Starting /dee2/code/volunteer_pipeline.sh SRR7172489 current disk space = 3058928001024 free memory = 1573234088 SRR7172489 SRAfilesize f6fe0383cde8235c751166a66f3b917d SRR7172489.sra SRR7172489.sra file validated SRR7172489 is paired end SRR7172489 is conventional basespace SRR7172489 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172489_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.066 34.0 33.0 34.0 33.0 34.0 2 33.4555 34.0 34.0 34.0 33.0 34.0 3 33.4725 34.0 34.0 34.0 33.0 34.0 4 33.41925 34.0 34.0 34.0 33.0 34.0 5 33.41825 34.0 34.0 34.0 33.0 34.0 6 37.1075 38.0 38.0 38.0 36.0 38.0 7 37.38525 38.0 38.0 38.0 37.0 38.0 8 37.48175 38.0 38.0 38.0 37.0 38.0 9 37.522 38.0 38.0 38.0 38.0 38.0 10-14 37.52034999999999 38.0 38.0 38.0 37.8 38.0 15-19 37.512550000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.5287 38.0 38.0 38.0 38.0 38.0 25-29 37.4978 38.0 38.0 38.0 37.8 38.0 30-34 37.4211 38.0 38.0 38.0 37.0 38.0 35-39 37.35915 38.0 38.0 38.0 37.0 38.0 40-44 37.233900000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.1857 38.0 38.0 38.0 36.4 38.0 50-54 37.04065000000001 38.0 38.0 38.0 36.0 38.0 55-59 37.0116 38.0 38.0 38.0 36.0 38.0 60-64 37.00315 38.0 38.0 38.0 36.0 38.0 65-69 37.01265 38.0 38.0 38.0 36.0 38.0 70-74 36.84275 38.0 38.0 38.0 35.2 38.0 75-79 36.75075 38.0 38.0 38.0 35.2 38.0 80-84 36.65995 38.0 38.0 38.0 34.6 38.0 85-89 36.53285 38.0 38.0 38.0 34.0 38.0 90-94 36.4217 38.0 38.0 38.0 34.0 38.0 95-99 36.271249999999995 38.0 37.8 38.0 34.0 38.0 100-104 36.129400000000004 38.0 37.4 38.0 33.2 38.0 105-109 36.011700000000005 38.0 37.0 38.0 32.6 38.0 110-114 35.760450000000006 38.0 37.0 38.0 31.8 38.0 115-119 35.5746 38.0 36.6 38.0 30.6 38.0 120-124 35.459649999999996 38.0 36.6 38.0 30.6 38.0 125-129 35.0769 38.0 36.0 38.0 28.2 38.0 130-134 34.650349999999996 38.0 35.2 38.0 27.2 38.0 135-139 34.24399999999999 38.0 35.0 38.0 24.0 38.0 140-144 33.7758 38.0 34.4 38.0 22.6 38.0 145-149 32.974000000000004 38.0 33.2 38.0 16.6 38.0 150-151 28.320500000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 1.0 14 2.0 15 1.0 16 0.0 17 2.0 18 3.0 19 2.0 20 2.0 21 11.0 22 9.0 23 8.0 24 9.0 25 27.0 26 15.0 27 33.0 28 33.0 29 37.0 30 50.0 31 62.0 32 73.0 33 125.0 34 147.0 35 290.0 36 658.0 37 2395.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.95064540622627 15.666919767147558 7.719564667172868 31.662870159453306 2 21.025 18.975 34.825 25.174999999999997 3 18.4 26.35 28.775000000000002 26.474999999999998 4 22.075 32.775 24.2 20.95 5 20.681021532298445 38.70806209313971 23.885828743114672 16.72508763144717 6 18.075 36.175000000000004 24.525 21.224999999999998 7 15.75 21.925 43.475 18.85 8 17.075000000000003 24.325 31.8 26.8 9 17.825 23.325000000000003 32.5 26.35 10-14 19.71 29.815 26.665 23.810000000000002 15-19 19.73 28.249999999999996 28.015 24.005000000000003 20-24 19.645000000000003 28.605000000000004 27.91 23.84 25-29 19.63 29.595 27.500000000000004 23.275000000000002 30-34 19.63 28.389999999999997 28.4 23.580000000000002 35-39 19.582937440616092 29.139370905635847 27.529129369405407 23.74856228434265 40-44 20.316094828448534 28.763629088726617 27.563268980694204 23.357007102130638 