Starting /dee2/code/volunteer_pipeline.sh SRR7172484 current disk space = 3058932289536 free memory = 1382092872 SRR7172484 SRAfilesize 5cd6f23ce6941a881963fa7a08dc87ca SRR7172484.sra SRR7172484.sra file validated SRR7172484 is paired end SRR7172484 is conventional basespace SRR7172484 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172484_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0505 34.0 34.0 34.0 33.0 34.0 2 33.5145 34.0 34.0 34.0 33.0 34.0 3 33.50275 34.0 34.0 34.0 33.0 34.0 4 33.547 34.0 34.0 34.0 33.0 34.0 5 33.5835 34.0 34.0 34.0 33.0 34.0 6 37.3485 38.0 38.0 38.0 37.0 38.0 7 37.5035 38.0 38.0 38.0 37.0 38.0 8 37.56975 38.0 38.0 38.0 38.0 38.0 9 37.6235 38.0 38.0 38.0 38.0 38.0 10-14 37.571549999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.583149999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.608599999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.5649 38.0 38.0 38.0 38.0 38.0 30-34 37.5119 38.0 38.0 38.0 38.0 38.0 35-39 37.50685 38.0 38.0 38.0 38.0 38.0 40-44 37.3546 38.0 38.0 38.0 37.0 38.0 45-49 37.3197 38.0 38.0 38.0 37.0 38.0 50-54 37.128 38.0 38.0 38.0 36.0 38.0 55-59 37.19115000000001 38.0 38.0 38.0 36.4 38.0 60-64 37.1371 38.0 38.0 38.0 36.0 38.0 65-69 37.0517 38.0 38.0 38.0 36.0 38.0 70-74 36.96435 38.0 38.0 38.0 35.8 38.0 75-79 36.8431 38.0 38.0 38.0 35.4 38.0 80-84 36.7372 38.0 38.0 38.0 35.0 38.0 85-89 36.7618 38.0 38.0 38.0 34.8 38.0 90-94 36.6218 38.0 38.0 38.0 34.4 38.0 95-99 36.43255 38.0 37.8 38.0 33.8 38.0 100-104 36.23695 38.0 37.4 38.0 33.8 38.0 105-109 36.062149999999995 38.0 37.4 38.0 33.2 38.0 110-114 35.68905 38.0 37.0 38.0 31.0 38.0 115-119 35.7825 38.0 37.0 38.0 31.4 38.0 120-124 35.61065000000001 38.0 36.2 38.0 31.0 38.0 125-129 35.21215 38.0 36.0 38.0 28.8 38.0 130-134 34.8819 38.0 35.4 38.0 27.8 38.0 135-139 34.521049999999995 38.0 35.0 38.0 26.2 38.0 140-144 33.79925 38.0 33.8 38.0 22.8 38.0 145-149 32.972899999999996 38.0 33.2 38.0 16.6 38.0 150-151 28.646250000000002 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 2.0 19 3.0 20 3.0 21 7.0 22 9.0 23 8.0 24 12.0 25 15.0 26 15.0 27 23.0 28 32.0 29 35.0 30 39.0 31 42.0 32 87.0 33 97.0 34 172.0 35 289.0 36 723.0 37 2380.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.76327152654306 13.462026924053848 9.601219202438404 41.1734823469647 2 20.0 19.075 36.675000000000004 24.25 3 19.1 24.125 26.35 30.425 4 21.5 33.925 21.925 22.650000000000002 5 21.375 36.025 23.75 18.85 6 16.75 36.875 25.650000000000002 20.724999999999998 7 13.975000000000001 22.175 44.525 19.325 8 17.224999999999998 23.95 32.4 26.424999999999997 9 19.3 21.475 32.75 26.474999999999998 10-14 19.505 28.985 27.02 24.490000000000002 15-19 19.425 27.894999999999996 27.83 24.85 20-24 19.42 28.595 27.99 23.995 25-29 19.64 28.470000000000002 27.779999999999998 24.11 30-34 19.62 28.449999999999996 28.325 23.605 35-39 19.495 28.43 28.185 23.89 40-44 19.945 29.13 27.49 23.435 45-49 20.025000000000002 27.965 27.98 24.03 50-54 19.905 28.105000000000004 28.28 23.71 55-59 19.525000000000002 28.64 27.99 23.845 60-64 19.825 28.275 27.800000000000004 24.099999999999998 65-69 19.900000000000002 27.975 28.165000000000003 23.96 70-74 19.505 28.07 28.470000000000002 23.955000000000002 75-79 19.470000000000002 28.749999999999996 28.310000000000002 23.47 80-84 20.165 28.035 28.294999999999998 23.505000000000003 85-89 20.225 27.785 27.625 24.365000000000002 90-94 20.36 27.915 28.12 23.605 95-99 20.09 28.345 27.865000000000002 23.7 100-104 20.20015011258444 28.40630472854641 27.815861896422316 23.577683262446836 