Starting /dee2/code/volunteer_pipeline.sh SRR7172483 current disk space = 3059104305152 free memory = 1562444516 SRR7172483 SRAfilesize 822ef5718e8c7e3a7667f36bfcdfbb3d SRR7172483.sra SRR7172483.sra file validated SRR7172483 is paired end SRR7172483 is conventional basespace SRR7172483 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172483_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.753 34.0 33.0 34.0 33.0 34.0 2 33.363 34.0 34.0 34.0 33.0 34.0 3 33.3965 34.0 34.0 34.0 33.0 34.0 4 33.4495 34.0 34.0 34.0 33.0 34.0 5 33.44725 34.0 34.0 34.0 33.0 34.0 6 37.06325 38.0 38.0 38.0 36.0 38.0 7 37.48425 38.0 38.0 38.0 37.0 38.0 8 37.51475 38.0 38.0 38.0 38.0 38.0 9 37.53625 38.0 38.0 38.0 38.0 38.0 10-14 37.54295 38.0 38.0 38.0 38.0 38.0 15-19 37.4982 38.0 38.0 38.0 38.0 38.0 20-24 37.509750000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.502700000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.45115 38.0 38.0 38.0 37.4 38.0 35-39 37.365449999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.19799999999999 38.0 38.0 38.0 36.4 38.0 45-49 37.085800000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.93580000000001 38.0 38.0 38.0 35.8 38.0 55-59 36.96595 38.0 38.0 38.0 36.0 38.0 60-64 36.9482 38.0 38.0 38.0 36.0 38.0 65-69 36.78535 38.0 38.0 38.0 35.2 38.0 70-74 36.72085 38.0 38.0 38.0 35.0 38.0 75-79 36.580099999999995 38.0 38.0 38.0 34.4 38.0 80-84 36.4212 38.0 38.0 38.0 34.0 38.0 85-89 36.3178 38.0 37.8 38.0 34.0 38.0 90-94 36.252300000000005 38.0 37.8 38.0 33.8 38.0 95-99 36.0661 38.0 37.0 38.0 33.0 38.0 100-104 35.93155 38.0 37.0 38.0 32.2 38.0 105-109 35.6409 38.0 36.8 38.0 30.6 38.0 110-114 35.2938 38.0 36.2 38.0 29.0 38.0 115-119 35.2453 38.0 36.0 38.0 28.8 38.0 120-124 34.95905 38.0 35.8 38.0 27.8 38.0 125-129 34.56095 38.0 35.0 38.0 26.6 38.0 130-134 34.34715 38.0 35.0 38.0 25.2 38.0 135-139 33.6688 38.0 34.0 38.0 21.0 38.0 140-144 33.005649999999996 38.0 33.2 38.0 16.2 38.0 145-149 32.0496 38.0 32.4 38.0 10.8 38.0 150-151 27.530124999999998 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 2.0 15 0.0 16 4.0 17 2.0 18 7.0 19 5.0 20 12.0 21 6.0 22 9.0 23 17.0 24 15.0 25 19.0 26 22.0 27 25.0 28 25.0 29 39.0 30 45.0 31 65.0 32 105.0 33 134.0 34 179.0 35 328.0 36 816.0 37 2113.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.27665558680644 14.472002045512655 8.156481718230632 39.09486064945027 2 21.725 18.15 37.075 23.05 3 16.575 23.9 27.800000000000004 31.724999999999998 4 21.625 32.05 23.775 22.55 5 20.8 36.675000000000004 24.625 17.9 6 17.75 35.025 26.224999999999998 21.0 7 13.075000000000001 23.625 43.625 19.675 8 16.525000000000002 23.75 31.874999999999996 27.85 9 17.299999999999997 24.325 33.5 24.875 10-14 20.064999999999998 29.005 26.985 23.945 15-19 19.705000000000002 28.54 27.58 24.175 20-24 19.689999999999998 28.895 28.050000000000004 23.365 25-29 19.49 29.125 27.900000000000002 23.485 30-34 19.595000000000002 28.985 27.865000000000002 23.555 35-39 19.98 29.065 27.310000000000002 23.645 40-44 20.175 28.23 28.03 23.565 45-49 20.25 28.265 27.705000000000002 23.78 50-54 20.04 28.96 27.650000000000002 23.35 55-59 20.435 28.485 27.825 23.255 60-64 19.39 29.515 27.74 23.355 65-69 19.85 28.465 28.199999999999996 23.485 70-74 20.294999999999998 28.895 27.250000000000004 23.56 75-79 19.77 28.595 28.199999999999996 23.435 80-84 20.135 28.99 27.72 23.155 85-89 19.905 29.225 27.47 23.400000000000002 90-94 20.095 28.675 27.779999999999998 23.45 95-99 20.39 28.51 27.42 23.68 100-104 19.930979293788138 28.48854656396919 28.088426527958386 23.492047614284285 105-109 20.655 28.88 27.915 22.55 