Starting /dee2/code/volunteer_pipeline.sh SRR7172487 current disk space = 3058793410560 free memory = 1481428408 SRR7172487 SRAfilesize cebd3874572b1223dc88a73452c0dca2 SRR7172487.sra SRR7172487.sra file validated SRR7172487 is paired end SRR7172487 is conventional basespace SRR7172487 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172487_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80325 34.0 33.0 34.0 33.0 34.0 2 33.42025 34.0 34.0 34.0 33.0 34.0 3 33.47775 34.0 34.0 34.0 33.0 34.0 4 33.523 34.0 34.0 34.0 33.0 34.0 5 33.50775 34.0 34.0 34.0 33.0 34.0 6 37.22975 38.0 38.0 38.0 36.0 38.0 7 37.512 38.0 38.0 38.0 37.0 38.0 8 37.5545 38.0 38.0 38.0 38.0 38.0 9 37.6255 38.0 38.0 38.0 38.0 38.0 10-14 37.56849999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.5945 38.0 38.0 38.0 38.0 38.0 20-24 37.56945 38.0 38.0 38.0 38.0 38.0 25-29 37.54469999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.520799999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.411699999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.28015 38.0 38.0 38.0 37.0 38.0 45-49 37.25625 38.0 38.0 38.0 36.8 38.0 50-54 37.1673 38.0 38.0 38.0 36.0 38.0 55-59 37.108999999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.1087 38.0 38.0 38.0 36.0 38.0 65-69 36.95905 38.0 38.0 38.0 35.8 38.0 70-74 36.89215 38.0 38.0 38.0 35.4 38.0 75-79 36.7435 38.0 38.0 38.0 35.0 38.0 80-84 36.61005 38.0 38.0 38.0 34.2 38.0 85-89 36.45385 38.0 38.0 38.0 34.0 38.0 90-94 36.3777 38.0 38.0 38.0 34.0 38.0 95-99 36.237449999999995 38.0 37.6 38.0 33.8 38.0 100-104 36.033550000000005 38.0 37.2 38.0 33.0 38.0 105-109 35.8784 38.0 37.0 38.0 32.2 38.0 110-114 35.50715 38.0 36.4 38.0 30.6 38.0 115-119 35.51065 38.0 36.2 38.0 31.0 38.0 120-124 35.221 38.0 36.0 38.0 28.4 38.0 125-129 34.897 38.0 35.2 38.0 28.0 38.0 130-134 34.6659 38.0 35.2 38.0 27.2 38.0 135-139 34.111450000000005 38.0 34.4 38.0 24.0 38.0 140-144 33.25025 38.0 33.2 38.0 17.6 38.0 145-149 32.3596 38.0 32.4 38.0 13.8 38.0 150-151 28.129624999999997 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 0.0 15 0.0 16 6.0 17 4.0 18 2.0 19 4.0 20 6.0 21 4.0 22 13.0 23 8.0 24 7.0 25 14.0 26 23.0 27 27.0 28 36.0 29 35.0 30 60.0 31 47.0 32 77.0 33 114.0 34 175.0 35 323.0 36 814.0 37 2197.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.91836734693877 13.596938775510203 10.127551020408163 40.35714285714286 2 21.125 20.05 36.175000000000004 22.650000000000002 3 18.099999999999998 25.775 27.950000000000003 28.175 4 22.425 32.725 22.625 22.225 5 20.8 36.85 24.6 17.75 6 17.424999999999997 35.425000000000004 26.674999999999997 20.474999999999998 7 14.374999999999998 22.975 43.675000000000004 18.975 8 17.275 23.150000000000002 31.6 27.975 9 18.099999999999998 23.325000000000003 33.95 24.625 10-14 19.645000000000003 29.270000000000003 26.784999999999997 24.3 15-19 19.695 28.315 28.04 23.95 20-24 20.105 28.345 27.93 23.62 25-29 19.735 28.17 27.85 24.245 30-34 19.345000000000002 28.705000000000002 28.249999999999996 23.7 35-39 20.22 28.485 27.800000000000004 23.494999999999997 40-44 19.805 28.705000000000002 27.785 23.705000000000002 45-49 20.26 28.335 27.62 23.785 50-54 19.845 28.599999999999998 