105-109 20.150000000000002 28.549999999999997 27.750000000000004 23.549999999999997 110-114 20.302559735510695 28.337424234834447 27.29048740169313 24.069528627961727 115-119 20.44 28.694999999999997 27.79 23.075000000000003 120-124 19.66 28.785 27.97 23.585 125-129 20.244999999999997 28.18 27.639999999999997 23.935000000000002 130-134 20.935000000000002 28.845 26.935 23.285 135-139 20.495 28.794999999999998 27.1 23.61 140-144 20.72 28.42 27.325 23.535 145-149 21.175 28.585 26.68 23.56 150-151 21.0 28.7 26.474999999999998 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 3.0 24 4.5 25 5.0 26 6.5 27 10.0 28 12.0 29 16.5 30 19.5 31 27.5 32 34.0 33 42.0 34 66.5 35 83.5 36 88.0 37 103.5 38 136.0 39 174.0 40 197.0 41 207.0 42 231.5 43 265.5 44 278.5 45 272.0 46 245.5 47 234.0 48 226.0 49 197.5 50 163.5 51 134.5 52 118.5 53 94.5 54 75.5 55 63.5 56 52.0 57 31.5 58 20.5 59 16.5 60 9.0 61 8.0 62 8.0 63 5.0 64 2.5 65 2.0 66 0.5 67 0.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.075 105-109 0.0 110-114 0.185 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.875 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.7874999999999996 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.8 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138-139 6.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATACAAT 10 0.006832588 144.9875 6 >>END_MODULE SRR7172484 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172484_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7855 33.0 33.0 34.0 32.0 34.0 2 32.92525 34.0 33.0 34.0 32.0 34.0 3 32.956 34.0 33.0 34.0 32.0 34.0 4 32.90025 34.0 33.0 34.0 32.0 34.0 5 32.959 34.0 33.0 34.0 32.0 34.0 6 37.06575 38.0 38.0 38.0 37.0 38.0 7 37.0485 38.0 38.0 38.0 37.0 38.0 8 37.1245 38.0 38.0 38.0 37.0 38.0 9 37.0915 38.0 38.0 38.0 37.0 38.0 10-14 37.02335 38.0 38.0 38.0 37.0 38.0 15-19 37.0448 38.0 38.0 38.0 37.0 38.0 20-24 37.03995 38.0 38.0 38.0 37.0 38.0 25-29 37.0357 38.0 38.0 38.0 37.0 38.0 30-34 36.9976 38.0 38.0 38.0 37.0 38.0 35-39 36.979949999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.0016 38.0 38.0 38.0 37.0 38.0 45-49 36.93765 38.0 38.0 38.0 37.0 38.0 50-54 36.92895 38.0 38.0 38.0 36.6 38.0 55-59 36.888099999999994 38.0 38.0 38.0 36.6 38.0 60-64 36.82645 38.0 38.0 38.0 36.6 38.0 65-69 36.73864999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.7578 38.0 38.0 38.0 36.2 38.0 75-79 36.52095 38.0 38.0 38.0 35.2 38.0 80-84 36.56385 38.0 38.0 38.0 35.6 38.0 85-89 36.5792 38.0 38.0 38.0 35.4 38.0 90-94 36.357000000000006 38.0 38.0 38.0 34.8 38.0 95-99 36.236 38.0 38.0 38.0 34.0 38.0 100-104 36.20495 38.0 38.0 38.0 34.0 38.0 105-109 35.8863 38.0 38.0 38.0 33.4 38.0 110-114 35.8994 38.0 38.0 38.0 33.4 38.0 115-119 35.695949999999996 38.0 38.0 38.0 32.4 38.0 120-124 35.547399999999996 38.0 37.0 38.0 32.0 38.0 125-129 35.344199999999994 38.0 37.0 38.0 31.0 38.0 130-134 34.9715 38.0 36.2 38.0 28.8 38.0 135-139 34.511199999999995 38.0 35.8 38.0 25.8 38.0 140-144 33.8798 38.0 34.4 38.0 23.0 38.0 145-149 33.234249999999996 38.0 33.0 38.0 16.2 38.0 150-151 29.01825 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 4.0 4 3.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 3.0 12 1.0 13 7.0 14 4.0 15 6.0 16 1.0 17 7.0 18 8.0 19 5.0 20 5.0 21 11.0 22 8.0 23 16.0 24 11.0 25 11.0 26 13.0 27 24.0 28 25.0 29 28.0 30 43.0 31 55.0 32 65.0 33 84.0 34 116.0 35 203.0 36 479.0 37 2729.