Starting /dee2/code/volunteer_pipeline.sh SRR7172491 current disk space = 3058920951808 free memory = 1580114900 SRR7172491 SRAfilesize 15ebec957bfc93ceabcb568ee9086906 SRR7172491.sra SRR7172491.sra file validated SRR7172491 is paired end SRR7172491 is conventional basespace SRR7172491 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172491_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73875 34.0 33.0 34.0 33.0 34.0 2 33.40775 34.0 34.0 34.0 33.0 34.0 3 33.4575 34.0 34.0 34.0 33.0 34.0 4 33.558 34.0 34.0 34.0 33.0 34.0 5 33.50025 34.0 34.0 34.0 33.0 34.0 6 37.3165 38.0 38.0 38.0 36.0 38.0 7 37.4595 38.0 38.0 38.0 37.0 38.0 8 37.53075 38.0 38.0 38.0 38.0 38.0 9 37.623 38.0 38.0 38.0 38.0 38.0 10-14 37.5601 38.0 38.0 38.0 38.0 38.0 15-19 37.511 38.0 38.0 38.0 38.0 38.0 20-24 37.5599 38.0 38.0 38.0 38.0 38.0 25-29 37.51715 38.0 38.0 38.0 37.6 38.0 30-34 37.49595 38.0 38.0 38.0 38.0 38.0 35-39 37.379999999999995 38.0 38.0 38.0 37.2 38.0 40-44 37.1831 38.0 38.0 38.0 36.2 38.0 45-49 37.1553 38.0 38.0 38.0 36.0 38.0 50-54 37.0154 38.0 38.0 38.0 36.0 38.0 55-59 36.95405 38.0 38.0 38.0 35.6 38.0 60-64 37.00285 38.0 38.0 38.0 36.0 38.0 65-69 36.832 38.0 38.0 38.0 35.4 38.0 70-74 36.701499999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.60705 38.0 38.0 38.0 34.4 38.0 80-84 36.43915 38.0 38.0 38.0 34.0 38.0 85-89 36.3536 38.0 37.8 38.0 33.8 38.0 90-94 36.25535000000001 38.0 37.2 38.0 33.4 38.0 95-99 36.0433 38.0 37.0 38.0 32.6 38.0 100-104 35.8885 38.0 37.0 38.0 32.6 38.0 105-109 35.6102 38.0 36.6 38.0 30.6 38.0 110-114 35.26755 38.0 36.0 38.0 28.8 38.0 115-119 35.226549999999996 38.0 36.0 38.0 28.6 38.0 120-124 35.0186 38.0 35.4 38.0 28.2 38.0 125-129 34.742900000000006 38.0 35.0 38.0 27.6 38.0 130-134 34.101150000000004 38.0 34.4 38.0 24.0 38.0 135-139 33.49015 38.0 33.8 38.0 20.2 38.0 140-144 32.816649999999996 38.0 33.2 38.0 15.4 38.0 145-149 31.438049999999997 38.0 31.4 38.0 8.4 38.0 150-151 26.365625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 3.0 18 4.0 19 3.0 20 7.0 21 11.0 22 12.0 23 13.0 24 18.0 25 11.0 26 26.0 27 28.0 28 23.0 29 48.0 30 44.0 31 79.0 32 88.0 33 143.0 34 197.0 35 396.0 36 852.0 37 1986.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.90517683239364 12.762685802152744 9.892362890825218 42.43977447462839 2 21.25 20.674999999999997 35.775 22.3 3 19.075 25.025 25.374999999999996 30.525000000000002 4 22.775000000000002 32.925 21.55 22.75 5 21.425 36.95 23.875 17.75 6 18.675 35.675000000000004 25.775 19.875 7 13.725000000000001 23.95 42.75 19.575 8 18.475 23.95 30.775000000000002 26.8 9 18.175 23.474999999999998 33.0 25.35 10-14 20.4 29.14 26.474999999999998 23.985 15-19 19.61 28.08 28.04 24.27 20-24 20.645 28.89 27.51 22.955000000000002 25-29 19.965 28.994999999999997 27.92 23.119999999999997 30-34 20.02 28.725 27.48 23.775 35-39 19.785 28.634999999999998 27.639999999999997 23.94 40-44 20.195 28.744999999999997 27.32 23.74 45-49 19.645000000000003 29.080000000000002 27.685 23.59 50-54 20.055 28.63 27.884999999999998 23.43 55-59 19.89196218676537 28.459960986345223 27.939778922622914 23.70829790426649 60-64 20.05001250312578 28.377094273568392 28.047011752938232 23.52588147036759 65-69 20.390097524381094 28.29707426856714 27.786946736684172 23.52588147036759 70-74 20.081044574515982 28.425634098754315 27.79028465656111 23.703036670168594 75-79 20.17311252314004 