28.18 23.375 55-59 20.29 28.625 27.560000000000002 23.525 60-64 20.395 28.345 27.62 23.64 65-69 20.44 28.775000000000002 27.555000000000003 23.23 70-74 19.900970291087326 28.56356907072122 27.488246473942183 24.047214164249276 75-79 19.973994798959794 28.585717143428685 27.775555111022204 23.664732946589318 80-84 19.505851755526656 28.283485045513657 27.81834550365109 24.392317695308595 85-89 20.330000000000002 27.955000000000002 27.875 23.84 90-94 20.17701770177018 28.90789078907891 27.3977397739774 23.517351735173516 95-99 20.115 28.23 27.495000000000005 24.16 100-104 20.306244995996796 29.01321056845476 27.572057646116892 23.108486789431545 105-109 20.936515083295813 28.67577167442093 27.565160838461157 22.8225524038221 110-114 20.68637274549098 28.006012024048093 27.645290581162325 23.662324649298597 115-119 20.2531012404962 28.15126050420168 27.59603841536615 23.999599839935975 120-124 20.674999999999997 28.88 27.465 22.98 125-129 20.880000000000003 28.549999999999997 26.634999999999998 23.935000000000002 130-134 21.195 28.395 27.18 23.23 135-139 21.025 28.64 26.845000000000002 23.49 140-144 21.435000000000002 28.53 26.85 23.185 145-149 20.825 29.255 26.345000000000002 23.575 150-151 21.375 28.725 27.175 22.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.5 22 2.5 23 3.0 24 4.5 25 7.0 26 7.0 27 8.5 28 13.0 29 17.5 30 21.5 31 24.5 32 30.0 33 38.5 34 52.0 35 72.5 36 86.5 37 113.5 38 151.0 39 169.0 40 194.5 41 215.0 42 233.0 43 259.0 44 277.0 45 280.5 46 271.0 47 247.0 48 212.0 49 188.0 50 159.0 51 128.0 52 101.0 53 90.5 54 81.5 55 61.0 56 52.0 57 38.5 58 25.5 59 22.5 60 16.5 61 9.5 62 4.5 63 2.5 64 2.0 65 1.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.03 75-79 0.02 80-84 0.03 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.08 105-109 0.055 110-114 0.2 115-119 0.04 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4528301886792453 0.8999999999999999 3 0.05031446540880503 0.15 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 1.9875 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.0250000000000004 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.4 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.775 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.6 0.0 0.0 0.0 0.0 132-133 6.137499999999999 0.0 0.0 0.0 0.0 134-135 6.5625 0.0 0.0 0.0 0.0 136-137 7.175000000000001 0.0 0.0 0.0 0.0 138-139 7.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 45 2.4911113E-5 22.551666 95-99 >>END_MODULE SRR7172487 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172487_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62625 33.0 33.0 34.0 32.0 34.0 2 32.77925 34.0 33.0 34.0 32.0 34.0 3 32.75675 34.0 33.0 34.0 32.0 34.0 4 32.7125 34.0 33.0 34.0 32.0 34.0 5 32.709 34.0 33.0 34.0 32.0 34.0 6 36.91425 38.0 38.0 38.0 36.0 38.0 7 36.91625 38.0 38.0 38.0 36.0 38.0 8 36.95425 38.0 38.0 38.0 37.0 38.0 9 36.9475 38.0 38.0 38.0 37.0 38.0 10-14 36.99725 38.0 38.0 38.0 36.8 38.0 15-19 37.034150000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.00105 38.0 38.0 38.0 37.0 38.0 25-29 37.03495 38.0 38.0 38.0 37.0 38.0 30-34 36.97769999999999 38.0 38.0 38.0 36.8 38.0 35-39 36.9346 