Starting /dee2/code/volunteer_pipeline.sh SRR7172486 current disk space = 3058869714944 free memory = 1436091392 SRR7172486 SRAfilesize 9975509a47eb67e63ffdff8c06e1f2c4 SRR7172486.sra SRR7172486.sra file validated SRR7172486 is paired end SRR7172486 is conventional basespace SRR7172486 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172486_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.617 34.0 33.0 34.0 32.0 34.0 2 33.26625 34.0 33.0 34.0 32.0 34.0 3 33.35525 34.0 33.0 34.0 33.0 34.0 4 33.37625 34.0 34.0 34.0 33.0 34.0 5 33.3385 34.0 34.0 34.0 33.0 34.0 6 37.20125 38.0 38.0 38.0 36.0 38.0 7 37.34725 38.0 38.0 38.0 37.0 38.0 8 37.47775 38.0 38.0 38.0 37.0 38.0 9 37.47275 38.0 38.0 38.0 38.0 38.0 10-14 37.43625000000001 38.0 38.0 38.0 37.4 38.0 15-19 37.416349999999994 38.0 38.0 38.0 37.6 38.0 20-24 37.48015 38.0 38.0 38.0 38.0 38.0 25-29 37.424699999999994 38.0 38.0 38.0 37.4 38.0 30-34 37.40415 38.0 38.0 38.0 37.6 38.0 35-39 37.2789 38.0 38.0 38.0 37.0 38.0 40-44 37.04755 38.0 38.0 38.0 36.0 38.0 45-49 37.0218 38.0 38.0 38.0 36.0 38.0 50-54 36.94495 38.0 38.0 38.0 36.0 38.0 55-59 36.81849999999999 38.0 38.0 38.0 35.6 38.0 60-64 36.8409 38.0 38.0 38.0 35.6 38.0 65-69 36.78375 38.0 38.0 38.0 35.4 38.0 70-74 36.64775000000001 38.0 38.0 38.0 34.6 38.0 75-79 36.437349999999995 38.0 38.0 38.0 34.2 38.0 80-84 36.3707 38.0 38.0 38.0 34.0 38.0 85-89 36.3502 38.0 38.0 38.0 34.0 38.0 90-94 36.17285 38.0 38.0 38.0 33.8 38.0 95-99 36.07899999999999 38.0 37.8 38.0 33.4 38.0 100-104 35.921899999999994 38.0 37.2 38.0 32.6 38.0 105-109 35.5603 38.0 37.0 38.0 31.0 38.0 110-114 35.18245 38.0 36.4 38.0 28.2 38.0 115-119 35.170100000000005 38.0 36.2 38.0 28.4 38.0 120-124 35.126 38.0 36.0 38.0 28.4 38.0 125-129 34.74705 38.0 35.2 38.0 27.6 38.0 130-134 34.2771 38.0 34.6 38.0 24.8 38.0 135-139 33.62305 38.0 34.4 38.0 20.6 38.0 140-144 33.050650000000005 38.0 33.2 38.0 16.2 38.0 145-149 32.0517 38.0 33.0 38.0 10.8 38.0 150-151 27.121375 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 3.0 10 0.0 11 0.0 12 6.0 13 2.0 14 3.0 15 6.0 16 4.0 17 4.0 18 5.0 19 11.0 20 7.0 21 8.0 22 11.0 23 18.0 24 13.0 25 20.0 26 15.0 27 31.0 28 35.0 29 41.0 30 72.0 31 66.0 32 83.0 33 99.0 34 151.0 35 301.0 36 706.0 37 2276.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.53265044814341 14.647887323943662 9.961587708066581 30.85787451984635 2 22.2 17.150000000000002 34.325 26.325 3 18.825 24.45 27.6 29.125 4 22.575 30.55 24.6 22.275 5 22.05 34.725 24.25 18.975 6 17.65 37.175000000000004 25.0 20.175 7 14.674999999999999 23.25 42.75 19.325 8 15.775 25.2 32.35 26.674999999999997 9 17.375 23.724999999999998 33.4 25.5 10-14 19.985 29.615000000000002 26.46 23.94 15-19 19.62 28.705000000000002 27.705000000000002 23.97 20-24 20.146007300365017 28.72143607180359 27.371368568428423 23.761188059402972 25-29 19.640982049102455 29.02645132256613 27.736386819340968 23.59617980899045 30-34 20.025000000000002 29.220000000000002 27.205000000000002 23.549999999999997 35-39 20.495495495495494 28.603603603603606 26.811811811811815 24.08908908908909 40-44 19.744744744744743 28.888888888888886 27.237237237237238 24.12912912912913 45-49 