Starting /dee2/code/volunteer_pipeline.sh SRR7172482 current disk space = 3059097956352 free memory = 1567696164 SRR7172482 SRAfilesize 0d0381a3707fd4bb243d92b1aa26b364 SRR7172482.sra SRR7172482.sra file validated SRR7172482 is paired end SRR7172482 is conventional basespace SRR7172482 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172482_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92625 34.0 33.0 34.0 33.0 34.0 2 33.398 34.0 34.0 34.0 33.0 34.0 3 33.453 34.0 34.0 34.0 33.0 34.0 4 33.51725 34.0 34.0 34.0 33.0 34.0 5 33.49475 34.0 34.0 34.0 33.0 34.0 6 37.215 38.0 38.0 38.0 36.0 38.0 7 37.507 38.0 38.0 38.0 37.0 38.0 8 37.55375 38.0 38.0 38.0 38.0 38.0 9 37.5115 38.0 38.0 38.0 38.0 38.0 10-14 37.52045 38.0 38.0 38.0 38.0 38.0 15-19 37.56735 38.0 38.0 38.0 38.0 38.0 20-24 37.567249999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.52 38.0 38.0 38.0 38.0 38.0 30-34 37.470600000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.39025 38.0 38.0 38.0 37.2 38.0 40-44 37.20989999999999 38.0 38.0 38.0 36.2 38.0 45-49 37.128699999999995 38.0 38.0 38.0 36.0 38.0 50-54 37.0393 38.0 38.0 38.0 36.0 38.0 55-59 37.02115 38.0 38.0 38.0 36.0 38.0 60-64 36.989149999999995 38.0 38.0 38.0 35.8 38.0 65-69 36.87125 38.0 38.0 38.0 35.2 38.0 70-74 36.76225 38.0 38.0 38.0 35.0 38.0 75-79 36.612950000000005 38.0 38.0 38.0 34.4 38.0 80-84 36.4747 38.0 38.0 38.0 34.0 38.0 85-89 36.30285 38.0 37.8 38.0 34.0 38.0 90-94 36.2647 38.0 37.6 38.0 33.8 38.0 95-99 36.05515 38.0 37.2 38.0 33.0 38.0 100-104 35.9516 38.0 37.0 38.0 32.8 38.0 105-109 35.692150000000005 38.0 37.0 38.0 31.0 38.0 110-114 35.23325 38.0 36.0 38.0 29.0 38.0 115-119 35.2623 38.0 36.0 38.0 28.8 38.0 120-124 34.87365 38.0 35.4 38.0 27.6 38.0 125-129 34.6699 38.0 35.0 38.0 26.6 38.0 130-134 34.22465 38.0 34.6 38.0 24.4 38.0 135-139 33.576350000000005 38.0 33.8 38.0 21.4 38.0 140-144 32.87885 38.0 33.2 38.0 15.0 38.0 145-149 31.8673 37.8 31.4 38.0 10.8 38.0 150-151 27.413249999999998 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 2.0 12 1.0 13 2.0 14 2.0 15 3.0 16 1.0 17 1.0 18 3.0 19 6.0 20 4.0 21 12.0 22 7.0 23 9.0 24 17.0 25 18.0 26 28.0 27 27.0 28 22.0 29 51.0 30 62.0 31 72.0 32 91.0 33 123.0 34 165.0 35 350.0 36 817.0 37 2103.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.08577246118605 15.95825909900738 6.999236446933062 29.956731992873504 2 20.9 18.125 36.225 24.75 3 17.549999999999997 25.8 28.65 28.000000000000004 4 21.55 33.725 22.75 21.975 5 21.475 37.875 22.025 18.625 6 17.150000000000002 35.575 26.6 20.674999999999997 7 13.875000000000002 23.3 44.675 18.15 8 17.1 22.425 31.45 29.025000000000002 9 17.95 23.549999999999997 33.4 25.1 10-14 20.080000000000002 29.715000000000003 26.200000000000003 24.005000000000003 15-19 19.830000000000002 28.575 27.985 23.61 20-24 20.085 27.894999999999996 27.785 24.235 25-29 20.345 28.199999999999996 28.060000000000002 23.395 30-34 20.025000000000002 28.58 27.755000000000003 23.64 35-39 19.8 28.93 27.21 24.060000000000002 40-44 20.4 28.67 27.075 23.855 45-49 20.025000000000002 29.015 27.92 23.04 50-54 20.07 28.804999999999996 27.595 23.53 55-59 20.085 29.330000000000002 26.974999999999998 23.61 60-64 19.55 29.125 27.334999999999997 23.990000000000002 65-69 19.785 27.93 27.99 24.295 70-74 20.16504126031508 28.562140535133786 27.49687421855464 23.775943985996502 75-79 20.36 28.38 27.650000000000002 23.61 80-84 20.485 28.439999999999998 27.73 23.345 85-89 20.62 28.34 27.115000000000002 23.925 90-94 20.616030801540077 28.691434571728585 27.28636431821591 23.406170308515424 95-99 20.380000000000003 28.025 27.975 23.62 100-104 20.239227265902606 28.472048446023724 