Starting /dee2/code/volunteer_pipeline.sh SRR7172488 current disk space = 3058903150592 free memory = 1580122372 SRR7172488 SRAfilesize 297c0358c3ce419157d7a7472b58fc81 SRR7172488.sra SRR7172488.sra file validated SRR7172488 is paired end SRR7172488 is conventional basespace SRR7172488 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172488_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.529 34.0 33.0 34.0 32.0 34.0 2 33.2355 34.0 33.0 34.0 32.0 34.0 3 33.31 34.0 33.0 34.0 32.0 34.0 4 33.418 34.0 33.0 34.0 33.0 34.0 5 33.26125 34.0 33.0 34.0 33.0 34.0 6 37.02725 38.0 37.0 38.0 36.0 38.0 7 37.41775 38.0 38.0 38.0 37.0 38.0 8 37.50925 38.0 38.0 38.0 37.0 38.0 9 37.424 38.0 38.0 38.0 37.0 38.0 10-14 37.35395 38.0 38.0 38.0 36.8 38.0 15-19 37.14725000000001 38.0 38.0 38.0 36.2 38.0 20-24 37.0858 38.0 38.0 38.0 36.2 38.0 25-29 37.289750000000005 38.0 38.0 38.0 36.8 38.0 30-34 37.126850000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.93345000000001 38.0 38.0 38.0 35.8 38.0 40-44 36.957899999999995 38.0 38.0 38.0 35.8 38.0 45-49 36.552800000000005 38.0 37.8 38.0 34.0 38.0 50-54 36.8886 38.0 38.0 38.0 35.2 38.0 55-59 36.9245 38.0 38.0 38.0 35.4 38.0 60-64 36.84405 38.0 38.0 38.0 34.8 38.0 65-69 36.742450000000005 38.0 38.0 38.0 34.4 38.0 70-74 36.48605 38.0 37.4 38.0 34.2 38.0 75-79 36.39445 38.0 37.6 38.0 33.6 38.0 80-84 36.076499999999996 38.0 37.0 38.0 32.4 38.0 85-89 36.04305000000001 38.0 36.8 38.0 32.2 38.0 90-94 35.552600000000005 38.0 36.4 38.0 30.0 38.0 95-99 35.97685 38.0 37.0 38.0 32.6 38.0 100-104 35.86325 38.0 37.0 38.0 31.6 38.0 105-109 35.345150000000004 38.0 35.8 38.0 28.6 38.0 110-114 35.243700000000004 38.0 35.8 38.0 28.8 38.0 115-119 35.070550000000004 38.0 35.4 38.0 28.4 38.0 120-124 34.81345 38.0 35.0 38.0 27.4 38.0 125-129 34.42445 38.0 35.0 38.0 25.2 38.0 130-134 34.0795 38.0 34.0 38.0 23.0 38.0 135-139 33.362199999999994 38.0 34.0 38.0 20.2 38.0 140-144 32.369299999999996 36.8 32.4 38.0 14.2 38.0 145-149 30.755000000000003 36.0 29.8 38.0 9.0 38.0 150-151 27.414625 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 1.0 15 3.0 16 1.0 17 3.0 18 5.0 19 5.0 20 1.0 21 7.0 22 10.0 23 10.0 24 10.0 25 21.0 26 23.0 27 34.0 28 41.0 29 50.0 30 71.0 31 85.0 32 106.0 33 166.0 34 266.0 35 470.0 36 951.0 37 1655.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.10415597742432 15.72601334017445 7.670600307850179 23.499230374551054 2 22.575 16.25 35.475 25.7 3 17.875 26.224999999999998 30.099999999999998 25.8 4 22.45 30.675 24.85 22.025 5 20.375 36.8 24.375 18.45 6 17.4 35.6 24.975 22.025 7 15.0 25.1 42.4 17.5 8 16.0 23.150000000000002 33.800000000000004 27.05 9 17.125 23.525 32.975 26.375 10-14 20.25 29.709999999999997 26.595000000000002 23.445 15-19 20.59 28.49 27.02 23.9 20-24 20.085 28.765 27.46 23.69 25-29 20.01 29.17 27.435 23.385 30-34 19.98 29.335 27.339999999999996 23.345 35-39 20.54 28.694999999999997 26.795 23.97 40-44 20.095 29.12 27.575 23.21 45-49 20.445 28.794999999999998 27.3 23.46 50-54 20.59 28.689999999999998 27.725 22.994999999999997 55-59 20.43 28.42 27.744999999999997 23.405 60-64 20.674999999999997 28.83 27.029999999999998 23.465 65-69 19.5 29.020000000000003 27.71 23.77 70-74 20.28 28.499999999999996 27.450000000000003 23.77 