45-49 20.48114434330299 28.78363509052716 27.673301990597178 23.06191857557267 50-54 20.29405881176235 28.920784156831363 27.845569113822766 22.939587917583516 55-59 20.117128841725897 28.82670938031835 27.850635699269194 23.205526078686557 60-64 19.813776531838208 28.634361233480178 27.748297957549056 23.80356427713256 65-69 19.652600490564147 27.801972268108326 28.692996946488464 23.852430294839063 70-74 20.40346398358112 28.62792211042699 27.376482955398707 23.59213095059318 75-79 20.115143929912392 28.86107634543179 27.83479349186483 23.188986232790988 80-84 19.968970521995896 28.682248135728944 27.871477904008806 23.477303438266354 85-89 20.51743982385027 28.469198818996144 27.598458689886403 23.414902667267175 90-94 19.786872123273962 28.89733840304182 27.996798078847306 23.318991394836903 95-99 19.571743045827496 28.93235941564939 27.98679207524515 23.509105463277965 100-104 20.682398917781452 28.41324715667118 27.606593516709253 23.297760408838116 105-109 20.48560700876095 28.946182728410513 27.97997496871089 22.58823529411765 110-114 20.640408899579075 28.748246141511324 27.22489476849068 23.386450190418923 115-119 20.255255255255257 28.928928928928926 27.81781781781782 22.997997997998 120-124 20.415 28.444999999999997 27.639999999999997 23.5 125-129 20.32101605080254 29.34646732336617 27.026351317565876 23.306165308265413 130-134 20.473943166984636 28.863339692740237 27.517823074605886 23.144894065669245 135-139 20.753672771181325 28.496679412356613 27.575971020326023 23.173676796136043 140-144 20.721757845738026 28.46989338805746 27.36373191851444 23.444616847690074 145-149 20.465 29.080000000000002 27.115000000000002 23.34 150-151 21.212500000000002 27.325 27.437499999999996 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 1.0 21 1.0 22 1.0 23 2.5 24 4.0 25 5.5 26 5.0 27 5.5 28 9.5 29 16.5 30 24.0 31 36.5 32 44.5 33 52.5 34 60.0 35 79.0 36 104.0 37 125.0 38 143.0 39 159.5 40 187.5 41 206.0 42 233.5 43 277.0 44 277.5 45 255.5 46 241.0 47 236.5 48 244.0 49 219.5 50 169.5 51 135.0 52 112.0 53 79.5 54 59.0 55 44.0 56 33.5 57 29.5 58 21.5 59 17.5 60 14.0 61 8.0 62 4.0 63 3.0 64 2.5 65 1.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.03 45-49 0.03 50-54 0.02 55-59 0.11 60-64 0.12 65-69 0.11499999999999999 70-74 0.11499999999999999 75-79 0.125 80-84 0.095 85-89 0.08499999999999999 90-94 0.06 95-99 0.06 100-104 0.20500000000000002 105-109 0.125 110-114 0.22 115-119 0.1 120-124 0.0 125-129 0.005 130-134 0.41000000000000003 135-139 0.62 140-144 0.105 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8374999999999999 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.3624999999999998 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.8 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.7125 0.0 0.0 0.0 0.0 118-119 2.9000000000000004 0.0 0.0 0.0 0.0 120-121 3.2125000000000004 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.0 0.0 0.0 0.0 0.0 128-129 4.425 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.3625 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.275 0.0 0.0 0.0 0.0 138-139 6.