Starting /dee2/code/volunteer_pipeline.sh SRR7172490 current disk space = 3058777579520 free memory = 1566591916 SRR7172490 SRAfilesize bf51d13ef03cf15358b1193e5b770258 SRR7172490.sra SRR7172490.sra file validated SRR7172490 is paired end SRR7172490 is conventional basespace SRR7172490 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172490_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4685 34.0 33.0 34.0 33.0 34.0 2 33.3 34.0 33.0 34.0 33.0 34.0 3 33.41125 34.0 34.0 34.0 33.0 34.0 4 33.4945 34.0 34.0 34.0 33.0 34.0 5 33.4715 34.0 34.0 34.0 33.0 34.0 6 37.312 38.0 38.0 38.0 37.0 38.0 7 37.478 38.0 38.0 38.0 37.0 38.0 8 37.53975 38.0 38.0 38.0 38.0 38.0 9 37.53325 38.0 38.0 38.0 38.0 38.0 10-14 37.530899999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.5265 38.0 38.0 38.0 38.0 38.0 20-24 37.493900000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.49715 38.0 38.0 38.0 38.0 38.0 30-34 37.47275 38.0 38.0 38.0 38.0 38.0 35-39 37.3699 38.0 38.0 38.0 37.6 38.0 40-44 37.15725 38.0 38.0 38.0 37.0 38.0 45-49 37.15894999999999 38.0 38.0 38.0 36.4 38.0 50-54 37.04795 38.0 38.0 38.0 36.0 38.0 55-59 37.0181 38.0 38.0 38.0 36.0 38.0 60-64 36.99525 38.0 38.0 38.0 36.0 38.0 65-69 36.917899999999996 38.0 38.0 38.0 35.8 38.0 70-74 36.77315 38.0 38.0 38.0 35.2 38.0 75-79 36.707350000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.4708 38.0 38.0 38.0 34.2 38.0 85-89 36.4456 38.0 38.0 38.0 34.0 38.0 90-94 36.3789 38.0 38.0 38.0 33.8 38.0 95-99 36.2268 38.0 38.0 38.0 34.0 38.0 100-104 35.991699999999994 38.0 37.2 38.0 33.0 38.0 105-109 35.771950000000004 38.0 37.0 38.0 31.6 38.0 110-114 35.4855 38.0 36.6 38.0 30.2 38.0 115-119 35.53375 38.0 36.8 38.0 30.2 38.0 120-124 35.357 38.0 36.0 38.0 30.2 38.0 125-129 34.87615 38.0 35.4 38.0 28.0 38.0 130-134 34.430499999999995 38.0 34.6 38.0 25.6 38.0 135-139 33.906549999999996 38.0 34.4 38.0 22.4 38.0 140-144 33.288799999999995 38.0 33.2 38.0 21.0 38.0 145-149 32.112849999999995 38.0 33.0 38.0 11.2 38.0 150-151 27.315625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 3.0 10 0.0 11 2.0 12 2.0 13 4.0 14 2.0 15 1.0 16 3.0 17 1.0 18 3.0 19 5.0 20 5.0 21 9.0 22 6.0 23 11.0 24 19.0 25 20.0 26 12.0 27 30.0 28 38.0 29 35.0 30 37.0 31 66.0 32 83.0 33 114.0 34 173.0 35 294.0 36 759.0 37 2260.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.99896747547754 14.2230252968508 7.201858544140423 32.57614868353124 2 22.425 18.375 33.95 25.25 3 19.225 23.775 28.575 28.425 4 22.375 31.574999999999996 24.2 21.85 5 21.349999999999998 34.75 23.5 20.4 6 18.15 34.375 26.8 20.674999999999997 7 14.6 23.974999999999998 44.4 17.025000000000002 8 17.275 24.75 31.825 26.150000000000002 9 18.2 23.549999999999997 33.650000000000006 24.6 10-14 20.330000000000002 29.375 26.740000000000002 23.555 15-19 19.865 28.875 27.815 23.445 20-24 20.111005550277515 28.546427321366068 27.91139556977849 23.43117155857793 25-29 20.531026551327567 28.921446072303613 27.30636531826591 23.241162058102905 30-34 19.675 29.25 27.715 23.36 35-39 20.162097258355015 29.02241344806884 26.92615569341605 23.889333600160096 40-44 20.299359231077293 28.44413295955146 27.973568281938327 23.28293952743292 45-49 19.97197617975279 29.029675223940348 27.353250262723318 23.645098333583547 50-54 20.01902282739287 28.594313175810974 27.76832198638366 23.618342010412498 55-59 20.871306960440663 28.447671507260893 27.275913870806207 23.405107661492238 60-64 20.615923885828742 28.632949424136207 27.065598397596396 23.685528292438658 65-69 19.969954932398597 28.903355032548824 27.711567351026538 23.415122684026038 70-74 19.91584852734923 28.70667200961731 