20.43043043043043 29.219219219219216 26.83183183183183 23.51851851851852 50-54 20.085085085085087 28.638638638638636 27.37737737737738 23.8988988988989 55-59 20.211221782872016 28.995445217478355 27.00335352119726 23.789979478452373 60-64 20.46046046046046 28.22822822822823 27.207207207207208 24.104104104104103 65-69 19.854854854854857 27.8978978978979 27.772772772772775 24.474474474474476 70-74 19.981980178196014 29.242166383021324 26.764440884973475 24.01141255380919 75-79 20.13416099319183 28.939727673207848 27.012414897877452 23.913696435722866 80-84 20.215215215215217 28.703703703703702 27.392392392392395 23.68868868868869 85-89 20.801841934030733 28.590019520496522 27.05841133189849 23.549727213574254 90-94 20.505505505505507 28.82882882882883 26.67167167167167 23.993993993993996 95-99 20.445445445445447 27.97797797797798 27.51751751751752 24.05905905905906 100-104 20.63166324640873 28.0894939686671 27.108463887081435 24.170378897842735 105-109 21.229721610254355 28.254556378930502 26.787502503504907 23.728219507310232 110-114 21.328461307438182 27.805586144759236 27.10982080288317 23.75613174491941 115-119 20.925925925925924 28.66866866866867 26.66166166166166 23.743743743743746 120-124 21.12 27.785 26.505000000000003 24.59 125-129 21.624324864972994 27.81056211242248 26.740348069613923 23.8247649529906 130-134 21.56656129258869 28.556375131717598 26.308394801545486 23.56866877414823 135-139 22.03628323031308 27.574249962309665 26.408362229257754 23.981104578119503 140-144 21.98737854352399 28.29309826705399 25.663628167885406 24.055895021536614 145-149 21.575 27.42 26.150000000000002 24.855 150-151 21.8875 27.450000000000003 25.4 25.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 0.5 16 2.5 17 3.0 18 0.5 19 0.5 20 0.5 21 2.0 22 2.5 23 2.0 24 4.5 25 6.0 26 7.0 27 9.5 28 15.0 29 22.5 30 23.5 31 25.5 32 34.5 33 46.5 34 67.0 35 85.5 36 99.0 37 111.5 38 132.0 39 169.0 40 184.0 41 192.0 42 212.5 43 231.5 44 243.0 45 231.5 46 225.5 47 228.5 48 216.5 49 192.0 50 174.0 51 149.5 52 124.0 53 106.0 54 89.5 55 87.5 56 74.5 57 48.5 58 30.5 59 28.0 60 25.0 61 13.0 62 6.0 63 3.5 64 1.5 65 0.0 66 0.5 67 1.5 68 2.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.005 30-34 0.0 35-39 0.1 40-44 0.1 45-49 0.1 50-54 0.1 55-59 0.105 60-64 0.1 65-69 0.1 70-74 0.11 75-79 0.12 80-84 0.1 85-89 0.105 90-94 0.1 95-99 0.1 100-104 0.105 105-109 0.13999999999999999 110-114 0.11 115-119 0.1 120-124 0.0 125-129 0.02 130-134 0.35500000000000004 135-139 0.505 140-144 0.16999999999999998 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62525458248473 96.85000000000001 2 1.0692464358452138 2.1 3 0.22912423625254583 0.675 4 0.02545824847250509 0.1 5 0.02545824847250509 0.125 6 0.02545824847250509 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCCAACATAGCCTTCTCCGTCCCCCCTTCGCAGTAACACCAAGTACAGG 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGTAGCATCTCGTATGC 5 0.125 TruSeq Adapter, Index 22 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.3250000000000002 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.6375 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.2875 