75-79 19.975 28.53 27.855 23.64 80-84 20.24 28.854999999999997 26.979999999999997 23.925 85-89 20.515 28.939999999999998 27.560000000000002 22.985 90-94 20.974999999999998 28.71 27.265 23.05 95-99 20.105 28.46 27.66 23.775 100-104 20.599999999999998 28.275 27.46 23.665 105-109 20.87 27.855 27.584999999999997 23.69 110-114 20.815 27.935 27.27 23.98 115-119 20.48 28.435 27.3 23.785 120-124 21.375 28.375 26.56 23.69 125-129 20.71 28.194999999999997 27.445000000000004 23.65 130-134 21.075 28.595 27.115000000000002 23.215 135-139 20.87 27.825 27.165 24.14 140-144 21.3 27.994999999999997 27.089999999999996 23.615 145-149 21.285 28.335 26.375 24.005000000000003 150-151 21.337500000000002 28.050000000000004 26.275 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 2.5 20 1.5 21 2.0 22 3.5 23 3.5 24 4.5 25 5.0 26 4.5 27 4.5 28 8.5 29 18.0 30 25.0 31 33.5 32 42.5 33 46.5 34 63.0 35 83.5 36 98.5 37 119.0 38 142.0 39 157.5 40 181.5 41 209.0 42 212.5 43 230.5 44 256.5 45 257.0 46 244.5 47 236.5 48 225.5 49 208.0 50 187.5 51 146.0 52 108.0 53 93.0 54 76.5 55 61.0 56 51.5 57 38.5 58 28.5 59 23.5 60 16.5 61 10.5 62 8.5 63 5.5 64 2.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96281305337719 97.8 2 0.9107007336200355 1.7999999999999998 3 0.10118897040222614 0.3 4 0.025297242600556536 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.4124999999999996 0.0 0.0 0.0 0.0 124-125 2.8125 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.75 0.0 0.0 0.0 0.0 132-133 3.9875 0.0 0.0 0.0 0.0 134-135 4.2625 0.0 0.0 0.0 0.0 136-137 4.5 0.0 0.0 0.0 0.0 138-139 4.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTACT 10 0.0063298983 148.6923 1 >>END_MODULE SRR7172488 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172488_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84425 33.0 33.0 34.0 32.0 34.0 2 32.8895 34.0 33.0 34.0 32.0 34.0 3 32.9185 34.0 33.0 34.0 32.0 34.0 4 32.8705 34.0 33.0 34.0 32.0 34.0 5 32.86875 34.0 33.0 34.0 33.0 34.0 6 36.8515 38.0 38.0 38.0 36.0 38.0 7 36.9725 38.0 38.0 38.0 37.0 38.0 8 36.9045 38.0 38.0 38.0 37.0 38.0 9 36.7835 38.0 38.0 38.0 37.0 38.0 10-14 36.73695 38.0 38.0 38.0 36.0 38.0 15-19 36.8081 38.0 38.0 38.0 36.8 38.0 20-24 36.616699999999994 38.0 38.0 38.0 35.8 38.0 25-29 36.5007 38.0 38.0 38.0 35.4 38.0 30-34 36.5802 38.0 38.0 38.0 35.8 38.0 35-39 36.6245 38.0 38.0 38.0 36.0 38.0 40-44 36.414049999999996 38.0 38.0 38.0 35.0 38.0 45-49 36.43615 38.0 38.0 38.0 35.6 38.0 50-54 36.17785 38.0 37.8 38.0 33.8 38.0 55-59 36.423500000000004 38.0 38.0 38.0 35.2 38.0 60-64 36.3577 38.0 38.0 38.0 35.0 38.0 65-69 36.1414 38.0 38.0 38.0 34.2 38.0 70-74 36.1724 38.0 38.0 38.0 34.4 38.0 75-79 36.277300000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.156349999999996 38.0 38.0 38.0 34.2 38.0 85-89 35.491099999999996 38.0 37.4 38.0 30.6 38.0 90-94 35.816199999999995 38.0 38.0 38.0 33.6 38.0 95-99 35.92515 38.0 38.0 38.0 33.8 38.0 100-104 35.4846 38.0 37.4 38.0 31.2 38.0 105-109 35.510299999999994 38.0 37.8 38.0 32.0 38.0 110-114 35.32235 38.0 37.2 38.0 31.0 38.0 115-119 35.21320000000001 38.0 37.0 38.0 30.6 38.0 120-124 34.9982 38.0 37.0 38.0 29.2 38.0 125-129 34.782000000000004 38.0 36.0 38.0 27.8 38.0 130-134 34.06335 38.0 35.4 38.0 21.4 38.0 135-139 33.73595 38.0 35.0 38.0 20.6 38.0 140-144 33.47869999999999 38.0 34.8 38.0 17.4 38.0 145-149 32.84755 38.0 34.0 38.0 15.0 38.0 150-151 29.164 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 10.0 4 6.0 5 6.0 6 4.0 7 6.0 8 3.0 9 3.0 10 3.0 11 8.0 12 6.0 13 5.0 14 7.0 15 6.0 16 10.0 17 10.0 18 5.0 19 10.0 20 9.0 21 7.0 22 9.0 23 13.0 24 7.0 25 11.0 26 23.0 27 22.0 28 23.0 29 26.0 30 40.0 31 57.0 32 78.0 33 91.0 34 172.0 35 226.0 36 553.0 37 2504.