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTCG 10 0.0068555363 144.825 5 CCTTCGC 10 0.0068555363 144.825 6 >>END_MODULE SRR7172489 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172489_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54975 33.0 33.0 34.0 32.0 34.0 2 32.67125 33.0 33.0 34.0 32.0 34.0 3 32.6795 34.0 33.0 34.0 32.0 34.0 4 32.567 34.0 33.0 34.0 32.0 34.0 5 32.56225 34.0 33.0 34.0 32.0 34.0 6 36.6505 38.0 38.0 38.0 36.0 38.0 7 36.73875 38.0 38.0 38.0 36.0 38.0 8 36.77875 38.0 38.0 38.0 36.0 38.0 9 36.72125 38.0 38.0 38.0 36.0 38.0 10-14 36.73075 38.0 38.0 38.0 36.0 38.0 15-19 36.7201 38.0 38.0 38.0 36.0 38.0 20-24 36.6838 38.0 38.0 38.0 36.0 38.0 25-29 36.6626 38.0 38.0 38.0 36.0 38.0 30-34 36.6349 38.0 38.0 38.0 36.0 38.0 35-39 36.592150000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.522549999999995 38.0 38.0 38.0 35.8 38.0 45-49 36.5445 38.0 38.0 38.0 36.0 38.0 50-54 36.5745 38.0 38.0 38.0 36.0 38.0 55-59 36.4543 38.0 38.0 38.0 35.4 38.0 60-64 36.3902 38.0 38.0 38.0 35.0 38.0 65-69 36.30585 38.0 38.0 38.0 35.0 38.0 70-74 36.27239999999999 38.0 38.0 38.0 34.2 38.0 75-79 36.16105 38.0 38.0 38.0 34.0 38.0 80-84 36.087900000000005 38.0 38.0 38.0 34.0 38.0 85-89 35.9539 38.0 38.0 38.0 33.6 38.0 90-94 35.76615 38.0 38.0 38.0 33.2 38.0 95-99 35.67274999999999 38.0 38.0 38.0 32.2 38.0 100-104 35.5661 38.0 38.0 38.0 31.6 38.0 105-109 35.50095 38.0 37.8 38.0 31.8 38.0 110-114 35.186099999999996 38.0 37.0 38.0 29.0 38.0 115-119 35.05285 38.0 37.0 38.0 28.4 38.0 120-124 34.763400000000004 38.0 36.0 38.0 27.0 38.0 125-129 34.3857 38.0 36.0 38.0 23.8 38.0 130-134 33.9902 38.0 35.4 38.0 22.0 38.0 135-139 33.4426 38.0 33.8 38.0 16.2 38.0 140-144 32.7519 38.0 33.2 38.0 13.6 38.0 145-149 31.822699999999998 38.0 32.8 38.0 8.6 38.0 150-151 27.31875 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 7.0 4 7.0 5 1.0 6 3.0 7 6.0 8 2.0 9 4.0 10 2.0 11 2.0 12 6.0 13 5.0 14 5.0 15 7.0 16 7.0 17 6.0 18 10.0 19 11.0 20 9.0 21 13.0 22 9.0 23 13.0 24 13.0 25 21.0 26 27.0 27 26.0 28 40.0 29 45.0 30 56.0 31 64.0 32 78.0 33 92.0 34 150.0 35 253.0 36 512.0 37 2463.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.96745117676515 19.929894842263394 12.293440160240362 22.8092138207311 2 26.10330992978937 25.45135406218656 32.47241725175527 15.972918756268806 3 20.51667920742413 27.74015550539253 33.358414848256835 18.38475043892651 4 22.00752823086575 36.01003764115433 23.111668757841908 18.870765370138017 5 23.1058705469142 38.585047666833916 22.00200702458605 16.30707476166583 6 18.804920913884008 38.53878985689179 23.901581722319857 18.754707506904346 7 17.92168674698795 19.703815261044177 42.79618473895582 19.57831325301205 8 21.561244979919678 22.640562248995984 30.522088353413658 25.27610441767068 9 21.290484559377354 23.851368315340196 30.65528496108461 24.202862164197843 10-14 23.010493548225135 28.232163478435506 27.11753778179445 21.639805191544912 15-19 22.531251568853857 27.662031226467192 27.76745820573322 22.03925899894573 20-24 22.22110653680088 27.839140475951403 28.652475148107236 21.287277839140476 25-29 22.429718875502008 28.473895582329316 28.704819277108435 20.39156626506024 30-34 21.940568216042568 28.230097379781142 29.16373858046381 