27.49949909837708 23.87798036465638 75-79 20.484945644005812 28.134862982816493 28.164921597114372 23.215269776063323 80-84 20.245368052078117 28.647971957936907 27.075613420130196 24.031046569854784 85-89 20.187299679487182 28.670873397435898 27.418870192307693 23.722956730769234 90-94 19.9949924887331 28.41261892839259 27.020530796194294 24.57185778668002 95-99 20.59088632949424 28.337506259389084 27.325988983475213 23.745618427641464 100-104 20.817471448607495 28.716690042075736 26.948507313163695 23.517331196153076 105-109 20.60636431971937 28.0982209972438 27.557003257328986 23.73841142570784 110-114 20.700365713140627 28.159911828064725 27.08281148239066 24.05691097640399 115-119 20.391705069124423 28.676617912242037 26.878381085954718 24.05329593267882 120-124 20.36 28.435 26.834999999999997 24.37 125-129 20.770385192596297 28.74437218609305 26.473236618309155 24.012006003001503 130-134 20.64266318012672 28.29126018304335 27.285527506788696 23.780549130041233 135-139 20.865268253327955 28.191811214199276 27.0421540943929 23.90076643807987 140-144 20.914377381191095 28.44395428113094 26.343493082013236 24.298175255664727 145-149 21.267126712671267 28.517851785178514 26.07760776077608 24.137413741374136 150-151 21.087500000000002 28.537499999999998 26.137500000000003 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.5 17 2.0 18 1.5 19 3.0 20 3.0 21 1.5 22 2.5 23 2.5 24 2.5 25 5.5 26 9.0 27 13.5 28 16.5 29 17.0 30 21.5 31 34.0 32 40.5 33 49.0 34 73.0 35 90.5 36 99.5 37 107.5 38 130.5 39 158.5 40 183.5 41 199.5 42 205.0 43 222.0 44 243.0 45 256.5 46 240.5 47 225.0 48 218.5 49 196.0 50 185.0 51 157.5 52 118.0 53 105.5 54 87.0 55 67.5 56 52.5 57 39.0 58 37.0 59 29.5 60 16.5 61 7.5 62 7.0 63 7.0 64 4.0 65 2.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.005 30-34 0.0 35-39 0.06 40-44 0.12 45-49 0.08499999999999999 50-54 0.12 55-59 0.15 60-64 0.15 65-69 0.15 70-74 0.18 75-79 0.19499999999999998 80-84 0.15 85-89 0.16 90-94 0.15 95-99 0.15 100-104 0.18 105-109 0.22499999999999998 110-114 0.19499999999999998 115-119 0.18 120-124 0.0 125-129 0.05 130-134 0.5700000000000001 135-139 0.84 140-144 0.26 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06636386575826 98.15 2 0.9336361342417362 1.8499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.275 0.0 0.0 0.0 0.0 108-109 2.6624999999999996 0.0 0.0 0.0 0.0 110-111 2.9749999999999996 0.0 0.0 0.0 0.0 112-113 3.4625 0.0 0.0 0.0 0.0 114-115 3.825 0.0 0.0 0.0 0.0 116-117 4.3125 0.0 0.0 0.0 0.0 118-119 4.800000000000001 0.0 0.0 0.0 0.0 120-121 5.4375 0.0 0.0 0.0 0.0 122-123 5.9625 0.0 0.0 0.0 0.0 124-125 6.5375 0.0 0.0 0.0 0.0 126-127 7.0875 0.0 0.0 0.0 0.0 128-129 7.725 0.0 0.0 0.0 0.0 130-131 8.412500000000001 0.0 0.0 0.0 0.0 132-133 9.225000000000001 0.0 0.0 0.0 0.0 134-135 10.0125 0.0 0.0 0.0 0.0 136-137 10.6875 0.0 0.0 0.0 0.0 138-139 11.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATGGG 10 0.006528151 147.16667 1 >>END_MODULE SRR7172490 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172490_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84475 33.0 33.0 34.0 32.0 34.0 2 32.964 34.0 33.0 34.0 32.0 34.0 3 32.9445 34.0 33.0 34.0 32.0 34.0 4 32.905 34.0 33.0 34.0 32.0 34.0 5 32.90275 34.0 33.0 34.0 32.0 34.0 6 37.0985 38.0 38.0 38.0 37.0 38.0 7 37.07925 38.0 38.0 38.0 37.0 38.0 8 37.03675 38.0 38.0 38.0 37.0 38.0 9 36.98625 38.0 38.0 38.0 37.0 38.0 10-14 37.0596 38.0 38.0 38.0 37.0 38.0 15-19 37.0592 38.0 38.0 38.0 37.0 38.0 20-24 37.0034 38.0 38.0 38.0 37.0 38.0 25-29 37.04455 38.0 38.0 38.0 37.0 38.0 30-34 37.02375000000001 38.0 38.0 38.0 37.0 38.0 35-39 36.990050000000004 38.0 