28.31340371241307 27.517886626307096 23.99559713813979 80-84 20.44011002750688 28.272068017004255 27.886971742935735 23.400850212553138 85-89 20.277096983944382 28.47996798879608 27.609663382183765 23.633271645075776 90-94 20.19004751187797 28.367091772943237 27.73693423355839 23.705926481620406 95-99 20.650162540635158 28.442110527631908 27.871967991997998 23.035758939734936 100-104 21.06790772156333 28.118901065906023 27.398288545263473 23.414902667267175 105-109 20.58661594674408 28.499924921167224 27.453826517843737 23.459632614244956 110-114 20.655655655655654 29.224224224224226 27.3023023023023 22.81781781781782 115-119 21.386039529647235 28.741556167125342 26.99524643482612 22.8771578684013 120-124 20.815 28.645 27.38 23.16 125-129 20.86856456696853 28.513533796968026 27.74303297143143 22.87486866463201 130-134 20.39400944818575 28.82701779073274 27.555533219419036 23.223439541662476 135-139 20.61149448446079 28.182138719588977 27.723769707349017 23.48259708860122 140-144 20.666833792930557 28.598646277262475 27.02933065931311 23.70518927049386 145-149 20.962096209620963 28.95789578957896 27.19271927192719 22.887288728872885 150-151 20.625 28.475 27.224999999999998 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.5 22 1.5 23 3.0 24 2.0 25 3.5 26 5.5 27 5.0 28 8.5 29 15.0 30 20.0 31 29.5 32 34.0 33 40.5 34 55.5 35 75.5 36 93.5 37 116.0 38 140.0 39 157.5 40 198.5 41 231.0 42 251.5 43 259.5 44 253.0 45 261.0 46 263.0 47 235.0 48 212.5 49 201.0 50 176.0 51 131.0 52 103.0 53 91.5 54 74.0 55 71.0 56 54.0 57 34.5 58 26.0 59 22.0 60 17.0 61 8.0 62 4.5 63 3.0 64 2.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.034999999999999996 60-64 0.025 65-69 0.025 70-74 0.055 75-79 0.065 80-84 0.025 85-89 0.034999999999999996 90-94 0.025 95-99 0.025 100-104 0.08499999999999999 105-109 0.105 110-114 0.1 115-119 0.075 120-124 0.0 125-129 0.065 130-134 0.51 135-139 0.735 140-144 0.27499999999999997 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5285678328718851 1.05 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.037500000000000006 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.262499999999999 0.0 0.0 0.0 0.0 126-127 4.55 0.0 0.0 0.0 0.0 128-129 4.8125 0.0 0.0 0.0 0.0 130-131 5.262499999999999 0.0 0.0 0.0 0.0 132-133 5.6375 0.0 0.0 0.0 0.0 134-135 6.0125 0.0 0.0 0.0 0.0 136-137 6.475 0.0 0.0 0.0 0.0 138-139 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTGA 10 0.0063298983 148.6923 1 >>END_MODULE SRR7172491 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172491_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81925 33.0 33.0 34.0 32.0 34.0 2 32.8645 34.0 33.0 34.0 32.0 34.0 3 32.93925 34.0 33.0 34.0 32.0 34.0 4 32.97875 34.0 33.0 34.0 32.0 34.0 5 32.9785 34.0 33.0 34.0 32.0 34.0 6 37.06175 38.0 38.0 38.0 37.0 38.0 7 37.14475 38.0 38.0 38.0 37.0 38.0 8 37.0945 38.0 38.0 38.0 37.0 38.0 9 37.0295 38.0 38.0 38.0 37.0 38.0 10-14 37.11555 38.0 38.0 38.0 37.0 38.0 15-19 37.1138 38.0 38.0 38.0 37.0 38.0 20-24 37.0839 38.0 38.0 38.0 37.0 38.0 25-29 37.116049999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.04235 38.0 38.0 38.0 37.0 38.0 35-39 37.005199999999995 38.0 38.0 38.0 37.0 38.0 40-44 36.9809 38.0 38.0 38.0 37.0 38.0 45-49 37.015 38.0 38.0 38.0 37.0 38.0 50-54 36.93095 38.0 38.0 38.0 36.6 38.0 55-59 36.90895 38.0 38.0 38.0 36.6 38.0 60-64 36.883050000000004 38.0 38.0 