38.0 38.0 38.0 36.8 38.0 40-44 36.919650000000004 38.0 38.0 38.0 37.0 38.0 45-49 36.8708 38.0 38.0 38.0 36.8 38.0 50-54 36.8836 38.0 38.0 38.0 36.6 38.0 55-59 36.82045 38.0 38.0 38.0 36.4 38.0 60-64 36.71145 38.0 38.0 38.0 36.0 38.0 65-69 36.68055 38.0 38.0 38.0 35.8 38.0 70-74 36.60335 38.0 38.0 38.0 35.8 38.0 75-79 36.4837 38.0 38.0 38.0 35.2 38.0 80-84 36.3695 38.0 38.0 38.0 35.0 38.0 85-89 36.365050000000004 38.0 38.0 38.0 34.6 38.0 90-94 36.2226 38.0 38.0 38.0 34.0 38.0 95-99 35.98665 38.0 38.0 38.0 33.6 38.0 100-104 35.85385000000001 38.0 38.0 38.0 33.2 38.0 105-109 35.7154 38.0 38.0 38.0 32.8 38.0 110-114 35.51755 38.0 37.4 38.0 31.0 38.0 115-119 35.36175 38.0 37.0 38.0 30.6 38.0 120-124 35.048649999999995 38.0 36.8 38.0 28.6 38.0 125-129 34.72095 38.0 36.0 38.0 27.4 38.0 130-134 34.268299999999996 38.0 35.4 38.0 24.6 38.0 135-139 33.83015 38.0 34.2 38.0 21.2 38.0 140-144 33.1169 38.0 33.0 38.0 15.0 38.0 145-149 32.1611 38.0 33.0 38.0 10.8 38.0 150-151 27.595625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 3.0 4 4.0 5 3.0 6 1.0 7 4.0 8 0.0 9 0.0 10 3.0 11 2.0 12 4.0 13 4.0 14 6.0 15 5.0 16 5.0 17 5.0 18 6.0 19 8.0 20 13.0 21 7.0 22 13.0 23 15.0 24 11.0 25 20.0 26 18.0 27 26.0 28 35.0 29 27.0 30 48.0 31 43.0 32 77.0 33 107.0 34 129.0 35 251.0 36 595.0 37 2483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.88131757606236 19.235604727181293 14.382700528036207 30.50037716872014 2 26.465408805031448 26.08805031446541 33.459119496855344 13.9874213836478 3 20.241691842900302 27.945619335347434 31.344410876132933 20.468277945619334 4 23.741188318227593 35.372608257804636 22.58308157099698 18.303121852970797 5 25.02517623363545 36.933534743202415 22.20543806646526 15.835850956696879 6 18.729600803414513 39.266884258096916 23.2237007280944 18.779814210394175 7 18.04927099044746 19.607843137254903 42.961287078934134 19.3815987933635 8 20.527638190954775 24.095477386934675 29.070351758793972 26.306532663316585 9 22.004521477015825 24.61693041949259 29.540316503391107 23.838231600100475 10-14 23.010450160771704 28.64248392282958 26.49216237942122 21.854903536977492 15-19 22.899919614147908 27.929059485530544 27.733118971061092 21.43790192926045 20-24 22.910387783805504 28.270042194092827 27.70745428973277 21.112115732368895 25-29 22.814241952493347 28.092201074674833 28.36338070607141 20.73017626676041 30-34 22.368355002258923 27.895185984639326 28.562823151448217 21.17363586165353 35-39 22.401325700512203 28.1711358843025 28.095811991563725 21.33172642362157 40-44 22.62700366815738 28.521179840209033 28.043816893623436 20.80799959801015 45-49 23.200281520209128 27.604061934446005 28.58435551980696 20.611301025537905 50-54 22.750578063737812 27.792299185684126 28.586508495023626 20.870614255554436 55-59 22.93978807813991 27.645256867373075 28.192637975192085 21.222317079294932 60-64 23.29049101315393 27.758811125615026 28.115272617732707 20.835425243498342 65-69 23.090836012861736 27.944131832797424 28.114951768488744 20.850080385852092 70-74 22.62472994021002 27.493342712153947 28.44797266743707 21.433954680198966 75-79 23.57846092023307 27.843078159533857 27.43118344384167 21.1472774763914 80-84 