27.325959661678596 23.962764626395074 105-109 20.260130065032516 28.254127063531765 27.943971985993 23.541770885442723 110-114 20.19842661722704 28.62153630305156 27.413939970937516 23.766097108783885 115-119 20.472165257840246 28.459960986345223 27.20452158255389 23.86335217326064 120-124 20.86 28.37 27.71 23.06 125-129 20.919999999999998 27.884999999999998 27.29 23.905 130-134 21.21 27.71 27.495000000000005 23.585 135-139 20.845 28.365000000000002 27.229999999999997 23.56 140-144 20.655 28.439999999999998 27.089999999999996 23.815 145-149 20.87 28.565 27.005000000000003 23.56 150-151 19.075 29.275000000000002 27.55 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 2.0 19 1.0 20 1.0 21 2.0 22 2.0 23 2.5 24 4.0 25 5.5 26 3.0 27 4.0 28 10.0 29 15.5 30 24.5 31 31.5 32 44.5 33 55.5 34 55.5 35 67.5 36 90.5 37 102.0 38 130.5 39 160.5 40 180.0 41 216.5 42 234.0 43 252.5 44 263.5 45 253.0 46 263.0 47 253.5 48 222.5 49 199.0 50 181.0 51 150.0 52 109.0 53 89.5 54 81.5 55 60.0 56 40.5 57 37.0 58 27.0 59 20.0 60 15.5 61 11.5 62 8.0 63 3.5 64 2.5 65 3.5 66 2.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.095 105-109 0.05 110-114 0.215 115-119 0.034999999999999996 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.3250000000000002 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.7125 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.6375 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.1625 0.0 0.0 0.0 0.0 132-133 4.574999999999999 0.0 0.0 0.0 0.0 134-135 4.9625 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138-139 5.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGATT 10 0.0068343505 144.975 8 >>END_MODULE SRR7172482 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172482_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5925 33.0 33.0 34.0 32.0 34.0 2 32.65875 34.0 33.0 34.0 32.0 34.0 3 32.68525 34.0 33.0 34.0 32.0 34.0 4 32.59675 34.0 33.0 34.0 32.0 34.0 5 32.64075 34.0 33.0 34.0 32.0 34.0 6 36.74675 38.0 38.0 38.0 36.0 38.0 7 36.86875 38.0 38.0 38.0 37.0 38.0 8 36.86275 38.0 38.0 38.0 36.0 38.0 9 36.8495 38.0 38.0 38.0 36.0 38.0 10-14 36.89925 38.0 38.0 38.0 36.6 38.0 15-19 36.8949 38.0 38.0 38.0 36.8 38.0 20-24 36.8565 38.0 38.0 38.0 37.0 38.0 25-29 36.827149999999996 38.0 38.0 38.0 36.8 38.0 30-34 36.819900000000004 38.0 38.0 38.0 36.8 38.0 35-39 36.674850000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.7559 38.0 38.0 38.0 36.2 38.0 45-49 36.68814999999999 38.0 38.0 38.0 36.2 38.0 50-54 36.657349999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.65275 38.0 38.0 38.0 36.0 38.0 60-64 36.577200000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.4404 38.0 38.0 38.0 35.0 38.0 70-74 36.408300000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.30535 38.0 38.0 38.0 34.6 38.0 80-84 36.215700000000005 38.0 38.0 38.0 34.2 38.0 85-89 36.1609 38.0 38.0 38.0 34.0 38.0 90-94 35.9913 38.0 38.0 38.0 33.6 38.0 95-99 35.855549999999994 38.0 38.0 38.0 33.2 38.0 100-104 35.7295 38.0 38.0 38.0 32.6 38.0 105-109 35.66325 38.0 38.0 38.0 32.0 38.0 110-114 35.40715 38.0 37.4 38.0 30.6 38.0 115-119 35.242450000000005 38.0 37.0 38.0 30.0 38.0 120-124 34.8998 38.0 36.4 38.0 27.8 38.0 125-129 34.6173 38.0 36.0 38.0 26.8 38.0 130-134 34.16155 38.0 35.4 38.0 23.4 38.0 135-139 33.6776 38.0 34.0 38.0 20.4 38.0 140-144 33.01115 38.0 33.0 38.0 13.8 38.0 145-149 32.07205 38.0 33.0 38.0 8.6 38.0 150-151 27.5335 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 2.0 4 4.0 5 3.0 6 2.0 7 2.0 8 5.0 9 3.0 10 2.0 11 3.0 12 4.0 13 0.0 14 7.0 15 2.0 16 8.0 17 5.0 18 6.0 19 5.0 20 13.0 21 8.0 22 13.0 23 16.0 24 22.0 25 20.0 26 22.0 27 35.0 28 25.0 29 34.0 30 44.0 31 64.0 32 79.0 33 77.0 34 144.0 35 221.0 36 571.0 37 2500.