38.0 36.2 38.0 65-69 36.77945 38.0 38.0 38.0 36.0 38.0 70-74 36.731500000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.63725 38.0 38.0 38.0 35.4 38.0 80-84 36.52065 38.0 38.0 38.0 35.0 38.0 85-89 36.29965 38.0 38.0 38.0 34.4 38.0 90-94 36.2125 38.0 38.0 38.0 34.0 38.0 95-99 36.134249999999994 38.0 38.0 38.0 34.0 38.0 100-104 35.98030000000001 38.0 38.0 38.0 33.6 38.0 105-109 35.8609 38.0 38.0 38.0 33.2 38.0 110-114 35.600100000000005 38.0 37.4 38.0 31.8 38.0 115-119 35.3432 38.0 37.0 38.0 30.2 38.0 120-124 35.2157 38.0 36.8 38.0 29.6 38.0 125-129 34.92545 38.0 36.0 38.0 28.0 38.0 130-134 34.46415 38.0 35.6 38.0 26.0 38.0 135-139 33.958200000000005 38.0 34.4 38.0 23.0 38.0 140-144 33.15035 38.0 33.4 38.0 15.8 38.0 145-149 32.1711 38.0 33.0 38.0 10.8 38.0 150-151 27.958125 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 3.0 5 1.0 6 2.0 7 1.0 8 2.0 9 0.0 10 4.0 11 1.0 12 3.0 13 6.0 14 5.0 15 8.0 16 3.0 17 6.0 18 7.0 19 11.0 20 11.0 21 15.0 22 4.0 23 8.0 24 12.0 25 12.0 26 28.0 27 18.0 28 43.0 29 36.0 30 46.0 31 50.0 32 70.0 33 96.0 34 137.0 35 248.0 36 570.0 37 2520.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.925 19.45 14.95 30.675 2 24.4 27.900000000000002 33.525 14.174999999999999 3 21.275 27.675 29.5 21.55 4 22.525000000000002 35.325 23.45 18.7 5 23.5 36.475 23.575 16.45 6 19.35 36.675000000000004 24.975 19.0 7 17.575 18.35 42.575 21.5 8 19.35 23.724999999999998 29.725 27.200000000000003 9 21.85 24.025 30.349999999999998 23.775 10-14 22.355 29.409999999999997 26.44 21.795 15-19 22.06 28.02 28.515 21.404999999999998 20-24 22.485 28.255000000000003 28.185 21.075 25-29 22.21 28.825 28.199999999999996 20.765 30-34 22.305 28.055000000000003 28.854999999999997 20.785 35-39 22.065 28.110000000000003 28.835 20.990000000000002 40-44 22.61 27.71 28.744999999999997 20.935000000000002 45-49 22.725 27.810000000000002 28.875 20.59 50-54 22.225 28.384999999999998 28.315 21.075 55-59 22.3 28.275 28.305000000000003 21.12 60-64 22.634999999999998 27.925 28.345 21.095 65-69 22.62 27.435 28.52 21.425 70-74 22.939999999999998 28.01 28.000000000000004 21.05 75-79 22.785 28.189999999999998 28.18 20.845 80-84 22.945 28.384999999999998 27.58 21.09 85-89 22.725 28.139999999999997 27.93 21.205 90-94 23.48 27.785 27.505000000000003 21.23 95-99 23.1 27.375 28.384999999999998 21.14 100-104 22.634999999999998 27.575 28.605000000000004 21.185000000000002 105-109 23.51 27.779999999999998 27.99 20.72 110-114 23.76 28.084999999999997 27.905 20.25 115-119 23.65 28.525 27.38 20.445 120-124 23.919999999999998 28.02 27.779999999999998 20.28 125-129 24.145 27.875 27.3 20.68 130-134 24.18071746635313 27.337769550207636 28.098263871516487 20.383249111922748 135-139 24.779647435897438 27.428886217948715 27.669270833333332 20.12219551282051 140-144 24.41 28.349999999999998 27.16 20.080000000000002 145-149 24.82 28.025 27.41 19.744999999999997 150-151 24.625 28.1 27.737499999999997 19.537499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.5 24 5.5 25 5.0 26 5.0 27 7.5 28 10.0 29 11.5 30 16.5 31 25.5 32 34.5 33 34.5 34 48.0 35 85.5 36 99.0 37 116.5 38 157.0 39 192.5 40 213.0 41 211.5 42 235.0 43 278.5 44 273.5 45 264.0 46 262.5 47 244.5 48 222.0 49 186.0 50 157.5 51 126.5 52 94.5 53 77.5 54 72.5 55 63.0 56 46.0 57 35.0 58 25.0 59 16.5 60 8.0 61 6.0 62 6.0 63 4.5 64 3.0 65 0.5 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.065 