7665 34.0 33.0 34.0 32.0 34.0 5 32.692 34.0 33.0 34.0 32.0 34.0 6 36.9355 38.0 38.0 38.0 36.0 38.0 7 37.07875 38.0 38.0 38.0 37.0 38.0 8 36.9025 38.0 38.0 38.0 37.0 38.0 9 37.0205 38.0 38.0 38.0 37.0 38.0 10-14 36.920550000000006 38.0 38.0 38.0 36.8 38.0 15-19 36.9112 38.0 38.0 38.0 36.8 38.0 20-24 36.94325 38.0 38.0 38.0 37.0 38.0 25-29 36.950300000000006 38.0 38.0 38.0 37.0 38.0 30-34 36.934 38.0 38.0 38.0 36.8 38.0 35-39 36.7987 38.0 38.0 38.0 36.4 38.0 40-44 36.819 38.0 38.0 38.0 36.4 38.0 45-49 36.81225 38.0 38.0 38.0 36.2 38.0 50-54 36.756550000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.6684 38.0 38.0 38.0 35.8 38.0 60-64 36.684450000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.53445 38.0 38.0 38.0 35.4 38.0 70-74 36.454600000000006 38.0 38.0 38.0 35.0 38.0 75-79 36.384699999999995 38.0 38.0 38.0 34.6 38.0 80-84 36.3626 38.0 38.0 38.0 34.8 38.0 85-89 36.26925 38.0 38.0 38.0 34.2 38.0 90-94 36.11665 38.0 38.0 38.0 34.0 38.0 95-99 35.958299999999994 38.0 38.0 38.0 33.4 38.0 100-104 35.8328 38.0 38.0 38.0 33.0 38.0 105-109 35.68865000000001 38.0 37.4 38.0 32.4 38.0 110-114 35.5103 38.0 37.4 38.0 31.2 38.0 115-119 35.1332 38.0 37.0 38.0 29.0 38.0 120-124 34.95265 38.0 36.2 38.0 28.2 38.0 125-129 34.63155 38.0 36.0 38.0 26.8 38.0 130-134 33.8647 38.0 35.0 38.0 22.2 38.0 135-139 33.2324 38.0 33.0 38.0 17.0 38.0 140-144 32.47924999999999 38.0 33.0 38.0 13.0 38.0 145-149 31.346600000000002 38.0 32.2 38.0 3.8 38.0 150-151 26.338 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 8.0 4 4.0 5 2.0 6 2.0 7 3.0 8 4.0 9 2.0 10 2.0 11 2.0 12 2.0 13 1.0 14 4.0 15 4.0 16 11.0 17 4.0 18 6.0 19 12.0 20 16.0 21 12.0 22 12.0 23 12.0 24 18.0 25 28.0 26 25.0 27 29.0 28 34.0 29 34.0 30 41.0 31 54.0 32 74.0 33 107.0 34 144.0 35 265.0 36 557.0 37 2450.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.6 20.674999999999997 12.6 26.125 2 28.00700175043761 24.431107776944234 30.50762690672668 17.05426356589147 3 20.455113778444613 27.306826706676667 32.55813953488372 19.679919979995 4 24.424424424424423 34.68468468468468 22.07207207207207 18.81881881881882 5 24.63115778944736 37.28432108027007 21.73043260815204 16.35408852213053 6 21.675 36.875 22.900000000000002 18.55 7 20.5 19.725 39.324999999999996 20.45 8 22.125 23.525 28.875 25.474999999999998 9 23.724999999999998 23.549999999999997 28.425 24.3 10-14 24.15 28.744999999999997 25.55 21.555 15-19 23.715 27.83 27.339999999999996 21.115000000000002 20-24 23.825 28.134999999999998 27.505000000000003 20.535 25-29 24.38 28.305000000000003 26.705000000000002 20.61 30-34 23.990000000000002 27.639999999999997 27.48 20.89 35-39 24.38 27.66 27.015 20.945 40-44 24.135 27.465 27.22 21.18 45-49 24.015 28.03 27.18 20.775 50-54 23.965 27.49 27.505000000000003 21.04 55-59 24.104999999999997 27.655 27.08 21.16 60-64 24.09 27.845 27.42 20.645 65-69 24.035 27.63 27.810000000000002 20.525 70-74 23.685000000000002 27.3 27.85 21.165 75-79 24.255 27.61 26.66 21.475 80-84 23.995 27.99 27.54 20.474999999999998 85-89 24.285 27.49 27.72 20.505000000000003 90-94 24.271213560678035 27.841392069603483 27.12635631781589 20.761038051902595 95-99 23.724999999999998 28.255000000000003 27.21 20.810000000000002 100-104 23.955000000000002 26.700000000000003 28.28 21.065 105-109 24.94 27.900000000000002 26.810000000000002 20.349999999999998 110-114 24.05 28.415000000000003 26.91 20.625 115-119 24.955 27.975 26.97 20.1 120-124 24.88 27.839999999999996 27.365000000000002 19.915 125-129 25.55 27.76 26.884999999999998 19.805 130-134 26.055 27.47 26.715 19.759999999999998 135-139 25.82 27.529999999999998 27.12 19.53 140-144 26.179999999999996 27.685 27.205000000000002 18.93 145-149 26.235000000000003 27.71 26.21 19.845 150-151 26.85 27.237499999999997 26.737499999999997 19.