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.300000000000004 24.725 8.05 15.925 2 26.55 23.974999999999998 34.150000000000006 15.325 3 20.775 26.325 35.475 17.424999999999997 4 24.15 34.825 23.125 17.9 5 23.825 38.5 20.200000000000003 17.474999999999998 6 19.225 38.35 22.85 19.575 7 20.65 19.975 40.025 19.35 8 19.1 23.25 29.799999999999997 27.85 9 21.6 23.775 30.45 24.175 10-14 23.880000000000003 28.249999999999996 26.16 21.709999999999997 15-19 23.21 28.18 27.855 20.755000000000003 20-24 23.21 27.884999999999998 27.99 20.915 25-29 23.43 28.144999999999996 27.400000000000002 21.025 30-34 22.39 28.294999999999998 27.775 21.54 35-39 23.175 28.02 27.97 20.835 40-44 23.305 27.939999999999998 27.85 20.905 45-49 23.18 27.905 28.249999999999996 20.665 50-54 23.44 27.005000000000003 28.439999999999998 21.115000000000002 55-59 23.119999999999997 27.175 28.544999999999998 21.16 60-64 23.265 28.095 27.805000000000003 20.835 65-69 23.525 27.185 28.555000000000003 20.735 70-74 23.685000000000002 27.534999999999997 28.025 20.755000000000003 75-79 24.23 27.935 27.339999999999996 20.495 80-84 22.91 27.555000000000003 28.549999999999997 20.985 85-89 23.330000000000002 27.785 27.955000000000002 20.93 90-94 24.104999999999997 27.839999999999996 27.150000000000002 20.905 95-99 22.99 27.950000000000003 27.950000000000003 21.11 100-104 23.025000000000002 28.505000000000003 27.735 20.735 105-109 23.53 26.919999999999998 28.705000000000002 20.845 110-114 23.505000000000003 27.825 27.985 20.685000000000002 115-119 24.18 27.529999999999998 27.42 20.87 120-124 23.73 27.860000000000003 27.88 20.53 125-129 23.45 27.485 28.355000000000004 20.71 130-134 23.875 27.73 27.169999999999998 21.224999999999998 135-139 24.38 27.544999999999998 27.755000000000003 20.32 140-144 24.2 27.48 27.985 20.335 145-149 25.2 27.79 26.729999999999997 20.28 150-151 24.625 27.987499999999997 27.6375 19.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.5 5 1.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 2.0 17 1.5 18 1.0 19 2.0 20 2.5 21 1.0 22 1.5 23 4.0 24 3.5 25 4.5 26 7.0 27 7.5 28 10.5 29 14.0 30 20.5 31 22.5 32 23.0 33 31.0 34 46.0 35 61.5 36 75.5 37 101.0 38 119.5 39 147.5 40 188.0 41 214.0 42 238.0 43 256.5 44 269.0 45 284.0 46 271.5 47 259.0 48 234.0 49 196.5 50 162.5 51 134.0 52 122.0 53 100.5 54 86.0 55 66.0 56 51.0 57 41.0 58 26.0 59 20.0 60 20.0 61 15.0 62 11.0 63 8.0 64 3.0 65 1.0 66 0.0 67 0.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0365111561866 97.65 2 0.7352941176470588 1.4500000000000002 3 0.15212981744421905 0.44999999999999996 4 0.05070993914807302 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02535496957403651 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7875 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.675 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.7875 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.7375 0.0 0.0 0.0 0.0 132-133 3.9875 0.0 0.0 0.0 0.0 134-135 4.3 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 4.