110-114 20.58661594674408 28.529956454276988 27.909304770008507 22.97412282897042 115-119 20.424999999999997 28.945 28.044999999999998 22.585 120-124 21.325 28.665000000000003 27.185 22.825 125-129 20.75 28.575 27.185 23.49 130-134 20.775 28.735 27.33 23.16 135-139 20.565 28.735 27.450000000000003 23.25 140-144 21.035 29.015 26.875 23.075000000000003 145-149 20.585 28.985 27.04 23.39 150-151 20.4125 28.749999999999996 27.925 22.912499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.5 22 1.5 23 2.5 24 5.5 25 5.5 26 5.5 27 8.5 28 13.0 29 17.0 30 24.0 31 33.5 32 42.0 33 57.0 34 66.5 35 72.5 36 104.0 37 129.5 38 141.5 39 164.0 40 193.5 41 232.0 42 247.0 43 244.0 44 236.5 45 246.0 46 246.5 47 234.5 48 230.0 49 196.5 50 165.0 51 141.5 52 120.0 53 92.5 54 60.5 55 46.5 56 41.5 57 34.5 58 26.5 59 20.5 60 14.0 61 10.5 62 6.5 63 3.5 64 4.0 65 3.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.105 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.32630522088353414 0.65 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 4.0125 0.0 0.0 0.0 0.0 126-127 4.3875 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.175 0.0 0.0 0.0 0.0 132-133 5.487500000000001 0.0 0.0 0.0 0.0 134-135 5.9125 0.0 0.0 0.0 0.0 136-137 6.487500000000001 0.0 0.0 0.0 0.0 138-139 6.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCTG 10 0.0068343505 144.975 5 CCACGGC 10 0.0068343505 144.975 9 CCACCTC 10 0.0068343505 144.975 2 TCCACGG 10 0.0068343505 144.975 8 >>END_MODULE SRR7172483 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172483_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.542 33.0 33.0 34.0 32.0 34.0 2 32.72575 34.0 33.0 34.0 32.0 34.0 3 32.81725 34.0 33.0 34.0 32.0 34.0 4 32.6795 34.0 33.0 34.0 32.0 34.0 5 32.695 34.0 33.0 34.0 32.0 34.0 6 36.77525 38.0 38.0 38.0 36.0 38.0 7 36.8845 38.0 38.0 38.0 37.0 38.0 8 36.85275 38.0 38.0 38.0 37.0 38.0 9 36.85525 38.0 38.0 38.0 36.0 38.0 10-14 36.91405 38.0 38.0 38.0 36.6 38.0 15-19 36.94935 38.0 38.0 38.0 37.0 38.0 20-24 36.91439999999999 38.0 38.0 38.0 36.8 38.0 25-29 36.88545 38.0 38.0 38.0 36.6 38.0 30-34 36.85855 38.0 38.0 38.0 36.4 38.0 35-39 36.76005 38.0 38.0 38.0 36.0 38.0 40-44 36.7844 38.0 38.0 38.0 36.0 38.0 45-49 36.764199999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.74765 38.0 38.0 38.0 36.0 38.0 55-59 36.7181 38.0 38.0 38.0 36.0 38.0 60-64 36.661199999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.5695 38.0 38.0 38.0 35.6 38.0 70-74 36.53245 38.0 38.0 38.0 35.0 38.0 75-79 36.42975 38.0 38.0 38.0 34.8 38.0 80-84 36.23375 38.0 38.0 38.0 34.0 38.0 85-89 36.17380000000001 38.0 38.0 38.0 34.0 38.0 90-94 35.9553 38.0 38.0 38.0 33.4 38.0 95-99 35.8588 38.0 38.0 38.0 33.2 38.0 100-104 35.7493 38.0 38.0 38.0 32.6 38.0 105-109 35.58935 38.0 37.6 38.0 31.8 38.0 110-114 35.37085 38.0 37.0 38.0 30.8 38.0 115-119 35.206300000000006 38.0 37.0 38.0 29.6 38.0 120-124 34.9021 38.0 36.2 38.0 27.8 38.0 125-129 34.69135 38.0 36.0 38.0 27.6 38.0 130-134 34.14025 38.0 35.2 38.0 23.6 38.0 135-139 33.5556 38.0 33.8 38.0 19.0 38.0 140-144 32.8209 38.0 33.0 38.0 13.4 38.0 145-149 31.938300000000005 38.0 32.8 38.0 8.6 38.0 150-151 27.332124999999998 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 3.0 4 3.0 5 4.0 6 1.0 7 1.0 8 3.0 9 3.0 10 2.0 11 0.0 12 3.0 13 3.0 14 4.0 15 5.0 16 5.0 17 9.0 18 12.0 19 13.0 20 12.0 21 6.0 22 8.0 23 15.0 24 20.0 25 22.0 26 34.0 27 27.0 28 33.0 29 35.0 30 45.0 31 56.0 32 78.0 33 115.0 34 141.0 35 229.0 36 577.0 37 2454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.02710843373494 20.55722891566265 13.579317269076304 27.836345381526108 