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.51221354822463 21.254092168219593 9.493830269453538 22.73986401410224 2 25.894206549118387 25.642317380352647 32.06549118387909 16.397984886649873 3 20.634920634920633 26.55580750818846 33.68606701940035 19.12320483749055 4 23.481985386747294 35.626102292768955 22.600151171579743 18.29176114890401 5 23.532375913328295 37.36457545981355 22.95288485764676 16.150163769211385 6 20.336852689793865 37.00351935646054 23.906485671191554 18.753142282554048 7 19.028441983387868 18.701233324943367 42.084067455323435 20.18625723634533 8 19.92452830188679 24.47798742138365 28.930817610062892 26.666666666666668 9 21.836477987421386 24.40251572327044 30.289308176100626 23.471698113207548 10-14 23.10672772102853 28.611684194635938 26.53851959945655 21.743068484878982 15-19 23.076923076923077 28.228605926447653 27.906625748352365 20.787845248276902 20-24 23.07576214910957 28.53908843948083 27.49773619076366 20.88741322064594 25-29 22.597676874340024 28.38537738220948 28.26469552974305 20.752250213707445 30-34 22.919913528731588 28.30928560655573 28.012669046302346 20.758131818410337 35-39 22.8692110423895 28.57142857142857 28.0987579826017 20.46060240358023 40-44 22.841183574879224 27.868357487922708 28.43196457326892 20.858494363929147 45-49 22.63049277696683 28.172346101575478 28.655559470478682 20.54160165097901 50-54 23.373093764155218 27.57058734712366 28.375861895414968 20.680456993306155 55-59 23.823174411587207 27.49446791390062 28.178434922550792 20.503922751961376 60-64 22.9407623453686 27.793422508297294 28.356632806999897 20.909182339334205 65-69 23.00377358490566 28.07547169811321 28.21635220125786 20.70440251572327 70-74 23.247622402254315 28.022945705228196 27.997785940723595 20.731645951793894 75-79 22.471458029472412 28.42126439672082 28.20499924558668 20.902278328220085 80-84 23.696396215019124 28.11052949466479 27.461244211797865 20.73183007851822 85-89 23.364862145300865 28.023747232843633 28.250150935801972 20.36123968605353 90-94 22.87483013739997 27.49005989229453 28.45135638431728 21.183753585988224 95-99 23.76422027584818 28.068055975032717 27.997583811537304 20.170139937581798 100-104 23.821027731642257 27.902763098293825 27.71654335900146 20.55966581106246 105-109 23.42995169082126 27.616747181964573 28.517512077294686 20.435789049919485 110-114 23.252654355155236 28.143712574850298 27.640517284758214 20.96311578523625 115-119 23.246452651705745 27.649189896346986 28.29324745899165 20.811109992955622 120-124 23.569955224631485 28.631081149066762 27.302912914423704 20.49605071187805 125-129 23.983698933387 27.440128798551015 28.17971422821493 20.39645803984705 130-134 24.260712130356065 27.72580969623818 27.740897203781934 20.272580969623817 135-139 24.674410418866596 27.36461004676422 27.942877256499223 20.018102277869964 140-144 24.334658147607787 27.302912914423704 28.64114302963224 19.721285908336267 145-149 25.012581781580273 28.04730749874182 27.226975339708105 19.713135379969803 150-151 24.547055863110216 27.692501258178158 27.98188223452441 19.77856064418722 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 22.0 1 11.