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGGGT 10 0.006830828 145.0 1 GTTGGGT 10 0.006830828 145.0 6 >>END_MODULE Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826541 spots for SRR7172488.sra Written 826541 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra Read 826528 spots for SRR7172488.sra Written 826528 spots for SRR7172488.sra SRR ids: ['SRR7172488.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jk447zug SRR7172488.sra spots: 16530573 blocks: [[1, 826528], [826529, 1653056], [1653057, 2479584], [2479585, 3306112], [3306113, 4132640], [4132641, 4959168], [4959169, 5785696], [5785697, 6612224], [6612225, 7438752], [7438753, 8265280], [8265281, 9091808], [9091809, 9918336], [9918337, 10744864], [10744865, 11571392], [11571393, 12397920], [12397921, 13224448], [13224449, 14050976], [14050977, 14877504], [14877505, 15704032], [15704033, 16530573]] SRR7172488 file size 5579968 SRR7172488 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172488 SRR7172488_1.fastq SRR7172488_2.fastq Input file: SRR7172488_1.fastq Paired file: SRR7172488_2.fastq trimmed: SRR7172488-trimmed-pair1.fastq, SRR7172488-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:06:05 2025 >> started Mon Feb 10 13:06:22 2025 >> done (17.340s) 16530573 read pairs processed; of these: 38213 ( 0.23%) short read pairs filtered out after trimming by size control 22838 ( 0.14%) empty read pairs filtered out after trimming by size control 16469522 (99.63%) read pairs available; of these: 7944396 (48.24%) trimmed read pairs available after processing 8525126 (51.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 5 0.00% 20 22 0.00% 21 13 0.00% 22 25 0.00% 23 21 0.00% 24 21 0.00% 25 25 0.00% 26 24 0.00% 27 27 0.00% 28 33 0.00% 29 26 0.00% 30 21 0.00% 31 31 0.00% 32 33 0.00% 33 28 0.00% 34 36 0.00% 35 35 0.00% 36 40 0.00% 37 29 0.00% 38 35 0.00% 39 46 0.00% 40 38 0.00% 41 42 0.00% 42 45 0.00% 43 49 0.00% 44 58 0.00% 45 67 0.00% 46 86 0.00% 47 83 0.00% 48 76 0.00% 49 83 0.00% 50 116 0.00% 51 127 0.00% 52 109 0.00% 53 141 0.00% 54 169 0.00% 55 182 0.00% 56 176 0.00% 57 204 0.00% 58 204 0.00% 59 243 0.00% 60 295 0.00% 61 321 0.00% 62 374 0.00% 63 391 0.00% 64 465 0.00% 65 534 0.00% 66 661 0.00% 67 804 0.00% 68 1213 0.01% 69 2593 0.02% 70 2665 0.02% 71 1776 0.01% 72 1484 0.01% 73 1433 0.01% 74 1416 0.01% 75 1571 0.01% 76 1636 0.01% 77 1924 0.01% 78 2040 0.01% 79 2459 0.01% 80 2528 0.02% 81 2843 0.02% 82 3158 0.02% 83 3803 0.02% 84 5749 0.03% 85 6842 0.04% 86 7091 0.04% 87 7300 0.04% 88 7787 0.05% 89 8055 0.05% 90 8274 0.05% 91 8908 0.05% 92 9326 0.06% 93 10025 0.06% 94 10243 0.06% 95 11000 0.07% 96 11730 0.07% 97 11873 0.07% 98 12421 0.08% 99 13370 0.08% 100 14340 0.09% 101 14906 0.09% 102 15847 0.10% 103 16429 0.10% 104 17372 0.11% 105 18454 0.11% 106 19175 0.12% 107 19737 0.12% 108 20743 0.13% 109 21988 0.13% 110 22468 0.14% 111 23563 0.14% 112 24834 0.15% 113 26352 0.16% 114 26954 0.16% 115 28546 0.17% 116 30035 0.18% 117 30937 0.19% 118 31957 0.19% 119 