38.0 38.0 37.0 38.0 40-44 36.92405 38.0 38.0 38.0 37.0 38.0 45-49 36.9399 38.0 38.0 38.0 37.0 38.0 50-54 36.95615 38.0 38.0 38.0 37.0 38.0 55-59 36.90955 38.0 38.0 38.0 36.6 38.0 60-64 36.85145 38.0 38.0 38.0 36.2 38.0 65-69 36.7442 38.0 38.0 38.0 36.0 38.0 70-74 36.74399999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.653200000000005 38.0 38.0 38.0 35.8 38.0 80-84 36.544399999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.4076 38.0 38.0 38.0 34.6 38.0 90-94 36.282650000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.1259 38.0 38.0 38.0 34.0 38.0 100-104 36.08995 38.0 38.0 38.0 33.8 38.0 105-109 36.06395 38.0 38.0 38.0 34.0 38.0 110-114 35.81075 38.0 37.8 38.0 33.0 38.0 115-119 35.56945 38.0 37.2 38.0 32.0 38.0 120-124 35.24675 38.0 37.0 38.0 29.6 38.0 125-129 34.990199999999994 38.0 36.2 38.0 28.8 38.0 130-134 34.6837 38.0 36.0 38.0 27.6 38.0 135-139 34.1907 38.0 34.8 38.0 24.4 38.0 140-144 33.2923 38.0 33.2 38.0 17.8 38.0 145-149 32.141949999999994 38.0 33.0 38.0 10.8 38.0 150-151 27.797874999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 8.0 4 2.0 5 0.0 6 2.0 7 0.0 8 2.0 9 2.0 10 1.0 11 0.0 12 2.0 13 3.0 14 3.0 15 7.0 16 6.0 17 11.0 18 8.0 19 8.0 20 4.0 21 11.0 22 11.0 23 12.0 24 13.0 25 14.0 26 22.0 27 28.0 28 30.0 29 39.0 30 53.0 31 46.0 32 61.0 33 102.0 34 128.0 35 236.0 36 525.0 37 2590.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.800000000000004 21.275 10.674999999999999 23.25 2 25.99449587190393 24.993745308981737 31.623717788341253 17.38804103077308 3 20.981472208312468 27.94191286930396 31.99799699549324 19.078617926890335 4 23.13470205307962 34.60190285428143 23.43515272909364 18.828242363545318 5 24.887330996494743 36.47971957936905 21.657486229344016 16.975463194792187 6 19.950000000000003 36.7 23.549999999999997 19.8 7 19.525000000000002 20.225 40.1 20.150000000000002 8 21.075 24.5 28.675 25.75 9 21.3 24.325 30.55 23.825 10-14 23.965 28.605000000000004 25.924999999999997 21.505 15-19 23.105 27.77 28.505000000000003 20.62 20-24 23.7 28.075 27.474999999999998 20.75 25-29 24.545 27.965 27.38 20.11 30-34 23.544999999999998 27.565 28.09 20.8 35-39 23.885 27.88 27.73 20.505000000000003 40-44 23.93 27.52 28.175 20.375 45-49 23.435 27.63 28.175 20.76 50-54 23.685000000000002 27.49 27.615000000000002 21.21 55-59 23.785 27.939999999999998 27.49 20.785 60-64 23.47 28.18 27.400000000000002 20.95 65-69 23.400000000000002 27.71 27.595 21.295 70-74 23.830000000000002 27.32 27.85 21.0 75-79 23.669999999999998 27.389999999999997 27.705000000000002 21.235 80-84 23.595 27.445000000000004 27.625 21.335 85-89 23.68618430921546 28.431421571078552 27.456372818640933 20.426021301065052 90-94 23.853578036705507 27.914187128069212 27.74916237435615 20.48307246086913 95-99 23.482348234823483 27.912791279127912 27.597759775977597 21.007100710071008 100-104 24.095 28.12 27.49 20.294999999999998 105-109 24.224999999999998 28.27 27.105 20.4 110-114 23.895 28.27 27.43 20.405 115-119 24.195 28.544999999999998 26.685 20.575 120-124 24.715 27.839999999999996 26.71 20.735 125-129 24.69 28.15 26.995 20.165 130-134 24.77362549402171 27.975386462554404 27.660213117214465 19.590774926209413 135-139 25.78950002502377 27.746359041089036 26.905560282268155 19.558580651619035 140-144 25.785000000000004 28.470000000000002 26.529999999999998 19.215 145-149 26.155 27.605 26.96 19.28 150-151 26.7125 27.6875 26.437500000000004 19.162499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 2.5 24 3.5 25 5.0 26 6.5 27 7.0 28 6.5 29 10.0 30 19.5 31 21.5 32 26.5 33 37.5 34 56.0 35 69.5 36 74.0 37 96.0 38 121.5 39 140.0 40 160.5 41 204.0 42 243.5 43 255.0 44 263.5 45 255.5 46 255.5 47 261.0 48 244.5 49 210.5 50 176.0 51 141.0 52 125.5 53 117.0 54 93.0 55 75.5 56 54.5 57 43.5 58 37.0 59 24.5 60 18.0 61 13.0 62 7.0 63 4.5 64 2.5 65 2.