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 2.0 21 1.5 22 0.5 23 1.5 24 1.5 25 1.0 26 2.5 27 3.5 28 5.5 29 8.0 30 11.5 31 19.5 32 29.5 33 32.0 34 37.0 35 56.5 36 79.5 37 98.0 38 110.0 39 132.0 40 174.0 41 204.5 42 236.0 43 264.5 44 265.5 45 252.0 46 257.0 47 255.0 48 239.5 49 225.5 50 180.5 51 133.5 52 118.0 53 113.5 54 101.0 55 85.0 56 63.0 57 48.0 58 37.5 59 30.0 60 23.0 61 16.5 62 12.0 63 8.5 64 6.5 65 4.0 66 3.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.1 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11482043500253 97.975 2 0.7587253414264037 1.5 3 0.07587253414264036 0.22499999999999998 4 0.0 0.0 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.025290844714213456 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 7 0.17500000000000002 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.5249999999999999 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.9624999999999999 0.0 0.0 0.0 0.0 96-97 1.175 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.9375 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.8375 0.0 0.0 0.0 0.0 110-111 3.0999999999999996 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 3.9000000000000004 0.0 0.0 0.0 0.0 116-117 4.449999999999999 0.0 0.0 0.0 0.0 118-119 5.0 0.0 0.0 0.0 0.0 120-121 5.5375 0.0 0.0 0.0 0.0 122-123 6.0625 0.0 0.0 0.0 0.0 124-125 6.55 0.0 0.0 0.0 0.0 126-127 7.1625 0.0 0.0 0.0 0.0 128-129 7.5875 0.0 0.0 0.0 0.0 130-131 8.125 0.0 0.0 0.0 0.0 132-133 8.7375 0.0 0.0 0.0 0.0 134-135 9.1875 0.0 0.0 0.0 0.0 136-137 9.6875 0.0 0.0 0.0 0.0 138-139 10.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAATT 10 0.006830828 145.0 1 GGGGGGG 20 0.00593511 29.0 105-109 TTTTTTT 35 0.0035366106 20.714287 9 >>END_MODULE Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634506 spots for SRR7172481.sra Written 634506 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra Read 634492 spots for SRR7172481.sra Written 634492 spots for SRR7172481.sra SRR ids: ['SRR7172481.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xwp4mrav SRR7172481.sra spots: 12689854 blocks: [[1, 634492], [634493, 1268984], [1268985, 1903476], [1903477, 2537968], [2537969, 3172460], [3172461, 3806952], [3806953, 4441444], [4441445, 5075936], [5075937, 5710428], [5710429, 6344920], [6344921, 6979412], [6979413, 7613904], [7613905, 8248396], [8248397, 8882888], [8882889, 9517380], [9517381, 10151872], [10151873, 10786364], [10786365, 11420856], [11420857, 12055348], [12055349, 12689854]] SRR7172481 file size 4278474 SRR7172481 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172481 SRR7172481_1.fastq SRR7172481_2.fastq Input file: SRR7172481_1.fastq Paired file: SRR7172481_2.fastq trimmed: SRR7172481-trimmed-pair1.fastq, SRR7172481-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:32:36 2025 >> started Mon Feb 10 11:32:51 2025 >> done (14.722s) 12689854 read pairs processed; of these: 17888 ( 0.14%) short read pairs filtered out after trimming by size control 67658 ( 0.53%) empty read pairs filtered out after trimming by size control 12604308 (99.33%) read pairs available; of these: 6648496 (52.75%) trimmed read pairs available after processing 5955812 (47.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 7 0.00% 21 8 0.00% 22 3 0.00% 23 6 0.00% 24 7 0.00% 25 7 0.00% 26 5 0.00% 27 9 0.00% 28 8 0.00% 29 14 0.00% 30 9 0.00% 31 12 0.00% 32 15 0.00% 33 16 0.00% 34 20 0.00% 35 12 0.00% 36 19 0.00% 37 29 0.00% 38 33 0.00% 39 37 0.00% 40 29 0.00% 41 48 0.00% 42 43 0.00% 43 41 0.00% 44 55 0.00% 45 65 0.00% 46 69 0.00% 47 81 0.00% 48 80 0.00% 49 103 0.00% 50 122 0.00% 51 153 0.00% 52 182 0.00% 53 145 0.00% 54 169 0.00% 55 222 0.00% 56 223 0.00% 57 255 0.00% 58 286 0.00% 59 321 0.00% 60 381 0.00% 61 466 0.00% 62 513 0.00% 63 590 0.00% 64 712 0.01% 65 722 0.01% 66 804 0.01% 67 906 0.01% 68 1040 0.01% 69 1277 0.01% 70 1665 0.01% 71 1582 0.01% 72 1797 0.01% 73 1964 0.02% 74 2180 