135-139 0.16 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34442763489663 98.5 2 0.529500756429652 1.05 3 0.07564296520423601 0.22499999999999998 4 0.02521432173474534 0.1 5 0.02521432173474534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.037500000000000006 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.3499999999999996 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.0999999999999996 0.0 0.0 0.0 0.0 118-119 3.2875 0.0 0.0 0.0 0.0 120-121 3.5625 0.0 0.0 0.0 0.0 122-123 3.925 0.0 0.0 0.0 0.0 124-125 4.175000000000001 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 4.737500000000001 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.55 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.375 0.0 0.0 0.0 0.0 138-139 6.887499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686327 spots for SRR7172491.sra Written 686327 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra Read 686321 spots for SRR7172491.sra Written 686321 spots for SRR7172491.sra SRR ids: ['SRR7172491.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gfjzv9zw SRR7172491.sra spots: 13726426 blocks: [[1, 686321], [686322, 1372642], [1372643, 2058963], [2058964, 2745284], [2745285, 3431605], [3431606, 4117926], [4117927, 4804247], [4804248, 5490568], [5490569, 6176889], [6176890, 6863210], [6863211, 7549531], [7549532, 8235852], [8235853, 8922173], [8922174, 9608494], [9608495, 10294815], [10294816, 10981136], [10981137, 11667457], [11667458, 12353778], [12353779, 13040099], [13040100, 13726426]] SRR7172491 file size 4629734 SRR7172491 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172491 SRR7172491_1.fastq SRR7172491_2.fastq Input file: SRR7172491_1.fastq Paired file: SRR7172491_2.fastq trimmed: SRR7172491-trimmed-pair1.fastq, SRR7172491-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:19:14 2025 >> started Mon Feb 10 13:19:29 2025 >> done (15.175s) 13726426 read pairs processed; of these: 16124 ( 0.12%) short read pairs filtered out after trimming by size control 54544 ( 0.40%) empty read pairs filtered out after trimming by size control 13655758 (99.49%) read pairs available; of these: 7133360 (52.24%) trimmed read pairs available after processing 6522398 (47.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 2 0.00% 21 2 0.00% 22 5 0.00% 23 5 0.00% 24 7 0.00% 25 6 0.00% 26 9 0.00% 27 9 0.00% 28 4 0.00% 29 12 0.00% 30 8 0.00% 31 7 0.00% 32 10 0.00% 33 13 0.00% 34 17 0.00% 35 17 0.00% 36 17 0.00% 37 20 0.00% 38 22 0.00% 39 20 0.00% 40 18 0.00% 41 30 0.00% 42 37 0.00% 43 38 0.00% 44 42 0.00% 45 53 0.00% 46 53 0.00% 47 51 0.00% 48 69 0.00% 49 66 0.00% 50 78 0.00% 51 112 0.00% 52 117 0.00% 53 121 0.00% 54 129 0.00% 55 154 0.00% 56 176 0.00% 57 178 0.00% 58 218 0.00% 59 284 0.00% 60 266 0.00% 61 322 0.00% 62 408 0.00% 63 397 0.00% 64 439 0.00% 65 531 0.00% 66 609 0.00% 67 703 0.01% 68 769 0.01% 69 934 0.01% 70 1153 0.01% 71 1127 0.01% 72 1285 0.01% 73 1437 0.01% 74 1605 0.01% 75 1865 0.01% 76 1992 0.01% 77 2138 0.02% 78 2454 0.02% 79 2821 0.02% 80 3129 0.02% 81 3449 0.03% 82 3945 0.03% 83 4390 0.03% 84 5542 0.04% 85 6249 0.05% 86 6523 0.05% 87 6930 0.05% 88 7357 0.05% 89 7992 0.06% 90 8386 0.06% 91 9183 0.07% 92 10452 0.08% 93 10633 0.08% 94 10936 0.08% 95 12019 0.09% 96 11988 0.09% 97 12426 0.09% 98 13040 0.10% 99 13728 0.10% 100 14597 0.11% 101 15418 0.11% 102 16636 