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.6 0.0 0.0 0.0 0.0 110-111 3.9749999999999996 0.0 0.0 0.0 0.0 112-113 4.425 0.0 0.0 0.0 0.0 114-115 4.85 0.0 0.0 0.0 0.0 116-117 5.3625 0.0 0.0 0.0 0.0 118-119 6.0 0.0 0.0 0.0 0.0 120-121 6.6125 0.0 0.0 0.0 0.0 122-123 7.074999999999999 0.0 0.0 0.0 0.0 124-125 7.95 0.0 0.0 0.0 0.0 126-127 8.8 0.0 0.0 0.0 0.0 128-129 9.625 0.0 0.0 0.0 0.0 130-131 10.4625 0.0 0.0 0.0 0.0 132-133 11.25 0.0 0.0 0.0 0.0 134-135 12.024999999999999 0.0 0.0 0.0 0.0 136-137 12.65 0.0 0.0 0.0 0.0 138-139 13.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172486 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172486_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63575 33.0 33.0 34.0 32.0 34.0 2 32.62825 33.0 33.0 34.0 32.0 34.0 3 32.63825 34.0 33.0 34.0 32.0 34.0 4 32.602 34.0 33.0 34.0 32.0 34.0 5 32.66725 34.0 33.0 34.0 32.0 34.0 6 36.7785 38.0 38.0 38.0 36.0 38.0 7 36.73525 38.0 38.0 38.0 36.0 38.0 8 36.6405 38.0 38.0 38.0 36.0 38.0 9 36.67825 38.0 38.0 38.0 36.0 38.0 10-14 36.6971 38.0 38.0 38.0 36.0 38.0 15-19 36.65485 38.0 38.0 38.0 36.0 38.0 20-24 36.614599999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.6828 38.0 38.0 38.0 36.0 38.0 30-34 36.601 38.0 38.0 38.0 36.0 38.0 35-39 36.567049999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.4992 38.0 38.0 38.0 36.0 38.0 45-49 36.4724 38.0 38.0 38.0 36.0 38.0 50-54 36.480650000000004 38.0 38.0 38.0 35.8 38.0 55-59 36.467949999999995 38.0 38.0 38.0 35.6 38.0 60-64 36.414 38.0 38.0 38.0 35.4 38.0 65-69 36.279450000000004 38.0 38.0 38.0 34.8 38.0 70-74 36.2413 38.0 38.0 38.0 35.0 38.0 75-79 36.12465 38.0 38.0 38.0 34.0 38.0 80-84 36.022800000000004 38.0 38.0 38.0 34.0 38.0 85-89 35.850849999999994 38.0 38.0 38.0 33.2 38.0 90-94 35.6763 38.0 38.0 38.0 32.0 38.0 95-99 35.56155 38.0 38.0 38.0 31.8 38.0 100-104 35.53695 38.0 38.0 38.0 32.0 38.0 105-109 35.370400000000004 38.0 37.8 38.0 30.8 38.0 110-114 35.1145 38.0 37.0 38.0 29.6 38.0 115-119 34.8564 38.0 36.8 38.0 28.0 38.0 120-124 34.62615 38.0 36.0 38.0 26.4 38.0 125-129 34.321799999999996 38.0 35.8 38.0 24.0 38.0 130-134 33.891149999999996 38.0 35.2 38.0 22.0 38.0 135-139 33.3269 38.0 34.2 38.0 17.0 38.0 140-144 32.307050000000004 38.0 33.2 38.0 13.2 38.0 145-149 31.239600000000003 38.0 31.8 38.0 4.2 38.0 150-151 26.638624999999998 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 11.0 4 7.0 5 4.0 6 4.0 7 5.0 8 2.0 9 3.0 10 4.0 11 2.0 12 6.0 13 6.0 14 7.0 15 6.0 16 11.0 17 9.0 18 7.0 19 13.0 20 11.0 21 14.0 22 14.0 23 13.0 24 18.0 25 20.0 26 23.0 27 27.0 28 30.0 29 34.0 30 51.0 31 68.0 32 79.0 33 93.0 34 151.0 35 253.0 36 585.0 37 2387.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.275 21.75 12.125 20.849999999999998 2 27.602602602602605 25.3003003003003 29.904904904904907 17.192192192192195 3 21.696696696696698 27.3023023023023 31.406406406406408 19.594594594594593 4 24.54954954954955 34.45945945945946 22.4974974974975 18.493493493493492 5 24.94994994994995 35.88588588588589 21.02102102102102 18.143143143143142 6 21.575 37.375 21.8 19.25 7 20.875 19.6 39.4 20.125 8 21.825 23.925 27.525 26.724999999999998 9 20.9 25.324999999999996 28.625 25.15 10-14 