20.66559582371248 35-39 21.801114401887457 27.88514632799558 29.05978615531349 21.253953114803473 40-44 22.569793131150835 28.19341233179353 28.21349668608154 21.02329785097409 45-49 22.752837199959828 27.97027217033243 28.69840313347394 20.578487496233805 50-54 22.415264875721817 27.86844087371328 28.802410243535025 20.913884007029875 55-59 22.411888743849783 28.01486092981223 28.85329852394819 20.7199518023898 60-64 23.237951807228914 27.946787148594375 28.20281124497992 20.612449799196785 65-69 22.915097655269367 28.458101119646535 27.88070492544058 20.746096299643522 70-74 23.338019682667202 28.268728660373572 27.641092588873267 20.75215906808596 75-79 23.074605884124914 27.62325534692238 28.411487097098103 20.890651671854606 80-84 22.946374774051016 28.233581040369554 28.399276963245633 20.4207672223338 85-89 23.207111289674568 27.576335877862597 28.846926476496588 20.369626355966254 90-94 23.392282958199356 27.713022508038588 28.521905144694532 20.372789389067524 95-99 23.336179617258527 28.037570947812547 28.40926214274951 20.216987292179418 100-104 23.21249246836714 27.43522795742117 28.51978308897369 20.832496485238 105-109 23.335676272718146 27.904408073099706 28.341198915553772 20.418716738628376 110-114 23.70983935742972 28.05722891566265 27.92168674698795 20.311244979919678 115-119 23.65699367406366 27.994778592228137 27.904408073099706 20.443819660608494 120-124 23.437264648290405 27.569413064216498 28.267309333735003 20.726012953758097 125-129 23.618014761259225 27.910829944268716 28.53341366671687 19.937741627755184 130-134 24.50557172974601 27.467121774922198 28.09456881839173 19.932737676940064 135-139 24.00863367131814 28.335508483084027 27.487200080313222 20.16865776528461 140-144 24.602018781700398 27.901370963692063 27.3339024757696 20.162707778837945 145-149 24.869399236487844 28.7321679726743 26.933895921237692 19.46453686960016 150-151 25.291975386160992 27.577546150948134 28.054753233705892 19.075725229184982 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 7.0 2 3.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 3.5 23 4.5 24 3.5 25 5.5 26 8.0 27 8.5 28 9.0 29 16.5 30 23.0 31 24.0 32 37.5 33 47.0 34 53.0 35 73.5 36 94.5 37 127.0 38 162.0 39 175.5 40 193.5 41 232.0 42 260.0 43 263.0 44 250.0 45 245.0 46 242.0 47 240.0 48 230.0 49 191.0 50 159.0 51 132.5 52 106.5 53 82.0 54 68.0 55 58.0 56 45.5 57 34.5 58 21.5 59 13.5 60 9.0 61 7.0 62 4.0 63 3.0 64 3.5 65 2.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.3 3 0.325 4 0.375 5 0.35000000000000003 6 0.42500000000000004 7 0.4 8 0.4 9 0.42500000000000004 10-14 0.415 15-19 0.40499999999999997 20-24 0.41000000000000003 25-29 0.4 30-34 0.38999999999999996 35-39 0.395 40-44 0.42 45-49 0.43 50-54 0.42500000000000004 55-59 0.41000000000000003 60-64 0.4 65-69 0.415 70-74 0.42 75-79 0.41000000000000003 80-84 0.42 85-89 0.44 90-94 0.48 95-99 0.455 100-104 0.42 105-109 0.41000000000000003 110-114 0.4 115-119 0.41000000000000003 120-124 0.415 125-129 0.415 130-134 0.38999999999999996 135-139 0.38999999999999996 140-144 0.43499999999999994 145-149 0.45999999999999996 150-151 0.46249999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91111673841479 97.65 2 0.9875917953912383 1.95 3 0.05064573309698658 0.15 4 0.02532286654849329 0.1 5 0.0 0.0 6 0.02532286654849329 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.362500000000001 0.0 0.0 0.0 0.0 134-135 5.9125 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138-139 6.