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.15 4 0.15 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.015 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.055 135-139 0.095 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0126582278481 97.775 2 0.8101265822784811 1.6 3 0.10126582278481014 0.3 4 0.05063291139240507 0.2 5 0.025316455696202535 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.8375000000000004 0.0 0.0 0.0 0.0 110-111 3.1500000000000004 0.0 0.0 0.0 0.0 112-113 3.65 0.0 0.0 0.0 0.0 114-115 4.0625 0.0 0.0 0.0 0.0 116-117 4.5625 0.0 0.0 0.0 0.0 118-119 5.050000000000001 0.0 0.0 0.0 0.0 120-121 5.65 0.0 0.0 0.0 0.0 122-123 6.1625 0.0 0.0 0.0 0.0 124-125 6.75 0.0 0.0 0.0 0.0 126-127 7.324999999999999 0.0 0.0 0.0 0.0 128-129 7.975 0.0 0.0 0.0 0.0 130-131 8.6875 0.0 0.0 0.0 0.0 132-133 9.55 0.0 0.0 0.0 0.0 134-135 10.3625 0.0 0.0 0.0 0.0 136-137 11.05 0.0 0.0 0.0 0.0 138-139 11.662500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGAAA 10 0.00661466 146.54431 2 ATTTGAA 10 0.00661466 146.54431 1 AAAAAAA 60 0.0045515303 14.47125 35-39 >>END_MODULE Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra Read 740226 spots for SRR7172490.sra Written 740226 spots for SRR7172490.sra SRR ids: ['SRR7172490.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gytato9f SRR7172490.sra spots: 14804520 blocks: [[1, 740226], [740227, 1480452], [1480453, 2220678], [2220679, 2960904], [2960905, 3701130], [3701131, 4441356], [4441357, 5181582], [5181583, 5921808], [5921809, 6662034], [6662035, 7402260], [7402261, 8142486], [8142487, 8882712], [8882713, 9622938], [9622939, 10363164], [10363165, 11103390], [11103391, 11843616], [11843617, 12583842], [12583843, 13324068], [13324069, 14064294], [14064295, 14804520]] SRR7172490 file size 4995065 SRR7172490 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172490 SRR7172490_1.fastq SRR7172490_2.fastq Input file: SRR7172490_1.fastq Paired file: SRR7172490_2.fastq trimmed: SRR7172490-trimmed-pair1.fastq, SRR7172490-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:13:20 2025 >> started Mon Feb 10 12:13:37 2025 >> done (17.454s) 14804520 read pairs processed; of these: 21873 ( 0.15%) short read pairs filtered out after trimming by size control 67734 ( 0.46%) empty read pairs filtered out after trimming by size control 14714913 (99.39%) read pairs available; of these: 7843501 (53.30%) trimmed read pairs available after processing 6871412 (46.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 5 0.00% 21 7 0.00% 22 9 0.00% 23 5 0.00% 24 4 0.00% 25 14 0.00% 26 12 0.00% 27 11 0.00% 28 15 0.00% 29 18 0.00% 30 18 0.00% 31 14 0.00% 32 19 0.00% 33 19 0.00% 34 18 0.00% 35 21 0.00% 36 30 0.00% 37 36 0.00% 38 31 0.00% 39 30 0.00% 40 43 0.00% 41 45 0.00% 42 35 0.00% 43 51 0.00% 44 46 0.00% 45 59 0.00% 46 65 0.00% 47 77 0.00% 48 99 0.00% 49 99 0.00% 50 128 0.00% 51 158 0.00% 52 143 0.00% 53 162 0.00% 54 178 0.00% 55 204 0.00% 56 221 0.00% 57 238 0.00% 58 325 0.00% 59 294 0.00% 60 381 0.00% 61 424 0.00% 62 529 0.00% 63 538 0.00% 64 594 0.00% 65 669 0.00% 66 696 0.00% 67 886 0.01% 68 956 0.01% 69 1223 0.01% 70 1536 0.01% 71 1573 0.01% 72 1666 0.01% 73 1836 0.01% 74 2072 0.01% 75 2269 0.02% 76 2469 0.02% 77 2759 0.02% 78 3115 0.02% 79 3451 0.02% 80 3959 0.03% 81 4337 0.03% 82 5200 0.04% 83 5768 0.04% 84 7361 0.05% 85 8418 0.06% 86 8895 0.06% 87 9329 0.06% 88 10090 0.07% 89 10599 0.07% 90 11720 0.08% 91 12672 