24.05 28.765 25.615 21.57 15-19 24.43 27.405 27.185 20.979999999999997 20-24 24.115000000000002 27.505000000000003 27.43 20.95 25-29 23.68 27.755000000000003 27.29 21.275 30-34 23.575 27.27 28.28 20.875 35-39 23.68 27.750000000000004 27.700000000000003 20.87 40-44 24.16 27.57 27.625 20.645 45-49 23.84 27.485 27.68 20.995 50-54 23.095 27.694999999999997 28.095 21.115000000000002 55-59 23.66 27.894999999999996 27.61 20.835 60-64 24.145 27.24 27.565 21.05 65-69 24.25 26.915 27.615000000000002 21.22 70-74 23.669999999999998 28.17 27.315 20.845 75-79 23.73 27.315 27.815 21.14 80-84 24.14 27.325 27.235 21.3 85-89 24.411220561028053 26.961348067403367 27.76138806940347 20.866043302165107 90-94 24.232269680904274 27.45823747124137 27.80334100230069 20.506151845553667 95-99 24.292429242924293 27.71777177717772 27.51775177517752 20.47204720472047 100-104 24.11 28.299999999999997 27.555000000000003 20.035 105-109 24.565 27.485 27.375 20.575 110-114 24.88 27.76 27.029999999999998 20.330000000000002 115-119 25.6 27.805000000000003 26.784999999999997 19.81 120-124 25.224999999999998 27.6 27.195000000000004 19.98 125-129 25.83 27.700000000000003 26.47 20.0 130-134 25.57650942924316 28.077634935721075 26.546946125756595 19.798909509279174 135-139 27.03203203203203 27.36736736736737 26.576576576576578 19.024024024024026 140-144 26.224999999999998 28.12 26.064999999999998 19.59 145-149 26.575 28.08 25.91 19.435 150-151 27.4125 27.875 25.3125 19.400000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.5 3 1.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.5 20 2.0 21 2.5 22 1.0 23 0.5 24 1.0 25 1.5 26 4.5 27 6.5 28 10.0 29 10.5 30 9.0 31 17.0 32 26.5 33 32.0 34 43.5 35 59.0 36 73.0 37 93.5 38 115.0 39 139.0 40 170.5 41 194.0 42 222.5 43 245.0 44 250.0 45 272.0 46 265.5 47 241.0 48 228.0 49 214.0 50 179.5 51 148.0 52 136.5 53 124.0 54 111.5 55 92.5 56 75.0 57 56.0 58 34.5 59 22.0 60 20.5 61 13.5 62 8.5 63 7.0 64 5.0 65 1.5 66 1.0 67 1.0 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.03 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.045 135-139 0.1 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88154550076258 97.25 2 0.7880020335536351 1.55 3 0.20335536349771224 0.6 4 0.05083884087442806 0.2 5 0.05083884087442806 0.25 6 0.02541942043721403 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAACA 6 0.15 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.35 0.0 0.0 0.0 0.0 96-97 1.5125000000000002 0.0 0.0 0.0 0.0 98-99 1.675 0.0 0.0 0.0 0.0 100-101 1.9375 0.0 0.0 0.0 0.0 102-103 2.325 0.0 0.0 0.0 0.0 104-105 2.6875 0.0 0.0 0.0 0.0 106-107 3.2125 0.0 0.0 0.0 0.0 108-109 3.7 0.0 0.0 0.0 0.0 110-111 4.0625 0.0 0.0 0.0 0.0 112-113 4.550000000000001 0.0 0.0 0.0 0.0 114-115 5.05 0.0 0.0 0.0 0.0 116-117 5.5875 0.0 0.0 0.0 0.0 118-119 6.237500000000001 0.0 0.0 0.0 0.0 120-121 6.8625 0.0 0.0 0.0 0.0 122-123 7.324999999999999 0.0 0.0 0.0 0.0 124-125 8.1375 0.0 0.0 0.0 0.0 126-127 8.975 0.0 0.0 0.0 0.0 128-129 9.8625 0.0 0.0 0.0 0.0 130-131 10.7625 0.0 0.0 0.0 0.0 132-133 11.625 0.0 0.0 0.0 0.0 134-135 12.3375 0.0 0.0 0.0 0.0 136-137 13.0 0.0 0.0 0.0 0.0 138-139 13.