2 24.403715792116497 26.537785588752193 33.91915641476274 15.139342204368567 3 19.437468608739326 28.427925665494726 31.617277749874432 20.51732797589151 4 22.852837769964843 36.16273229532898 23.43043696634857 17.55399296835761 5 23.85735811150176 37.01657458563536 22.626820693119036 16.49924660974385 6 18.73119358074223 39.16750250752257 23.696088264794383 18.405215646940825 7 18.09284818067754 19.623588456712675 43.01129234629862 19.27227101631117 8 20.767494356659142 23.752194632555806 30.072736393278156 25.407574617506896 9 22.422874341610232 24.053172811637825 29.29520943064961 24.228743416102333 10-14 22.731149350323584 28.68108162343852 27.15597250790147 21.431796518336427 15-19 22.479181298284338 28.17798735828233 28.639510384268085 20.703320959165243 20-24 23.134028892455856 27.788924558587482 28.8473113964687 20.22973515248796 25-29 22.416127576350235 28.634471691489892 28.07281480367083 20.876585928489042 30-34 22.866740198536046 28.852902837661688 27.920385039606938 20.359971924195328 35-39 22.822325861290807 28.243317787473043 28.709693596108522 20.224662755127625 40-44 22.927955047160346 27.89985952237608 28.667469395946217 20.504716034517358 45-49 22.46700456666834 27.972098158277714 28.514076378782555 21.04682089627139 50-54 22.64539113854182 28.200110391891215 28.425911987555825 20.72858648201114 55-59 23.239719157472415 27.4222668004012 28.60581745235707 20.73219658976931 60-64 23.011734028683183 28.15665429746264 29.00912646675359 19.82248520710059 65-69 23.357078358583326 27.465636600782585 28.609411056486405 20.56787398414769 70-74 23.037174534691214 27.998795966487734 28.00882957908995 20.9551999197311 75-79 23.25208145250276 28.232520814525024 28.22248971812619 20.292908014846024 80-84 23.27378562826174 27.965676435166596 28.18145323163388 20.579084704937774 85-89 23.230499122146977 27.82543265613243 28.261851015801355 20.682217205919237 90-94 23.81334671349724 27.832413447064724 28.108379327646766 20.24586051179127 95-99 23.225935963063336 28.04878048780488 28.410117434507676 20.31516611462411 100-104 23.08695870339706 27.939184103567666 28.28541321692007 20.68844397611521 105-109 22.917920931165963 27.88480834838451 28.215934176199077 20.98133654425045 110-114 23.213927353000198 28.46177001806141 28.02528597230584 20.299016656632553 115-119 23.103552077062012 28.53702588801926 27.66405779650813 20.695364238410598 120-124 24.164743654058395 27.79672920638106 27.902076853616936 20.136450285943614 125-129 24.261275272161743 27.923543871971102 28.32990518236091 19.485275673506248 130-134 24.50095295415789 27.931587922559935 27.550406259404152 20.01705286387802 135-139 24.383149448345034 28.239719157472415 27.9839518555667 19.393179538615847 140-144 25.046400802608478 27.695008778530223 27.48934035615751 19.769250062703787 145-149 24.40541896638234 28.725539387857502 27.516307074761663 19.352734570998496 150-151 24.636226793778224 28.03562468640241 27.621675865529355 19.706472654290014 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 5.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 2.5 21 2.5 22 1.0 23 2.0 24 6.5 25 8.5 26 6.0 27 7.0 28 10.5 29 12.5 30 16.5 31 22.5 32 30.5 33 43.5 34 58.0 35 73.0 36 102.5 37 131.0 38 157.5 39 181.0 40 196.5 41 231.0 42 260.0 43 270.0 44 277.5 45 269.5 46 249.0 47 228.5 48 212.0 49 189.5 50 156.0 51 121.0 52 101.5 53 88.0 54 73.5 55 55.0 56 31.5 57 21.5 58 20.0 59 16.0 60 11.5 61 8.5 62 4.0 63 5.5 64 5.0 65 3.0 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.42500000000000004 3 0.44999999999999996 4 0.44999999999999996 5 0.44999999999999996 6 0.3 7 