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 1.5 19 1.0 20 0.0 21 0.5 22 1.5 23 2.5 24 5.0 25 5.0 26 6.0 27 10.5 28 12.5 29 13.0 30 16.0 31 24.5 32 33.0 33 41.0 34 51.0 35 57.5 36 81.5 37 104.5 38 129.5 39 172.5 40 212.0 41 233.5 42 256.0 43 271.0 44 265.0 45 271.0 46 258.0 47 231.5 48 204.0 49 185.0 50 163.0 51 135.5 52 119.5 53 96.0 54 76.0 55 57.0 56 43.0 57 40.5 58 30.0 59 22.0 60 15.0 61 5.5 62 3.0 63 1.5 64 1.0 65 0.5 66 1.5 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.75 3 0.775 4 0.775 5 0.775 6 0.5499999999999999 7 0.675 8 0.625 9 0.625 10-14 0.635 15-19 0.615 20-24 0.61 25-29 0.565 30-34 0.545 35-39 0.565 40-44 0.64 45-49 0.6649999999999999 50-54 0.655 55-59 0.58 60-64 0.5700000000000001 65-69 0.625 70-74 0.635 75-79 0.585 80-84 0.66 85-89 0.62 90-94 0.655 95-99 0.67 100-104 0.655 105-109 0.64 110-114 0.635 115-119 0.63 120-124 0.615 125-129 0.62 130-134 0.58 135-139 0.565 140-144 0.615 145-149 0.65 150-151 0.65 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31697444978498 98.15 2 0.6324310650139134 1.25 3 0.025297242600556536 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025297242600556536 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 21 0.525 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.6375000000000002 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.35 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 3.0875 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 3.9625 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.625 0.0 0.0 0.0 0.0 134-135 5.0125 0.0 0.0 0.0 0.0 136-137 5.35 0.0 0.0 0.0 0.0 138-139 5.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAACC 10 0.006830828 145.0 2 >>END_MODULE Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871458 spots for SRR7172482.sra Written 871458 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra Read 871444 spots for SRR7172482.sra Written 871444 spots for SRR7172482.sra SRR ids: ['SRR7172482.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q067bmt0 SRR7172482.sra spots: 17428894 blocks: [[1, 871444], [871445, 1742888], [1742889, 2614332], [2614333, 3485776], [3485777, 4357220], [4357221, 5228664], [5228665, 6100108], [6100109, 6971552], [6971553, 7842996], [7842997, 8714440], [8714441, 9585884], [9585885, 10457328], [10457329, 11328772], [11328773, 12200216], [12200217, 13071660], [13071661, 13943104], [13943105, 14814548], [14814549, 15685992], [15685993, 16557436], [16557437, 17428894]] SRR7172482 file size 5884379 SRR7172482 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172482 SRR7172482_1.fastq SRR7172482_2.fastq Input file: SRR7172482_1.fastq Paired file: SRR7172482_2.fastq trimmed: SRR7172482-trimmed-pair1.fastq, SRR7172482-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:34:22 2025 >> started Mon Feb 10 11:34:43 2025 >> done (21.630s) 17428894 read pairs processed; of these: 24982 ( 0.14%) short read pairs filtered out after trimming by size control 117631 ( 0.67%) empty read pairs filtered out after trimming by size control 17286281 (99.18%) read pairs available; of these: 9032067 (52.25%) trimmed read pairs available after processing 8254214 (47.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 11 0.00% 20 12 0.00% 21 7 0.00% 22 11 0.00% 23 11 0.00% 24 8 0.00% 25 8 0.00% 26 13 0.00% 27 11 0.00% 28 13 0.00% 29 17 0.00% 30 17 0.00% 31 16 0.00% 32 11 0.00% 33 21 0.00% 34 15 0.00% 35 24 0.00% 36 17 0.00% 37 19 0.00% 38 22 0.00% 39 24 0.00% 40 25 0.00% 41 30 0.00% 42 30 0.00% 43 34 0.00% 44 46 0.00% 45 39 0.00% 46 45 0.00% 47 60 0.00% 48 51 0.00% 49 67 0.00% 50 59 0.00% 51 88 0.00% 52 88 0.00% 53 97 0.00% 54 119 0.00% 55 143 0.00% 56 140 0.00% 57 167 0.00% 58 192 0.00% 59 228 0.00% 60 219 0.00% 61 260 0.00% 62 319 0.00% 63 349 0.00% 64 350 0.00% 65 370 0.00% 66 462 0.00% 67 505 0.00% 68 588 0.00% 69 677 0.00% 70 828 0.00% 71 904 0.01% 72 966 0.01% 73 1053 0.01% 74 1151 0.01% 75 1325 0.01% 76 1487 0.01% 77 1572 0.01% 78 1724 0.01% 79 2023 0.01% 80 2300 0.01% 81 2670 0.02% 82 2964 0.02% 83 