Starting /dee2/code/volunteer_pipeline.sh SRR7172485 current disk space = 3058887704576 free memory = 1294107500 SRR7172485 SRAfilesize 987cdaf71580e987e8ded2b96a20289a SRR7172485.sra SRR7172485.sra file validated SRR7172485 is paired end SRR7172485 is conventional basespace SRR7172485 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172485_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.24575 34.0 33.0 34.0 32.0 34.0 2 33.23075 34.0 33.0 34.0 32.0 34.0 3 33.32175 34.0 33.0 34.0 32.0 34.0 4 33.4185 34.0 33.0 34.0 33.0 34.0 5 33.2125 34.0 33.0 34.0 33.0 34.0 6 37.0705 38.0 37.0 38.0 36.0 38.0 7 37.405 38.0 38.0 38.0 37.0 38.0 8 37.5315 38.0 38.0 38.0 37.0 38.0 9 37.481 38.0 38.0 38.0 37.0 38.0 10-14 37.375299999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.1429 38.0 38.0 38.0 36.4 38.0 20-24 37.0949 38.0 38.0 38.0 36.0 38.0 25-29 37.40445 38.0 38.0 38.0 37.0 38.0 30-34 37.1841 38.0 38.0 38.0 36.6 38.0 35-39 37.08964999999999 38.0 38.0 38.0 36.0 38.0 40-44 37.1781 38.0 38.0 38.0 36.2 38.0 45-49 36.5624 38.0 37.8 38.0 34.2 38.0 50-54 36.95399999999999 38.0 38.0 38.0 35.8 38.0 55-59 36.98695 38.0 38.0 38.0 35.6 38.0 60-64 36.867999999999995 38.0 38.0 38.0 35.2 38.0 65-69 36.81185000000001 38.0 38.0 38.0 34.8 38.0 70-74 36.47715000000001 38.0 37.6 38.0 34.2 38.0 75-79 36.4853 38.0 37.6 38.0 34.0 38.0 80-84 36.258849999999995 38.0 37.0 38.0 33.4 38.0 85-89 36.1155 38.0 37.0 38.0 32.4 38.0 90-94 35.65865 38.0 36.6 38.0 30.6 38.0 95-99 36.195550000000004 38.0 37.0 38.0 33.2 38.0 100-104 36.075500000000005 38.0 37.0 38.0 32.8 38.0 105-109 35.677049999999994 38.0 36.8 38.0 30.6 38.0 110-114 35.53315 38.0 36.2 38.0 30.2 38.0 115-119 35.355000000000004 38.0 36.0 38.0 29.4 38.0 120-124 35.128 38.0 35.8 38.0 28.2 38.0 125-129 34.65560000000001 38.0 35.0 38.0 26.4 38.0 130-134 34.2983 38.0 34.6 38.0 24.6 38.0 135-139 33.7565 38.0 34.0 38.0 22.8 38.0 140-144 32.74465 37.4 33.2 38.0 15.6 38.0 145-149 30.953249999999997 35.8 30.4 38.0 9.2 38.0 150-151 27.551625 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 4.0 15 2.0 16 3.0 17 1.0 18 6.0 19 0.0 20 3.0 21 2.0 22 7.0 23 6.0 24 10.0 25 24.0 26 23.0 27 26.0 28 36.0 29 57.0 30 58.0 31 89.0 32 103.0 33 159.0 34 235.0 35 426.0 36 964.0 37 1755.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.09764309764309 14.840714840714842 7.07070707070707 34.99093499093499 2 18.925 20.45 38.224999999999994 22.400000000000002 3 19.950000000000003 25.174999999999997 26.474999999999998 28.4 4 22.575 31.874999999999996 22.825 22.725 5 23.025000000000002 37.475 22.400000000000002 17.1 6 16.425 36.025 26.224999999999998 21.325 7 13.875000000000002 23.1 44.925 18.099999999999998 8 16.5 22.7 32.925 27.875 9 18.325 24.125 32.800000000000004 24.75 10-14 19.965 29.5 26.545 23.990000000000002 15-19 19.985 27.92 28.244999999999997 23.849999999999998 20-24 19.470000000000002 28.375 28.13 24.025 25-29 19.814999999999998 27.875 27.975 24.335 30-34 20.369999999999997 28.435 27.985 23.21 35-39 19.8 28.705000000000002 28.115000000000002 23.380000000000003 40-44 20.055 28.405 27.98 23.56 45-49 20.36 28.310000000000002 27.99 23.34 50-54 19.99 28.15 28.225 23.635 55-59 20.330000000000002 