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626530 spots for SRR7172486.sra Written 626530 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra Read 626514 spots for SRR7172486.sra Written 626514 spots for SRR7172486.sra SRR ids: ['SRR7172486.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wcm0xjwv SRR7172486.sra spots: 12530296 blocks: [[1, 626514], [626515, 1253028], [1253029, 1879542], [1879543, 2506056], [2506057, 3132570], [3132571, 3759084], [3759085, 4385598], [4385599, 5012112], [5012113, 5638626], [5638627, 6265140], [6265141, 6891654], [6891655, 7518168], [7518169, 8144682], [8144683, 8771196], [8771197, 9397710], [9397711, 10024224], [10024225, 10650738], [10650739, 11277252], [11277253, 11903766], [11903767, 12530296]] SRR7172486 file size 4224405 SRR7172486 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172486 SRR7172486_1.fastq SRR7172486_2.fastq Input file: SRR7172486_1.fastq Paired file: SRR7172486_2.fastq trimmed: SRR7172486-trimmed-pair1.fastq, SRR7172486-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:59:17 2025 >> started Mon Feb 10 11:59:43 2025 >> done (25.814s) 12530296 read pairs processed; of these: 30637 ( 0.24%) short read pairs filtered out after trimming by size control 73366 ( 0.59%) empty read pairs filtered out after trimming by size control 12426293 (99.17%) read pairs available; of these: 6814596 (54.84%) trimmed read pairs available after processing 5611697 (45.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 15 0.00% 21 10 0.00% 22 12 0.00% 23 11 0.00% 24 19 0.00% 25 20 0.00% 26 16 0.00% 27 12 0.00% 28 19 0.00% 29 19 0.00% 30 19 0.00% 31 21 0.00% 32 18 0.00% 33 18 0.00% 34 29 0.00% 35 25 0.00% 36 35 0.00% 37 46 0.00% 38 28 0.00% 39 42 0.00% 40 42 0.00% 41 54 0.00% 42 54 0.00% 43 53 0.00% 44 63 0.00% 45 63 0.00% 46 78 0.00% 47 115 0.00% 48 120 0.00% 49 151 0.00% 50 155 0.00% 51 197 0.00% 52 209 0.00% 53 226 0.00% 54 286 0.00% 55 248 0.00% 56 294 0.00% 57 361 0.00% 58 424 0.00% 59 490 0.00% 60 538 0.00% 61 657 0.01% 62 695 0.01% 63 788 0.01% 64 839 0.01% 65 1030 0.01% 66 1122 0.01% 67 1400 0.01% 68 1702 0.01% 69 2773 0.02% 70 3380 0.03% 71 2544 0.02% 72 2545 0.02% 73 2727 0.02% 74 2935 0.02% 75 3275 0.03% 76 3474 0.03% 77 3801 0.03% 78 4347 0.03% 79 4821 0.04% 80 5275 0.04% 81 6107 0.05% 82 6833 0.05% 83 7839 0.06% 84 9858 0.08% 85 10734 0.09% 86 11657 0.09% 87 11877 0.10% 88 12583 0.10% 89 13496 0.11% 90 14209 0.11% 91 15583 0.13% 92 16951 0.14% 93 18682 0.15% 94 18823 0.15% 95 19949 0.16% 96 20568 0.17% 97 20774 0.17% 98 21440 0.17% 99 22332 0.18% 100 23978 0.19% 101 24630 0.20% 102 26632 0.21% 103 27850 0.22% 104 29169 0.23% 105 30758 0.25% 106 31464 0.25% 107 31754 0.26% 108 32590 0.26% 109 34776 0.28% 110 35387 0.28% 111 35613 0.29% 112 37155 0.30% 113 39703 0.32% 114 40348 0.32% 115 42175 0.34% 116 43801 0.35% 117 43910 0.35% 118 45015 0.36% 119 45329 0.36% 120 46940 0.38% 121 47500 0.38% 122 48848 0.39% 123 50909 0.41% 124 53347 0.43% 125 54189 0.44% 126 56175 0.45% 127 57423 0.46% 128 58748 0.47% 129 60220 0.48% 130 60919 0.49% 131 62384 0.50% 132 64756 0.52% 133 67865 0.55% 134 69928 0.56% 135 73216 0.59% 136 75371 0.61% 137 78285 0.63% 138 82732 