23.14884632785402 27.864072789423417 27.82888453224752 21.15819635047504 85-89 23.903541823662398 27.32981662898769 27.872393870886714 20.894247676463202 90-94 23.41912134311853 27.294661707047354 28.340203076304416 20.946013873529708 95-99 23.559577677224734 27.345399698340877 28.04927099044746 21.045751633986928 100-104 23.09895964215711 28.175101774136806 27.78810876011459 20.937829823591496 105-109 24.139490477865433 27.57147882015979 28.19456308728205 20.09446761469273 110-114 24.116789788431582 27.946127946127948 27.830544248454697 20.106538016985777 115-119 23.413236846072667 28.539122568973312 27.84059500477411 20.20704558017991 120-124 24.193710439063597 28.056867276198133 27.745403395961016 20.004018888777253 125-129 24.168425283891064 27.725856697819314 27.786152145513014 20.319565872776604 130-134 24.590657960823705 27.885484681064792 27.840281265695634 19.683576092415873 135-139 24.527922860586582 28.148854961832058 27.295098433105665 20.028123744475693 140-144 24.993720170811354 27.26450640542577 27.867370007535797 19.87440341622708 145-149 25.69360675512666 27.79955770004021 27.06574185765983 19.441093687173304 150-151 26.112088464438298 27.418949484795174 27.70796682583564 18.760995224930888 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 14.0 1 7.5 2 0.5 3 0.0 4 1.0 5 1.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 3.0 23 4.0 24 3.0 25 3.0 26 8.0 27 9.5 28 10.0 29 13.0 30 22.5 31 32.5 32 36.5 33 37.5 34 48.0 35 61.0 36 75.5 37 102.5 38 126.0 39 170.0 40 217.5 41 225.0 42 239.0 43 250.5 44 251.0 45 266.0 46 271.5 47 251.0 48 215.0 49 187.5 50 166.0 51 138.0 52 115.5 53 92.0 54 72.5 55 66.5 56 54.0 57 41.0 58 25.5 59 18.0 60 18.0 61 14.0 62 7.5 63 5.0 64 3.0 65 0.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.625 3 0.7000000000000001 4 0.7000000000000001 5 0.7000000000000001 6 0.42500000000000004 7 0.5499999999999999 8 0.5 9 0.475 10-14 0.48 15-19 0.48 20-24 0.45999999999999996 25-29 0.43499999999999994 30-34 0.395 35-39 0.43 40-44 0.49500000000000005 45-49 0.54 50-54 0.53 55-59 0.43499999999999994 60-64 0.41000000000000003 65-69 0.48 70-74 0.485 75-79 0.45999999999999996 80-84 0.5349999999999999 85-89 0.475 90-94 0.53 95-99 0.5499999999999999 100-104 0.515 105-109 0.49500000000000005 110-114 0.505 115-119 0.505 120-124 0.47000000000000003 125-129 0.49 130-134 0.44999999999999996 135-139 0.44 140-144 0.475 145-149 0.52 150-151 0.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13771240172457 97.725 2 0.6847577986304844 1.35 3 0.0760841998478316 0.22499999999999998 4 0.050722799898554397 0.2 5 0.0 0.0 6 0.025361399949277198 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025361399949277198 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 14 0.35000000000000003 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.7249999999999996 0.0 0.0 0.0 0.0 116-117 2.9749999999999996 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.6 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.675 0.0 0.0 0.0 0.0 128-129 5.137499999999999 0.0 0.0 0.0 0.0 130-131 5.5125 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.3875 0.0 0.0 0.0 0.0 136-137 6.975 0.0 0.0 0.0 0.0 138-139 7.