0.375 8 0.325 9 0.325 10-14 0.335 15-19 0.33 20-24 0.32 25-29 0.295 30-34 0.27 35-39 0.295 40-44 0.33999999999999997 45-49 0.365 50-54 0.35500000000000004 55-59 0.3 60-64 0.29 65-69 0.33 70-74 0.335 75-79 0.31 80-84 0.36 85-89 0.325 90-94 0.35000000000000003 95-99 0.37 100-104 0.35500000000000004 105-109 0.33999999999999997 110-114 0.33999999999999997 115-119 0.33999999999999997 120-124 0.33 125-129 0.335 130-134 0.31 135-139 0.3 140-144 0.325 145-149 0.35000000000000003 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3680485338726 98.275 2 0.4802831142568251 0.95 3 0.05055611729019212 0.15 4 0.02527805864509606 0.1 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.02527805864509606 0.17500000000000002 8 0.0 0.0 9 0.02527805864509606 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.475 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.2375 0.0 0.0 0.0 0.0 128-129 4.6 0.0 0.0 0.0 0.0 130-131 4.95 0.0 0.0 0.0 0.0 132-133 5.2875 0.0 0.0 0.0 0.0 134-135 5.6875 0.0 0.0 0.0 0.0 136-137 6.262499999999999 0.0 0.0 0.0 0.0 138-139 6.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAAGT 10 0.006830828 145.0 2 >>END_MODULE Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838589 spots for SRR7172483.sra Written 838589 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra Read 838575 spots for SRR7172483.sra Written 838575 spots for SRR7172483.sra SRR ids: ['SRR7172483.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gjfnu0mq SRR7172483.sra spots: 16771514 blocks: [[1, 838575], [838576, 1677150], [1677151, 2515725], [2515726, 3354300], [3354301, 4192875], [4192876, 5031450], [5031451, 5870025], [5870026, 6708600], [6708601, 7547175], [7547176, 8385750], [8385751, 9224325], [9224326, 10062900], [10062901, 10901475], [10901476, 11740050], [11740051, 12578625], [12578626, 13417200], [13417201, 14255775], [14255776, 15094350], [15094351, 15932925], [15932926, 16771514]] SRR7172483 file size 5661615 SRR7172483 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172483 SRR7172483_1.fastq SRR7172483_2.fastq Input file: SRR7172483_1.fastq Paired file: SRR7172483_2.fastq trimmed: SRR7172483-trimmed-pair1.fastq, SRR7172483-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:38:42 2025 >> started Mon Feb 10 11:39:10 2025 >> done (27.665s) 16771514 read pairs processed; of these: 23172 ( 0.14%) short read pairs filtered out after trimming by size control 111999 ( 0.67%) empty read pairs filtered out after trimming by size control 16636343 (99.19%) read pairs available; of these: 8909039 (53.55%) trimmed read pairs available after processing 7727304 (46.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 2 0.00% 20 9 0.00% 21 5 0.00% 22 9 0.00% 23 6 0.00% 24 17 0.00% 25 13 0.00% 26 15 0.00% 27 14 0.00% 28 11 0.00% 29 258 0.00% 30 9 0.00% 31 9 0.00% 32 18 0.00% 33 17 0.00% 34 7 0.00% 35 37 0.00% 36 25 0.00% 37 27 0.00% 38 27 0.00% 39 28 0.00% 40 25 0.00% 41 18 0.00% 42 33 0.00% 43 39 0.00% 44 30 0.00% 45 60 0.00% 46 54 0.00% 47 77 0.00% 48 68 0.00% 49 72 0.00% 50 90 0.00% 51 97 0.00% 52 114 0.00% 53 113 0.00% 54 137 0.00% 55 113 0.00% 56 168 0.00% 57 202 0.00% 58 191 0.00% 59 231 0.00% 60 284 0.00% 61 353 0.00% 62 341 0.00% 63 412 0.00% 64 460 0.00% 65 512 0.00% 66 558 0.00% 67 631 0.00% 68 710 0.00% 69 1007 0.01% 70 1127 0.01% 71 1098 0.01% 72 1206 0.01% 73 1373 0.01% 74 1443 0.01% 75 1635 0.01% 76 1763 0.01% 77 2018 0.01% 78 2173 0.01% 79 2391 0.01% 80 2738 0.02% 81 3191 0.02% 82 3614 0.02% 83 4013 0.02% 84 5238 0.03% 85 6069 0.04% 86 6470 0.04% 87 6850 0.04% 88 7411 0.04% 89 7811 0.05% 90 8379 0.05% 91 9185 0.06% 