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.14501130937421 20.432269414425736 13.64664488564966 28.776074390550388 2 25.30786629806484 26.91631063081176 33.82759487308369 13.948228198039708 3 19.63298139768728 29.11010558069382 30.568124685771746 20.688788335847157 4 23.02664655605832 35.822021116138764 23.0517848164907 18.099547511312217 5 23.65510306686777 36.5761689291101 23.0517848164907 16.71694318753142 6 18.784530386740332 39.126067302862886 24.91210447011552 17.177297840281266 7 19.7388247112004 18.884982420894023 42.36564540431944 19.01054746358614 8 21.76426237748178 23.67429002261875 28.625282734355366 25.936164865544107 9 21.713998492083437 24.528776074390553 29.85674792661473 23.900477506911283 10-14 23.355279690405588 28.62743127104589 26.938734482585314 21.078554555963212 15-19 23.076149786378487 28.167881377230458 27.896456396079415 20.859512440311637 20-24 22.84263959390863 28.24043825702367 28.104739407950944 20.812182741116754 25-29 22.481165243596184 28.45806127574083 28.096433952787542 20.96433952787544 30-34 22.697599678618058 28.216330219945768 28.351913226875563 20.73415687456061 35-39 22.56266010347079 28.002410969913104 28.66040484203124 20.77452408458486 40-44 23.226941442573512 27.685348077406385 28.333752199044987 20.75395828097512 45-49 22.86001507916562 28.384016084443324 27.896456396079415 20.859512440311637 50-54 23.045991455139482 27.87635084192008 28.439306358381504 20.638351344558934 55-59 23.475027635413525 27.901718420259268 28.102703245904937 20.52055069842227 60-64 23.09431686849907 27.893070699964827 28.36038390030652 20.652228531229586 65-69 23.09277314302945 27.666097095185442 28.389787918383757 20.851341843401347 70-74 23.096255340537823 27.78084945966323 28.368936918823824 20.75395828097512 75-79 23.965820557929128 28.03216888665494 27.690374465946217 20.31163608946972 80-84 23.739633073636593 28.32369942196532 27.29328977129932 20.64337773309877 85-89 23.729580296556925 28.147775823071125 27.690374465946217 20.432269414425736 90-94 23.980899723548628 27.775823071123394 27.594873083689368 20.648404121638603 95-99 23.60392058306107 28.469464689620505 27.408896707715506 20.517718019602917 100-104 24.001005277707968 27.625031414928376 27.816034179442074 20.557929127921586 105-109 24.151796933902993 28.12264388037195 27.609952249308872 20.115606936416185 110-114 23.87031917567228 28.464438301080676 27.730585574264893 19.93465694898216 115-119 24.151796933902993 27.91153556169892 27.831113345061574 20.105554159336517 120-124 23.81000251319427 27.775823071123394 27.68032168886655 20.733852726815783 125-129 23.84518723297311 27.991957778336264 27.921588338778587 20.24126664991204 130-134 25.094197437829692 28.314493845767398 26.973122331072595 19.61818638533032 135-139 24.718649517684888 28.08480707395498 27.692926045016076 19.50361736334405 140-144 24.604171902488062 28.017089721035436 27.705453631565717 19.67328474491078 145-149 25.20733852726816 28.38904247298316 26.644885649660722 19.75873335008796 150-151 24.968585071626038 27.821060567981903 26.966574516210102 20.243779844181955 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 17.0 1 8.5 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 1.0 9 1.5 10 0.5 11 0.5 12 0.5 13 0.0 14 1.0 15 1.0 16 1.0 17 1.5 18 1.5 19 1.5 20 0.5 21 1.0 22 2.0 23 3.5 24 3.5 25 2.5 26 5.0 27 4.5 28 7.5 29 12.0 30 18.5 31 29.0 32 36.5 33 41.0 34 46.0 35 75.5 36 104.0 37 106.5 38 138.5 39 175.0 40 188.0 41 221.0 42 244.0 43 266.5 44 270.5 45 260.0 46 245.0 47 230.0 48 224.5 49 203.0 50 175.0 51 135.0 52 107.0 53 92.0 54 77.0 55 56.0 56 39.0 57 32.0 58 24.0 59 18.0 60 13.5 61 10.5 62 9.5 63 6.5 64 3.5 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.525 3 0.5499999999999999 4 0.5499999999999999 5 0.5499999999999999 6 0.44999999999999996 7 0.44999999999999996 8 0.525 9 0.525 10-14 0.515 15-19 0.525 20-24 0.515 25-29 0.44999999999999996 30-34 0.43 35-39 0.455 40-44 0.525 45-49 0.525 50-54 0.525 55-59 0.49 60-64 0.49500000000000005 65-69 0.51 70-74 0.525 75-79 0.525 80-84 0.525 85-89 0.525 90-94 0.525 95-99 0.525 100-104 0.525 105-109 0.525 110-114 0.525 115-119 0.525 120-124 0.525 125-129 0.525 130-134 0.475 135-139 0.48 140-144 0.525 145-149 0.525 150-151 0.