33055 0.20% 120 34285 0.21% 121 35813 0.22% 122 36983 0.22% 123 38611 0.23% 124 40627 0.25% 125 41808 0.25% 126 44143 0.27% 127 45834 0.28% 128 47754 0.29% 129 50936 0.31% 130 52084 0.32% 131 53969 0.33% 132 56631 0.34% 133 59669 0.36% 134 63136 0.38% 135 66823 0.41% 136 70447 0.43% 137 76402 0.46% 138 81219 0.49% 139 87622 0.53% 140 93049 0.56% 141 101884 0.62% 142 111739 0.68% 143 126544 0.77% 144 144286 0.88% 145 171207 1.04% 146 212311 1.29% 147 285796 1.74% 148 426371 2.59% 149 813860 4.94% 150 3723593 22.61% 151 8525126 51.76% 16469522 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=23 prefix-density=0.66 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=36.87 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=7.0 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=11 prefix-density=0.94 prefix-fanout=1.6 sequence=ATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=37.69 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.6 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR7172488 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:07:09 Started mapping on | Feb 10 13:07:09 Finished on | Feb 10 13:09:26 Mapping speed, Million of reads per hour | 432.78 Number of input reads | 16469522 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14929300 Uniquely mapped reads % | 90.65% Average mapped length | 293.27 Number of splices: Total | 13940760 Number of splices: Annotated (sjdb) | 13614860 Number of splices: GT/AG | 13653622 Number of splices: GC/AG | 232646 Number of splices: AT/AC | 9107 Number of splices: Non-canonical | 45385 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 402467 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 150054 % of reads mapped to too many loci | 0.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.81% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1174282 1174282 1174282 N_multimapping 402467 402467 402467 N_noFeature 620160 14610374 752608 N_ambiguous 295478 1520 108039 UnstrandedReadsAssigned:14013662 PositiveStrandReadsAssigned:317406 NegativeStrandReadsAssigned:14068653 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172488 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172488-trimmed-pair1.fastq SRR7172488-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,469,522 reads, 14,154,446 reads pseudoaligned [quant] estimated average fragment length: 247.967 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,288 rounds 52401 SRR7172488.ke.tsv 34699 SRR7172488.se.tsv 87100 total ==> SRR7172488.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.03 684 22.7086 Potri.005G024800.1.v4.1 1035 788.033 166 12.3858 Potri.004G059700.1.v4.1 961 714.096 15 1.23508 Potri.007G009000.2.v4.1 1416 1169.03 0 0 Potri.003G141000.2.v4.1 2943 2696.03 543.072 11.8438 Potri.016G087400.1.v4.1 270 80.3277 829 606.805 Potri.015G069301.1.v4.1 564 324.31 0 0 Potri.010G195200.1.v4.1 1773 1526.03 19 0.732065 Potri.012G127500.1.v4.1 977 730.062 257 20.6982 ==> SRR7172488.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1783 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 305 Potri.001G212900.v4.1 68 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7172488 completed mapping pipeline successfully