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATATA 10 0.006830828 145.0 8 AGCAACA 10 0.006830828 145.0 6 >>END_MODULE Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859123 spots for SRR7172487.sra Written 859123 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra Read 859121 spots for SRR7172487.sra Written 859121 spots for SRR7172487.sra SRR ids: ['SRR7172487.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_34q66pe9 SRR7172487.sra spots: 17182422 blocks: [[1, 859121], [859122, 1718242], [1718243, 2577363], [2577364, 3436484], [3436485, 4295605], [4295606, 5154726], [5154727, 6013847], [6013848, 6872968], [6872969, 7732089], [7732090, 8591210], [8591211, 9450331], [9450332, 10309452], [10309453, 11168573], [11168574, 12027694], [12027695, 12886815], [12886816, 13745936], [13745937, 14605057], [14605058, 15464178], [15464179, 16323299], [16323300, 17182422]] SRR7172487 file size 5800858 SRR7172487 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172487 SRR7172487_1.fastq SRR7172487_2.fastq Input file: SRR7172487_1.fastq Paired file: SRR7172487_2.fastq trimmed: SRR7172487-trimmed-pair1.fastq, SRR7172487-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:12:50 2025 >> started Mon Feb 10 12:13:08 2025 >> done (18.010s) 17182422 read pairs processed; of these: 18658 ( 0.11%) short read pairs filtered out after trimming by size control 111732 ( 0.65%) empty read pairs filtered out after trimming by size control 17052032 (99.24%) read pairs available; of these: 8995215 (52.75%) trimmed read pairs available after processing 8056817 (47.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 8 0.00% 21 8 0.00% 22 4 0.00% 23 7 0.00% 24 5 0.00% 25 6 0.00% 26 12 0.00% 27 10 0.00% 28 9 0.00% 29 9 0.00% 30 14 0.00% 31 10 0.00% 32 8 0.00% 33 15 0.00% 34 13 0.00% 35 14 0.00% 36 12 0.00% 37 25 0.00% 38 14 0.00% 39 25 0.00% 40 28 0.00% 41 27 0.00% 42 34 0.00% 43 41 0.00% 44 31 0.00% 45 36 0.00% 46 60 0.00% 47 55 0.00% 48 61 0.00% 49 99 0.00% 50 78 0.00% 51 100 0.00% 52 114 0.00% 53 119 0.00% 54 154 0.00% 55 160 0.00% 56 159 0.00% 57 198 0.00% 58 208 0.00% 59 269 0.00% 60 298 0.00% 61 373 0.00% 62 395 0.00% 63 376 0.00% 64 476 0.00% 65 492 0.00% 66 573 0.00% 67 697 0.00% 68 714 0.00% 69 938 0.01% 70 1054 0.01% 71 1134 0.01% 72 1262 0.01% 73 1413 0.01% 74 1605 0.01% 75 1796 0.01% 76 1915 0.01% 77 2035 0.01% 78 2397 0.01% 79 2636 0.02% 80 2947 0.02% 81 3372 0.02% 82 3931 0.02% 83 4380 0.03% 84 5510 0.03% 85 6144 0.04% 86 6669 0.04% 87 6954 0.04% 88 7338 0.04% 89 8083 0.05% 90 8824 0.05% 91 9570 0.06% 92 10347 0.06% 93 11644 0.07% 94 12441 0.07% 95 13043 0.08% 96 13488 0.08% 97 14205 0.08% 98 14656 0.09% 99 15395 0.09% 100 16584 0.10% 101 17520 0.10% 102 18454 0.11% 103 19817 0.12% 104 21092 0.12% 105 22258 0.13% 106 23441 0.14% 107 23987 0.14% 108 24722 0.14% 109 26098 0.15% 110 27382 0.16% 111 28275 0.17% 112 29871 0.18% 113 31641 0.19% 114 33232 0.19% 115 34776 0.20% 116 36312 0.21% 117 36969 0.22% 118 38868 0.23% 119 39614 0.23% 120 40676 0.24% 121 42187 0.25% 122 44382 0.26% 123 46953 0.28% 124 48640 0.29% 125 50967 0.30% 126 53417 0.31% 127 55196 0.32% 128 57065 0.33% 129 58958 0.35% 130 61387 