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGGCC 10 0.0068449317 144.90001 9 >>END_MODULE Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738289 spots for SRR7172489.sra Written 738289 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra Read 738283 spots for SRR7172489.sra Written 738283 spots for SRR7172489.sra SRR ids: ['SRR7172489.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2uqvw4ba SRR7172489.sra spots: 14765666 blocks: [[1, 738283], [738284, 1476566], [1476567, 2214849], [2214850, 2953132], [2953133, 3691415], [3691416, 4429698], [4429699, 5167981], [5167982, 5906264], [5906265, 6644547], [6644548, 7382830], [7382831, 8121113], [8121114, 8859396], [8859397, 9597679], [9597680, 10335962], [10335963, 11074245], [11074246, 11812528], [11812529, 12550811], [12550812, 13289094], [13289095, 14027377], [14027378, 14765666]] SRR7172489 file size 4981899 SRR7172489 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172489 SRR7172489_1.fastq SRR7172489_2.fastq Input file: SRR7172489_1.fastq Paired file: SRR7172489_2.fastq trimmed: SRR7172489-trimmed-pair1.fastq, SRR7172489-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:24:44 2025 >> started Mon Feb 10 13:25:09 2025 >> done (25.571s) 14765666 read pairs processed; of these: 33425 ( 0.23%) short read pairs filtered out after trimming by size control 75134 ( 0.51%) empty read pairs filtered out after trimming by size control 14657107 (99.26%) read pairs available; of these: 7344765 (50.11%) trimmed read pairs available after processing 7312342 (49.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 12 0.00% 20 16 0.00% 21 9 0.00% 22 7 0.00% 23 11 0.00% 24 16 0.00% 25 13 0.00% 26 14 0.00% 27 16 0.00% 28 12 0.00% 29 16 0.00% 30 14 0.00% 31 12 0.00% 32 15 0.00% 33 17 0.00% 34 22 0.00% 35 23 0.00% 36 26 0.00% 37 52 0.00% 38 32 0.00% 39 44 0.00% 40 33 0.00% 41 38 0.00% 42 40 0.00% 43 44 0.00% 44 56 0.00% 45 125 0.00% 46 109 0.00% 47 89 0.00% 48 85 0.00% 49 85 0.00% 50 72 0.00% 51 116 0.00% 52 132 0.00% 53 139 0.00% 54 134 0.00% 55 151 0.00% 56 195 0.00% 57 203 0.00% 58 231 0.00% 59 298 0.00% 60 358 0.00% 61 360 0.00% 62 408 0.00% 63 472 0.00% 64 547 0.00% 65 543 0.00% 66 601 0.00% 67 709 0.00% 68 831 0.01% 69 1219 0.01% 70 1293 0.01% 71 1261 0.01% 72 1445 0.01% 73 1543 0.01% 74 1717 0.01% 75 1845 0.01% 76 1994 0.01% 77 2201 0.02% 78 2503 0.02% 79 2743 0.02% 80 3109 0.02% 81 3585 0.02% 82 4099 0.03% 83 4614 0.03% 84 6133 0.04% 85 6867 0.05% 86 7347 0.05% 87 7511 0.05% 88 7956 0.05% 89 8158 0.06% 90 8846 0.06% 91 9424 0.06% 92 10277 0.07% 93 11203 0.08% 94 11786 0.08% 95 12091 0.08% 96 12273 0.08% 97 12544 0.09% 98 13028 0.09% 99 13527 0.09% 100 14526 0.10% 101 15209 0.10% 102 16226 0.11% 103 17253 0.12% 104 18123 0.12% 105 18707 0.13% 106 19299 0.13% 107 19883 0.14% 108 20650 0.14% 109 21424 0.15% 110 22047 0.15% 111 23151 0.16% 112 