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57092377587077 98.625 2 0.3028773346794548 0.6 3 0.05047955577990913 0.15 4 0.05047955577990913 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025239777889954566 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 17 0.42500000000000004 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.825 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.65 0.0 0.0 0.0 0.0 122-123 2.9375 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.775 0.0 0.0 0.0 0.0 128-129 4.45 0.0 0.0 0.0 0.0 130-131 4.9375 0.0 0.0 0.0 0.0 132-133 5.325 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138-139 6.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812061 spots for SRR7172484.sra Written 812061 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra Read 812045 spots for SRR7172484.sra Written 812045 spots for SRR7172484.sra SRR ids: ['SRR7172484.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hc_glqzj SRR7172484.sra spots: 16240916 blocks: [[1, 812045], [812046, 1624090], [1624091, 2436135], [2436136, 3248180], [3248181, 4060225], [4060226, 4872270], [4872271, 5684315], [5684316, 6496360], [6496361, 7308405], [7308406, 8120450], [8120451, 8932495], [8932496, 9744540], [9744541, 10556585], [10556586, 11368630], [11368631, 12180675], [12180676, 12992720], [12992721, 13804765], [13804766, 14616810], [14616811, 15428855], [15428856, 16240916]] SRR7172484 file size 5481813 SRR7172484 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172484 SRR7172484_1.fastq SRR7172484_2.fastq Input file: SRR7172484_1.fastq Paired file: SRR7172484_2.fastq trimmed: SRR7172484-trimmed-pair1.fastq, SRR7172484-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:45:49 2025 >> started Mon Feb 10 11:46:08 2025 >> done (18.995s) 16240916 read pairs processed; of these: 17655 ( 0.11%) short read pairs filtered out after trimming by size control 103973 ( 0.64%) empty read pairs filtered out after trimming by size control 16119288 (99.25%) read pairs available; of these: 8401423 (52.12%) trimmed read pairs available after processing 7717865 (47.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 6 0.00% 21 8 0.00% 22 8 0.00% 23 8 0.00% 24 4 0.00% 25 7 0.00% 26 7 0.00% 27 7 0.00% 28 9 0.00% 29 4 0.00% 30 8 0.00% 31 17 0.00% 32 14 0.00% 33 8 0.00% 34 7 0.00% 35 12 0.00% 36 15 0.00% 37 13 0.00% 38 25 0.00% 39 13 0.00% 40 18 0.00% 41 34 0.00% 42 33 0.00% 43 32 0.00% 44 28 0.00% 45 37 0.00% 46 46 0.00% 47 45 0.00% 48 64 0.00% 49 78 0.00% 50 62 0.00% 51 71 0.00% 52 91 0.00% 53 100 0.00% 54 131 0.00% 55 142 0.00% 56 146 0.00% 57 131 0.00% 58 150 0.00% 59 226 0.00% 60 235 0.00% 61 282 0.00% 62 316 0.00% 63 369 0.00% 64 399 0.00% 65 375 0.00% 66 446 0.00% 67 558 0.00% 68 652 0.00% 69 776 0.00% 70 944 0.01% 71 936 0.01% 72 1076 0.01% 73 1208 0.01% 74 1273 0.01% 75 1356 0.01% 76 1555 0.01% 77 1680 0.01% 78 1916 0.01% 79 2115 0.01% 80 2417 0.01% 81 2663 0.02% 82 3063 0.02% 83 3599 0.02% 84 4358 0.03% 85 5239 0.03% 86 5515 0.03% 87 5836 0.04% 