28.205000000000002 27.665 23.799999999999997 60-64 20.330000000000002 27.994999999999997 27.689999999999998 23.985 65-69 19.91 28.04 27.845 24.205 70-74 20.54 27.884999999999998 28.084999999999997 23.49 75-79 20.150000000000002 28.525 27.965 23.36 80-84 20.03 28.76 27.565 23.645 85-89 20.78 27.935 28.16 23.125 90-94 20.235 28.860000000000003 27.500000000000004 23.405 95-99 20.955 28.645 27.860000000000003 22.54 100-104 20.29 28.735 27.485 23.49 105-109 20.18 28.744999999999997 27.16 23.915 110-114 20.595 28.435 27.755000000000003 23.215 115-119 20.95 28.285 27.200000000000003 23.565 120-124 19.845 29.175 27.35 23.630000000000003 125-129 20.474999999999998 27.985 27.67 23.87 130-134 21.11 28.185 27.185 23.52 135-139 20.815 28.26 27.175 23.75 140-144 21.335 27.55 27.565 23.549999999999997 145-149 20.49 28.875 26.840000000000003 23.794999999999998 150-151 20.875 29.025000000000002 26.387500000000003 23.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.5 23 4.0 24 5.5 25 6.0 26 8.5 27 11.0 28 9.0 29 13.5 30 24.0 31 33.0 32 30.5 33 38.0 34 57.0 35 75.0 36 94.5 37 113.5 38 133.5 39 148.0 40 166.0 41 217.5 42 265.5 43 257.5 44 262.0 45 268.0 46 257.5 47 254.5 48 225.0 49 203.5 50 171.5 51 129.0 52 113.5 53 93.5 54 76.0 55 60.0 56 41.5 57 33.0 58 27.0 59 19.5 60 16.0 61 9.0 62 3.5 63 4.0 64 2.5 65 1.0 66 2.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.475 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 2.9625000000000004 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.625 0.0 0.0 0.0 0.0 130-131 4.95 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.5625 0.0 0.0 0.0 0.0 136-137 6.1125 0.0 0.0 0.0 0.0 138-139 6.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACCA 10 0.0060887975 150.61038 1 TCTGTCG 10 0.006836113 144.9625 2 CTGTCGA 10 0.006836113 144.9625 3 CTTCTTC 35 0.003315817 62.12679 8 >>END_MODULE SRR7172485 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172485_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06125 33.0 33.0 34.0 32.0 34.0 2 33.1595 34.0 33.0 34.0 32.0 34.0 3 33.23425 34.0 33.0 34.0 33.0 34.0 4 33.1885 34.0 33.0 34.0 33.0 34.0 5 33.227 34.0 33.0 34.0 33.0 34.0 6 37.372 38.0 38.0 38.0 37.0 38.0 7 37.3485 38.0 38.0 38.0 37.0 38.0 8 37.38225 38.0 38.0 38.0 38.0 38.0 9 37.1695 38.0 38.0 38.0 37.0 38.0 10-14 37.1944 38.0 38.0 38.0 36.8 38.0 15-19 37.3192 38.0 38.0 38.0 37.2 38.0 20-24 37.04785 38.0 38.0 38.0 36.4 38.0 25-29 37.037150000000004 38.0 38.0 38.0 36.8 38.0 30-34 37.14475 38.0 38.0 38.0 36.8 38.0 35-39 37.1701 38.0 38.0 38.0 37.0 38.0 40-44 36.8974 38.0 38.0 38.0 36.0 38.0 45-49 36.99355 38.0 38.0 38.0 36.6 38.0 50-54 36.7492 38.0 38.0 38.0 35.2 38.0 55-59 37.0391 38.0 38.0 38.0 36.2 38.0 60-64 37.06654999999999 38.0 38.0 38.0 36.4 38.0 65-69 36.73389999999999 38.0 38.0 38.0 35.2 38.0 70-74 36.830650000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.88965 38.0 38.0 38.0 36.0 38.0 80-84 36.76765 38.0 38.0 38.0 35.6 38.0 85-89 36.2555 38.0 37.8 38.0 33.2 38.0 90-94 36.53855 38.0 38.0 38.0 34.6 38.0 95-99 36.55755 38.0 38.0 38.0 35.0 38.0 100-104 36.12595 38.0 37.6 38.0 33.2 38.0 105-109 36.19995 38.0 38.0 38.0 34.0 38.0 110-114 35.9886 