92 9929 0.06% 93 10997 0.07% 94 11525 0.07% 95 11936 0.07% 96 12635 0.08% 97 13197 0.08% 98 13605 0.08% 99 14591 0.09% 100 15578 0.09% 101 16426 0.10% 102 17465 0.10% 103 18303 0.11% 104 19353 0.12% 105 20717 0.12% 106 21563 0.13% 107 22092 0.13% 108 23072 0.14% 109 24561 0.15% 110 25301 0.15% 111 26792 0.16% 112 28194 0.17% 113 29396 0.18% 114 31051 0.19% 115 32118 0.19% 116 33222 0.20% 117 34505 0.21% 118 35940 0.22% 119 37104 0.22% 120 38525 0.23% 121 39953 0.24% 122 41804 0.25% 123 44246 0.27% 124 45826 0.28% 125 47874 0.29% 126 50256 0.30% 127 52015 0.31% 128 54442 0.33% 129 56719 0.34% 130 59045 0.35% 131 61773 0.37% 132 64826 0.39% 133 68193 0.41% 134 71984 0.43% 135 77026 0.46% 136 81373 0.49% 137 87479 0.53% 138 92223 0.55% 139 100330 0.60% 140 107390 0.65% 141 117140 0.70% 142 129707 0.78% 143 147657 0.89% 144 173117 1.04% 145 204423 1.23% 146 253538 1.52% 147 338609 2.04% 148 503965 3.03% 149 961090 5.78% 150 4030354 24.23% 151 7727304 46.45% 16636343 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=34 prefix-density=0.23 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=468.59 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=19.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.76 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=26.27 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=10.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172483 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:39:55 Started mapping on | Feb 10 11:39:55 Finished on | Feb 10 11:42:10 Mapping speed, Million of reads per hour | 443.64 Number of input reads | 16636343 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15464915 Uniquely mapped reads % | 92.96% Average mapped length | 292.33 Number of splices: Total | 14655585 Number of splices: Annotated (sjdb) | 14265943 Number of splices: GT/AG | 14377824 Number of splices: GC/AG | 208890 Number of splices: AT/AC | 8693 Number of splices: Non-canonical | 60178 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 504675 % of reads mapped to multiple loci | 3.03% Number of reads mapped to too many loci | 79698 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.38% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 686827 686827 686827 N_multimapping 504675 504675 504675 N_noFeature 709434 15193347 846394 N_ambiguous 271525 1367 136022 UnstrandedReadsAssigned:14483956 PositiveStrandReadsAssigned:270201 NegativeStrandReadsAssigned:14482499 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172483 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172483-trimmed-pair1.fastq SRR7172483-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,636,343 reads, 14,482,683 reads pseudoaligned [quant] estimated average fragment length: 246.87 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,030 rounds 52401 SRR7172483.ke.tsv 34699 SRR7172483.se.tsv 87100 total ==> SRR7172483.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.13 1575 59.0606 Potri.005G024800.1.v4.1 1035 789.13 270 22.7367 Potri.004G059700.1.v4.1 961 715.278 5 0.464524 Potri.007G009000.2.v4.1 1416 1170.13 0 0 Potri.003G141000.2.v4.1 2943 2697.13 623.309 15.3573 Potri.016G087400.1.v4.1 270 83.2542 1215.99 970.59 Potri.015G069301.1.v4.1 564 327.054 0 0 Potri.010G195200.1.v4.1 1773 1527.13 1569.84 68.3113 Potri.012G127500.1.v4.1 977 731.213 291 26.4461 ==> SRR7172483.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 387 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 261 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 25 SRR7172483 completed mapping pipeline successfully