88 6338 0.04% 89 6622 0.04% 90 7293 0.05% 91 7828 0.05% 92 8623 0.05% 93 9445 0.06% 94 10014 0.06% 95 10698 0.07% 96 10994 0.07% 97 11548 0.07% 98 12218 0.08% 99 12701 0.08% 100 13658 0.08% 101 14282 0.09% 102 15194 0.09% 103 16289 0.10% 104 17167 0.11% 105 18110 0.11% 106 19186 0.12% 107 19928 0.12% 108 20781 0.13% 109 21468 0.13% 110 22626 0.14% 111 23373 0.15% 112 25061 0.16% 113 26130 0.16% 114 27335 0.17% 115 28792 0.18% 116 29980 0.19% 117 31019 0.19% 118 32126 0.20% 119 33355 0.21% 120 34259 0.21% 121 35852 0.22% 122 36769 0.23% 123 39217 0.24% 124 41166 0.26% 125 42181 0.26% 126 45008 0.28% 127 46460 0.29% 128 48725 0.30% 129 50278 0.31% 130 52657 0.33% 131 55143 0.34% 132 57600 0.36% 133 60691 0.38% 134 64543 0.40% 135 68400 0.42% 136 72119 0.45% 137 76746 0.48% 138 83333 0.52% 139 89613 0.56% 140 96125 0.60% 141 104849 0.65% 142 116371 0.72% 143 130776 0.81% 144 152216 0.94% 145 179698 1.11% 146 223147 1.38% 147 300431 1.86% 148 464501 2.88% 149 897474 5.57% 150 4011860 24.89% 151 7717865 47.88% 16119288 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=10 prefix-density=0.38 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=397.70 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=21 prefix-density=0.44 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=62.28 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.9 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATGTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7172484 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:46:57 Started mapping on | Feb 10 11:46:58 Finished on | Feb 10 11:49:05 Mapping speed, Million of reads per hour | 456.92 Number of input reads | 16119288 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14935452 Uniquely mapped reads % | 92.66% Average mapped length | 293.19 Number of splices: Total | 14440122 Number of splices: Annotated (sjdb) | 14078418 Number of splices: GT/AG | 14161335 Number of splices: GC/AG | 218734 Number of splices: AT/AC | 8385 Number of splices: Non-canonical | 51668 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 447018 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 100708 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 751902 751902 751902 N_multimapping 447018 447018 447018 N_noFeature 631593 14663194 754973 N_ambiguous 274206 1346 124366 UnstrandedReadsAssigned:14029653 PositiveStrandReadsAssigned:270912 NegativeStrandReadsAssigned:14056113 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172484 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172484-trimmed-pair1.fastq SRR7172484-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,119,288 reads, 14,047,638 reads pseudoaligned [quant] estimated average fragment length: 244.224 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR7172484.ke.tsv 34699 SRR7172484.se.tsv 87100 total ==> SRR7172484.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.78 1418 51.2467 Potri.005G024800.1.v4.1 1035 791.776 312 25.2747 Potri.004G059700.1.v4.1 961 717.849 7 0.625458 Potri.007G009000.2.v4.1 1416 1172.78 0 0 Potri.003G141000.2.v4.1 2943 2699.78 813.447 19.3257 Potri.016G087400.1.v4.1 270 81.551 840 660.668 Potri.015G069301.1.v4.1 564 328.124 0 0 Potri.010G195200.1.v4.1 1773 1529.78 424.932 17.8166 Potri.012G127500.1.v4.1 977 733.802 82 7.1675 ==> SRR7172484.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 389 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 121 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR7172484 completed mapping pipeline successfully