38.0 37.6 38.0 33.4 38.0 115-119 35.9892 38.0 37.8 38.0 33.2 38.0 120-124 35.808 38.0 37.0 38.0 32.8 38.0 125-129 35.5124 38.0 36.8 38.0 31.0 38.0 130-134 34.74530000000001 38.0 35.6 38.0 26.6 38.0 135-139 34.3906 38.0 35.0 38.0 25.2 38.0 140-144 34.2192 38.0 35.0 38.0 24.2 38.0 145-149 33.4892 38.0 34.2 38.0 19.8 38.0 150-151 29.8925 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 3.0 10 0.0 11 0.0 12 2.0 13 5.0 14 3.0 15 5.0 16 5.0 17 0.0 18 7.0 19 5.0 20 1.0 21 5.0 22 10.0 23 11.0 24 8.0 25 16.0 26 19.0 27 23.0 28 29.0 29 31.0 30 41.0 31 55.0 32 67.0 33 105.0 34 141.0 35 258.0 36 617.0 37 2518.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.05 21.625 9.85 25.474999999999998 2 22.900000000000002 26.125 36.025 14.95 3 19.925 27.700000000000003 33.75 18.625 4 23.75 35.025 23.825 17.4 5 23.225 37.65 22.025 17.1 6 18.2 38.775 24.425 18.6 7 19.2 18.15 41.675000000000004 20.974999999999998 8 18.575 25.0 29.975 26.450000000000003 9 22.475 25.275 29.25 23.0 10-14 23.785 28.26 26.665 21.29 15-19 22.61 27.900000000000002 28.57 20.919999999999998 20-24 22.384999999999998 29.015 28.000000000000004 20.599999999999998 25-29 22.75 28.715000000000003 28.355000000000004 20.18 30-34 22.25 28.71 27.99 21.05 35-39 22.73 28.794999999999998 27.685 20.79 40-44 22.775000000000002 27.939999999999998 28.310000000000002 20.974999999999998 45-49 22.34 28.415000000000003 28.444999999999997 20.8 50-54 22.725 27.860000000000003 28.449999999999996 20.965 55-59 22.38 27.735 28.595 21.29 60-64 23.01 26.97 28.865000000000002 21.154999999999998 65-69 22.86 27.72 28.449999999999996 20.97 70-74 22.985 28.305000000000003 27.22 21.490000000000002 75-79 22.81 27.560000000000002 28.115000000000002 21.515 80-84 23.11 27.46 28.03 21.4 85-89 23.24 27.855 27.955000000000002 20.95 90-94 22.725 28.455000000000002 28.1 20.72 95-99 23.169999999999998 27.515 28.43 20.885 100-104 22.830000000000002 28.325 27.87 20.974999999999998 105-109 23.68 27.725 28.15 20.445 110-114 22.935 28.575 27.77 20.72 115-119 23.595 27.595 28.74 20.07 120-124 23.695 28.000000000000004 27.825 20.48 125-129 24.05 27.744999999999997 27.634999999999998 20.57 130-134 24.55 27.46 27.425 20.565 135-139 24.005000000000003 27.83 27.650000000000002 20.515 140-144 24.055 27.77 27.495000000000005 20.68 145-149 24.325 28.13 27.365000000000002 20.18 150-151 25.4875 27.712500000000002 26.1625 20.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 2.5 20 2.0 21 1.5 22 1.5 23 2.5 24 5.5 25 8.0 26 10.5 27 13.5 28 16.5 29 16.0 30 19.5 31 22.5 32 27.0 33 41.5 34 58.0 35 72.5 36 95.5 37 113.5 38 132.5 39 161.0 40 194.0 41 226.5 42 254.5 43 264.5 44 270.5 45 275.0 46 253.0 47 242.0 48 216.5 49 173.0 50 153.5 51 134.0 52 119.5 53 101.0 54 76.5 55 61.5 56 42.5 57 27.5 58 17.5 59 17.0 60 16.5 61 10.5 62 8.0 63 7.0 64 4.0 65 1.5 66 0.0 67 1.5 68 1.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16582406471183 98.075 2 0.6572295247724975 1.3 3 0.10111223458038424 0.3 4 0.05055611729019212 0.2 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 0.9874999999999999 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 2.15 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.225 0.0 0.0 0.0 0.0 128-129 4.574999999999999 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.225 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138-139 6.