0.36% 131 63341 0.37% 132 66122 0.39% 133 70424 0.41% 134 74425 0.44% 135 78594 0.46% 136 82753 0.49% 137 88634 0.52% 138 93031 0.55% 139 100283 0.59% 140 106978 0.63% 141 116472 0.68% 142 127959 0.75% 143 144627 0.85% 144 168709 0.99% 145 197802 1.16% 146 245664 1.44% 147 328458 1.93% 148 489610 2.87% 149 942012 5.52% 150 4094788 24.01% 151 8056817 47.25% 17052032 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=12 prefix-density=0.39 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=19 fanout-score=344.28 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=22 prefix-density=0.60 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=11.35 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=6.0 sequence=TGGTTCAAGGCTGGAGCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGATCCACGCACAAAGCATCTTGGCCATCTGGGCTACACAGGTGGTCTTGATGGGTGCCGTTGAGGGTTACAGAATTGCTGGCGGGCCACTCGGTGAGGTAACTGACCCAATCTACCCAGGTGGAAGCTTCGACCCACTGGGCTTGGCTGACGATCCCGAAGCATTCGCTGAGTTGAAGGTGAAGGAACTCAAGAATGGTAGGTTGGCTAT SRR7172487 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:13:52 Started mapping on | Feb 10 12:13:52 Finished on | Feb 10 12:15:45 Mapping speed, Million of reads per hour | 543.25 Number of input reads | 17052032 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16154838 Uniquely mapped reads % | 94.74% Average mapped length | 292.34 Number of splices: Total | 15335434 Number of splices: Annotated (sjdb) | 14975277 Number of splices: GT/AG | 15041639 Number of splices: GC/AG | 234080 Number of splices: AT/AC | 8971 Number of splices: Non-canonical | 50744 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 441890 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 48511 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.30% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 471208 471208 471208 N_multimapping 441890 441890 441890 N_noFeature 706937 15871374 843556 N_ambiguous 254384 1197 106816 UnstrandedReadsAssigned:15193517 PositiveStrandReadsAssigned:282267 NegativeStrandReadsAssigned:15204466 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172487 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172487-trimmed-pair1.fastq SRR7172487-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,052,032 reads, 15,141,892 reads pseudoaligned [quant] estimated average fragment length: 243.656 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR7172487.ke.tsv 34699 SRR7172487.se.tsv 87100 total ==> SRR7172487.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.34 601 21.3508 Potri.005G024800.1.v4.1 1035 792.344 190 15.1238 Potri.004G059700.1.v4.1 961 718.467 11 0.965623 Potri.007G009000.2.v4.1 1416 1173.34 0 0 Potri.003G141000.2.v4.1 2943 2700.34 1069.44 24.9781 Potri.016G087400.1.v4.1 270 84.7763 848 630.875 Potri.015G069301.1.v4.1 564 329.439 0 0 Potri.010G195200.1.v4.1 1773 1530.34 109.926 4.53038 Potri.012G127500.1.v4.1 977 734.402 322 27.6531 ==> SRR7172487.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 942 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 271 Potri.001G212900.v4.1 45 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR7172487 completed mapping pipeline successfully