0.09% 92 14369 0.10% 93 15851 0.11% 94 16509 0.11% 95 17496 0.12% 96 18074 0.12% 97 19057 0.13% 98 19761 0.13% 99 20321 0.14% 100 21895 0.15% 101 23163 0.16% 102 25310 0.17% 103 26684 0.18% 104 28198 0.19% 105 29917 0.20% 106 30416 0.21% 107 31734 0.22% 108 32710 0.22% 109 34341 0.23% 110 35357 0.24% 111 36106 0.25% 112 38124 0.26% 113 40171 0.27% 114 41690 0.28% 115 43855 0.30% 116 45935 0.31% 117 46470 0.32% 118 47717 0.32% 119 48459 0.33% 120 50414 0.34% 121 50904 0.35% 122 52340 0.36% 123 55159 0.37% 124 57642 0.39% 125 59113 0.40% 126 61824 0.42% 127 62672 0.43% 128 64490 0.44% 129 66897 0.45% 130 67944 0.46% 131 69174 0.47% 132 71535 0.49% 133 74517 0.51% 134 77321 0.53% 135 81626 0.55% 136 84029 0.57% 137 87334 0.59% 138 91949 0.62% 139 96718 0.66% 140 100334 0.68% 141 107020 0.73% 142 113482 0.77% 143 124894 0.85% 144 140400 0.95% 145 162972 1.11% 146 196562 1.34% 147 251013 1.71% 148 361609 2.46% 149 678940 4.61% 150 3241971 22.03% 151 6871412 46.70% 14714913 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=14 prefix-density=0.61 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=60.43 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.6 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGA criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=26 prefix-density=0.52 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=39.53 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.1 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCT SRR7172490 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:14:24 Started mapping on | Feb 10 12:14:24 Finished on | Feb 10 12:16:27 Mapping speed, Million of reads per hour | 430.68 Number of input reads | 14714913 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13401933 Uniquely mapped reads % | 91.08% Average mapped length | 289.69 Number of splices: Total | 11743372 Number of splices: Annotated (sjdb) | 11457318 Number of splices: GT/AG | 11504769 Number of splices: GC/AG | 189889 Number of splices: AT/AC | 7132 Number of splices: Non-canonical | 41582 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368042 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 60556 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.87% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 963556 963556 963556 N_multimapping 368042 368042 368042 N_noFeature 598751 13117358 720401 N_ambiguous 254556 1299 90817 UnstrandedReadsAssigned:12548626 PositiveStrandReadsAssigned:283276 NegativeStrandReadsAssigned:12590715 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7172490 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172490-trimmed-pair1.fastq SRR7172490-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,714,913 reads, 12,635,195 reads pseudoaligned [quant] estimated average fragment length: 221.636 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR7172490.ke.tsv 34699 SRR7172490.se.tsv 87100 total ==> SRR7172490.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.36 324 12.3143 Potri.005G024800.1.v4.1 1035 814.364 211 17.6996 Potri.004G059700.1.v4.1 961 740.439 16 1.47615 Potri.007G009000.2.v4.1 1416 1195.36 0 0 Potri.003G141000.2.v4.1 2943 2722.36 515.746 12.9416 Potri.016G087400.1.v4.1 270 92.5689 844 622.841 Potri.015G069301.1.v4.1 564 347.99 0 0 Potri.010G195200.1.v4.1 1773 1552.36 17 0.748092 Potri.012G127500.1.v4.1 977 756.399 151 13.6372 ==> SRR7172490.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 834 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 307 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7172490 completed mapping pipeline successfully