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069817 spots for SRR7172485.sra Written 1069817 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra Read 1069804 spots for SRR7172485.sra Written 1069804 spots for SRR7172485.sra SRR ids: ['SRR7172485.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_twj9iboe SRR7172485.sra spots: 21396093 blocks: [[1, 1069804], [1069805, 2139608], [2139609, 3209412], [3209413, 4279216], [4279217, 5349020], [5349021, 6418824], [6418825, 7488628], [7488629, 8558432], [8558433, 9628236], [9628237, 10698040], [10698041, 11767844], [11767845, 12837648], [12837649, 13907452], [13907453, 14977256], [14977257, 16047060], [16047061, 17116864], [17116865, 18186668], [18186669, 19256472], [19256473, 20326276], [20326277, 21396093]] SRR7172485 file size 7228733 SRR7172485 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172485 SRR7172485_1.fastq SRR7172485_2.fastq Input file: SRR7172485_1.fastq Paired file: SRR7172485_2.fastq trimmed: SRR7172485-trimmed-pair1.fastq, SRR7172485-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:51:33 2025 >> started Mon Feb 10 11:51:55 2025 >> done (22.806s) 21396093 read pairs processed; of these: 18939 ( 0.09%) short read pairs filtered out after trimming by size control 11365 ( 0.05%) empty read pairs filtered out after trimming by size control 21365789 (99.86%) read pairs available; of these: 10276904 (48.10%) trimmed read pairs available after processing 11088885 (51.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 12 0.00% 20 9 0.00% 21 11 0.00% 22 16 0.00% 23 15 0.00% 24 11 0.00% 25 16 0.00% 26 13 0.00% 27 20 0.00% 28 13 0.00% 29 23 0.00% 30 25 0.00% 31 18 0.00% 32 16 0.00% 33 28 0.00% 34 16 0.00% 35 24 0.00% 36 24 0.00% 37 20 0.00% 38 25 0.00% 39 39 0.00% 40 28 0.00% 41 23 0.00% 42 38 0.00% 43 38 0.00% 44 42 0.00% 45 53 0.00% 46 66 0.00% 47 68 0.00% 48 80 0.00% 49 74 0.00% 50 89 0.00% 51 97 0.00% 52 130 0.00% 53 132 0.00% 54 148 0.00% 55 171 0.00% 56 191 0.00% 57 215 0.00% 58 263 0.00% 59 287 0.00% 60 354 0.00% 61 377 0.00% 62 421 0.00% 63 486 0.00% 64 547 0.00% 65 593 0.00% 66 710 0.00% 67 850 0.00% 68 1084 0.01% 69 1640 0.01% 70 1361 0.01% 71 1278 0.01% 72 1411 0.01% 73 1667 0.01% 74 1794 0.01% 75 2010 0.01% 76 2339 0.01% 77 2525 0.01% 78 2844 0.01% 79 3155 0.01% 80 3495 0.02% 81 3966 0.02% 82 4400 0.02% 83 4999 0.02% 84 6252 0.03% 85 7405 0.03% 86 7785 0.04% 87 8527 0.04% 88 9106 0.04% 89 9534 0.04% 90 10486 0.05% 91 11031 0.05% 92 11839 0.06% 93 12901 0.06% 94 13640 0.06% 95 14454 0.07% 96 15205 0.07% 97 16405 0.08% 98 17031 0.08% 99 18158 0.08% 100 19250 0.09% 101 20024 0.09% 102 21386 0.10% 103 22108 0.10% 104 23476 0.11% 105 24895 0.12% 106 26254 0.12% 107 27434 0.13% 108 28584 0.13% 109 30269 0.14% 110 31407 0.15% 111 32457 0.15% 112 34370 0.16% 113 35514 0.17% 114 37309 0.17% 115 39035 0.18% 116 41295 0.19% 117 42949 0.20% 118 44613 0.21% 119 46136 0.22% 120 47949 0.22% 121 49625 0.23% 122 50821 0.24% 123 53557 0.25% 124 56083 0.26% 125 57971 0.27% 