24496 0.17% 113 25979 0.18% 114 26694 0.18% 115 27788 0.19% 116 28772 0.20% 117 29305 0.20% 118 30087 0.21% 119 31165 0.21% 120 32275 0.22% 121 33347 0.23% 122 34673 0.24% 123 36917 0.25% 124 38373 0.26% 125 39949 0.27% 126 41719 0.28% 127 42643 0.29% 128 44490 0.30% 129 46124 0.31% 130 47494 0.32% 131 48972 0.33% 132 52093 0.36% 133 54892 0.37% 134 58363 0.40% 135 61808 0.42% 136 65335 0.45% 137 68758 0.47% 138 73431 0.50% 139 78151 0.53% 140 83554 0.57% 141 90894 0.62% 142 99856 0.68% 143 112710 0.77% 144 129192 0.88% 145 154363 1.05% 146 189247 1.29% 147 253400 1.73% 148 381231 2.60% 149 755559 5.15% 150 3442418 23.49% 151 7312342 49.89% 14657107 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=9 prefix-density=0.41 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=423.99 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=23 prefix-density=0.56 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=51.78 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.5 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7172489 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:25:55 Started mapping on | Feb 10 13:25:55 Finished on | Feb 10 13:27:36 Mapping speed, Million of reads per hour | 522.43 Number of input reads | 14657107 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13595676 Uniquely mapped reads % | 92.76% Average mapped length | 292.33 Number of splices: Total | 12958130 Number of splices: Annotated (sjdb) | 12608216 Number of splices: GT/AG | 12699195 Number of splices: GC/AG | 201003 Number of splices: AT/AC | 7679 Number of splices: Non-canonical | 50253 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418847 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 57776 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.88% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 671513 671513 671513 N_multimapping 418847 418847 418847 N_noFeature 591918 13366936 698241 N_ambiguous 249017 1099 125880 UnstrandedReadsAssigned:12754741 PositiveStrandReadsAssigned:227641 NegativeStrandReadsAssigned:12771555 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172489 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172489-trimmed-pair1.fastq SRR7172489-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,657,107 reads, 12,774,103 reads pseudoaligned [quant] estimated average fragment length: 254.367 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR7172489.ke.tsv 34699 SRR7172489.se.tsv 87100 total ==> SRR7172489.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.63 893 39.0632 Potri.005G024800.1.v4.1 1035 781.633 254 25.0843 Potri.004G059700.1.v4.1 961 707.771 1 0.109063 Potri.007G009000.2.v4.1 1416 1162.63 0 0 Potri.003G141000.2.v4.1 2943 2689.63 596 17.105 Potri.016G087400.1.v4.1 270 82.7275 688 641.961 Potri.015G069301.1.v4.1 564 322.553 0 0 Potri.010G195200.1.v4.1 1773 1519.63 205 10.4132 Potri.012G127500.1.v4.1 977 723.676 140 14.9332 ==> SRR7172489.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 580 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 157 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7172489 completed mapping pipeline successfully