0.12% 103 17418 0.13% 104 17684 0.13% 105 18294 0.13% 106 18857 0.14% 107 19494 0.14% 108 20175 0.15% 109 21259 0.16% 110 22057 0.16% 111 23032 0.17% 112 23990 0.18% 113 24765 0.18% 114 26030 0.19% 115 27335 0.20% 116 28284 0.21% 117 29199 0.21% 118 30236 0.22% 119 30933 0.23% 120 31845 0.23% 121 32832 0.24% 122 34126 0.25% 123 35806 0.26% 124 37444 0.27% 125 38759 0.28% 126 40226 0.29% 127 41753 0.31% 128 43083 0.32% 129 44992 0.33% 130 46301 0.34% 131 48330 0.35% 132 50363 0.37% 133 53407 0.39% 134 55984 0.41% 135 59742 0.44% 136 63012 0.46% 137 67037 0.49% 138 70949 0.52% 139 76539 0.56% 140 81903 0.60% 141 89495 0.66% 142 98510 0.72% 143 110617 0.81% 144 129746 0.95% 145 155728 1.14% 146 195629 1.43% 147 259798 1.90% 148 384500 2.82% 149 736871 5.40% 150 3278545 24.01% 151 6522398 47.76% 13655758 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=18 prefix-density=0.37 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=472.02 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=19.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=25 prefix-density=0.77 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=52.26 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.9 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR7172491 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:20:14 Started mapping on | Feb 10 13:20:14 Finished on | Feb 10 13:21:44 Mapping speed, Million of reads per hour | 546.23 Number of input reads | 13655758 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12847335 Uniquely mapped reads % | 94.08% Average mapped length | 292.25 Number of splices: Total | 12114098 Number of splices: Annotated (sjdb) | 11837111 Number of splices: GT/AG | 11871370 Number of splices: GC/AG | 197597 Number of splices: AT/AC | 7177 Number of splices: Non-canonical | 37954 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390844 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 33135 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 432365 432365 432365 N_multimapping 390844 390844 390844 N_noFeature 537852 12623027 646560 N_ambiguous 200395 865 84174 UnstrandedReadsAssigned:12109088 PositiveStrandReadsAssigned:223443 NegativeStrandReadsAssigned:12116601 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172491 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172491-trimmed-pair1.fastq SRR7172491-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,655,758 reads, 12,114,473 reads pseudoaligned [quant] estimated average fragment length: 252.343 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,010 rounds 52401 SRR7172491.ke.tsv 34699 SRR7172491.se.tsv 87100 total ==> SRR7172491.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.66 505 22.7954 Potri.005G024800.1.v4.1 1035 783.657 143 14.5518 Potri.004G059700.1.v4.1 961 709.829 5 0.561725 Potri.007G009000.2.v4.1 1416 1164.66 0 0 Potri.003G141000.2.v4.1 2943 2691.66 780 23.1091 Potri.016G087400.1.v4.1 270 84.5771 573 540.268 Potri.015G069301.1.v4.1 564 324.265 0 0 Potri.010G195200.1.v4.1 1773 1521.66 18 0.943329 Potri.012G127500.1.v4.1 977 725.744 170 18.6798 ==> SRR7172491.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 903 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 219 Potri.001G212900.v4.1 34 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7172491 completed mapping pipeline successfully