0.67% 139 85929 0.69% 140 88946 0.72% 141 94711 0.76% 142 100137 0.81% 143 108354 0.87% 144 121704 0.98% 145 140222 1.13% 146 167406 1.35% 147 211379 1.70% 148 298466 2.40% 149 554614 4.46% 150 2635843 21.21% 151 5611697 45.16% 12426293 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=28 prefix-density=0.80 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=90.55 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=36 prefix-density=0.46 prefix-fanout=1.9 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGTCCCTAGCTA criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=41.81 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=10.9 sequence=AGGAAAAGAAATCAACCGAGATTCCCCCAGTAGCGGCGAGCGAACGGGGAGCAGCCCAGAGCCTGAATCAGTGTGTGTGTTAGTGGAAGCGTCTGGAAAGGCGCGCGATACAGGGTGACAGCCCCGTACACAAAAATGCACATGCTGTGAGCTCGATGAGTAGGGCGGGACACGTGGTATCCTGTCTGAATATGGGGGGACCATCCT SRR7172486 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:01:31 Started mapping on | Feb 10 12:01:31 Finished on | Feb 10 12:03:24 Mapping speed, Million of reads per hour | 395.88 Number of input reads | 12426293 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 11088872 Uniquely mapped reads % | 89.24% Average mapped length | 287.86 Number of splices: Total | 9409623 Number of splices: Annotated (sjdb) | 9186953 Number of splices: GT/AG | 9215140 Number of splices: GC/AG | 149959 Number of splices: AT/AC | 6902 Number of splices: Non-canonical | 37622 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.03% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318422 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 114562 % of reads mapped to too many loci | 0.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.05% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1043844 1043844 1043844 N_multimapping 318422 318422 318422 N_noFeature 441444 10795034 564274 N_ambiguous 261001 1042 89323 UnstrandedReadsAssigned:10386427 PositiveStrandReadsAssigned:292796 NegativeStrandReadsAssigned:10435275 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7172486 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172486-trimmed-pair1.fastq SRR7172486-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,426,293 reads, 10,515,297 reads pseudoaligned [quant] estimated average fragment length: 219.205 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,268 rounds 52401 SRR7172486.ke.tsv 34699 SRR7172486.se.tsv 87100 total ==> SRR7172486.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.79 666.677 27.6153 Potri.005G024800.1.v4.1 1035 816.795 156 14.2387 Potri.004G059700.1.v4.1 961 742.834 4 0.401445 Potri.007G009000.2.v4.1 1416 1197.79 0 0 Potri.003G141000.2.v4.1 2943 2724.79 415.883 11.3788 Potri.016G087400.1.v4.1 270 95.0568 587 460.376 Potri.015G069301.1.v4.1 564 350.251 0 0 Potri.010G195200.1.v4.1 1773 1554.79 95 4.55521 Potri.012G127500.1.v4.1 977 758.81 74 7.27038 ==> SRR7172486.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 245 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 338 Potri.001G212900.v4.1 111 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7172486 completed mapping pipeline successfully