0.02% 75 2375 0.02% 76 2573 0.02% 77 2834 0.02% 78 3063 0.02% 79 3641 0.03% 80 4053 0.03% 81 4587 0.04% 82 5325 0.04% 83 5984 0.05% 84 7306 0.06% 85 7869 0.06% 86 8486 0.07% 87 8893 0.07% 88 9701 0.08% 89 10147 0.08% 90 10871 0.09% 91 12079 0.10% 92 12828 0.10% 93 14345 0.11% 94 15132 0.12% 95 16154 0.13% 96 16279 0.13% 97 16956 0.13% 98 17305 0.14% 99 18225 0.14% 100 19394 0.15% 101 20212 0.16% 102 21583 0.17% 103 22781 0.18% 104 23889 0.19% 105 24891 0.20% 106 25674 0.20% 107 26133 0.21% 108 26771 0.21% 109 28356 0.22% 110 28962 0.23% 111 29811 0.24% 112 30996 0.25% 113 32932 0.26% 114 33939 0.27% 115 35457 0.28% 116 37080 0.29% 117 37070 0.29% 118 37817 0.30% 119 38447 0.31% 120 39675 0.31% 121 40164 0.32% 122 41634 0.33% 123 43883 0.35% 124 45972 0.36% 125 47097 0.37% 126 48628 0.39% 127 50000 0.40% 128 51081 0.41% 129 52097 0.41% 130 53703 0.43% 131 54663 0.43% 132 56849 0.45% 133 59208 0.47% 134 61788 0.49% 135 64854 0.51% 136 67756 0.54% 137 71203 0.56% 138 74563 0.59% 139 78224 0.62% 140 81475 0.65% 141 87722 0.70% 142 94074 0.75% 143 103631 0.82% 144 117319 0.93% 145 137935 1.09% 146 164317 1.30% 147 216410 1.72% 148 312800 2.48% 149 597492 4.74% 150 2793496 22.16% 151 5955812 47.25% 12604308 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.50 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=25.61 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.3 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=2.5 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=42.50 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.1 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATT SRR7172481 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:33:48 Started mapping on | Feb 10 11:33:48 Finished on | Feb 10 11:35:32 Mapping speed, Million of reads per hour | 436.30 Number of input reads | 12604308 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11416666 Uniquely mapped reads % | 90.58% Average mapped length | 289.97 Number of splices: Total | 10015293 Number of splices: Annotated (sjdb) | 9785602 Number of splices: GT/AG | 9805482 Number of splices: GC/AG | 168852 Number of splices: AT/AC | 6871 Number of splices: Non-canonical | 34088 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312534 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 171970 % of reads mapped to too many loci | 1.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.26% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 889159 889159 889159 N_multimapping 312534 312534 312534 N_noFeature 456059 11161208 547889 N_ambiguous 247675 1079 83455 UnstrandedReadsAssigned:10712932 PositiveStrandReadsAssigned:254379 NegativeStrandReadsAssigned:10785322 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7172481 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172481-trimmed-pair1.fastq SRR7172481-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,604,308 reads, 10,912,043 reads pseudoaligned [quant] estimated average fragment length: 225.94 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,255 rounds 52401 SRR7172481.ke.tsv 34699 SRR7172481.se.tsv 87100 total ==> SRR7172481.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.06 519 21.8272 Potri.005G024800.1.v4.1 1035 810.06 212 19.7353 Potri.004G059700.1.v4.1 961 736.099 9 0.921999 Potri.007G009000.2.v4.1 1416 1191.06 0 0 Potri.003G141000.2.v4.1 2943 2718.06 469 13.0118 Potri.016G087400.1.v4.1 270 90.7639 491 407.937 Potri.015G069301.1.v4.1 564 343.48 0 0 Potri.010G195200.1.v4.1 1773 1548.06 12 0.584545 Potri.012G127500.1.v4.1 977 752.07 65 6.51748 ==> SRR7172481.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 396 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 388 Potri.001G212900.v4.1 20 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7172481 completed mapping pipeline successfully