3340 0.02% 84 4580 0.03% 85 5285 0.03% 86 5622 0.03% 87 5859 0.03% 88 6174 0.04% 89 6562 0.04% 90 7159 0.04% 91 7548 0.04% 92 8398 0.05% 93 9307 0.05% 94 9632 0.06% 95 9950 0.06% 96 10343 0.06% 97 10912 0.06% 98 11215 0.06% 99 12053 0.07% 100 12660 0.07% 101 13267 0.08% 102 14519 0.08% 103 15323 0.09% 104 15944 0.09% 105 17190 0.10% 106 17693 0.10% 107 18786 0.11% 108 19364 0.11% 109 20323 0.12% 110 21321 0.12% 111 22361 0.13% 112 23568 0.14% 113 24660 0.14% 114 25929 0.15% 115 27304 0.16% 116 28538 0.17% 117 29720 0.17% 118 30625 0.18% 119 31754 0.18% 120 33516 0.19% 121 34755 0.20% 122 36589 0.21% 123 38694 0.22% 124 40338 0.23% 125 42225 0.24% 126 44684 0.26% 127 46296 0.27% 128 48432 0.28% 129 51066 0.30% 130 53408 0.31% 131 55193 0.32% 132 59232 0.34% 133 62981 0.36% 134 66824 0.39% 135 72088 0.42% 136 76828 0.44% 137 82360 0.48% 138 87221 0.50% 139 94519 0.55% 140 102736 0.59% 141 113007 0.65% 142 126426 0.73% 143 144809 0.84% 144 171662 0.99% 145 203877 1.18% 146 257716 1.49% 147 349311 2.02% 148 525788 3.04% 149 1017494 5.89% 150 4300077 24.88% 151 8254214 47.75% 17286281 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=0.47 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=448.74 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=18.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=20 prefix-density=0.63 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=18.96 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.9 sequence=CAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR7172482 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:35:28 Started mapping on | Feb 10 11:35:29 Finished on | Feb 10 11:37:23 Mapping speed, Million of reads per hour | 545.88 Number of input reads | 17286281 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16112114 Uniquely mapped reads % | 93.21% Average mapped length | 293.51 Number of splices: Total | 15577422 Number of splices: Annotated (sjdb) | 15224465 Number of splices: GT/AG | 15276199 Number of splices: GC/AG | 245200 Number of splices: AT/AC | 8735 Number of splices: Non-canonical | 47288 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442294 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 90857 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 753537 753537 753537 N_multimapping 442294 442294 442294 N_noFeature 714624 15844261 827372 N_ambiguous 256145 1125 100287 UnstrandedReadsAssigned:15141345 PositiveStrandReadsAssigned:266728 NegativeStrandReadsAssigned:15184455 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172482 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172482-trimmed-pair1.fastq SRR7172482-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,286,281 reads, 15,191,661 reads pseudoaligned [quant] estimated average fragment length: 255.644 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52401 SRR7172482.ke.tsv 34699 SRR7172482.se.tsv 87100 total ==> SRR7172482.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.36 552 19.3158 Potri.005G024800.1.v4.1 1035 780.356 92 7.2746 Potri.004G059700.1.v4.1 961 706.468 3 0.262025 Potri.007G009000.2.v4.1 1416 1161.36 0 0 Potri.003G141000.2.v4.1 2943 2688.36 1133.5 26.0165 Potri.016G087400.1.v4.1 270 78.8895 662 517.789 Potri.015G069301.1.v4.1 564 319.207 0 0 Potri.010G195200.1.v4.1 1773 1518.36 30 1.21916 Potri.012G127500.1.v4.1 977 722.405 94 8.029 ==> SRR7172482.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 995 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 247 Potri.001G212900.v4.1 27 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR7172482 completed mapping pipeline successfully