126 60966 0.29% 127 63322 0.30% 128 66227 0.31% 129 69146 0.32% 130 71353 0.33% 131 73764 0.35% 132 77051 0.36% 133 81271 0.38% 134 85338 0.40% 135 89437 0.42% 136 95055 0.44% 137 101873 0.48% 138 108748 0.51% 139 116269 0.54% 140 123287 0.58% 141 134731 0.63% 142 146991 0.69% 143 164001 0.77% 144 186006 0.87% 145 220802 1.03% 146 271353 1.27% 147 361556 1.69% 148 536478 2.51% 149 1023484 4.79% 150 4766917 22.31% 151 11088885 51.90% 21365789 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=12 prefix-density=0.51 prefix-fanout=2.4 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=25.09 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.9 sequence=AAACCATCCATCATGTTGTCCAGGTTGTACGTACGAAGACCTTGACTGAGGTACTCATAAGAACTCAAAACGGGGTTGTGAGTTCCAGTTCCCTGGGGGGCTTGGAAAAGAGAGTCCACCATACCCTTTCCTCTG criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=0.68 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=66.56 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.4 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7172485 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:52:44 Started mapping on | Feb 10 11:52:45 Finished on | Feb 10 11:55:00 Mapping speed, Million of reads per hour | 569.75 Number of input reads | 21365789 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 19968373 Uniquely mapped reads % | 93.46% Average mapped length | 293.02 Number of splices: Total | 18402481 Number of splices: Annotated (sjdb) | 17946165 Number of splices: GT/AG | 18025072 Number of splices: GC/AG | 305421 Number of splices: AT/AC | 11086 Number of splices: Non-canonical | 60902 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 555011 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 115414 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 864723 864723 864723 N_multimapping 555011 555011 555011 N_noFeature 926845 19593206 1135448 N_ambiguous 326970 1928 158982 UnstrandedReadsAssigned:18714558 PositiveStrandReadsAssigned:373239 NegativeStrandReadsAssigned:18673943 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172485 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172485-trimmed-pair1.fastq SRR7172485-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,365,789 reads, 18,718,206 reads pseudoaligned [quant] estimated average fragment length: 246.275 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7172485.ke.tsv 34699 SRR7172485.se.tsv 87100 total ==> SRR7172485.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.73 905 27.2732 Potri.005G024800.1.v4.1 1035 789.725 159 10.756 Potri.004G059700.1.v4.1 961 715.828 18 1.34336 Potri.007G009000.2.v4.1 1416 1170.73 0 0 Potri.003G141000.2.v4.1 2943 2697.73 720.125 14.2606 Potri.016G087400.1.v4.1 270 83.6519 949 606.064 Potri.015G069301.1.v4.1 564 327.431 0 0 Potri.010G195200.1.v4.1 1773 1527.73 47 1.64354 Potri.012G127500.1.v4.1 977 731.772 372 27.1579 ==> SRR7172485.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1442 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 323 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 23 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR7172485 completed mapping pipeline successfully