Starting /dee2/code/volunteer_pipeline.sh SRR7172492 current disk space = 3058758168576 free memory = 1568706352 SRR7172492 SRAfilesize cf2f4f026ad573bcf7689976e9015c4e SRR7172492.sra SRR7172492.sra file validated SRR7172492 is paired end SRR7172492 is conventional basespace SRR7172492 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172492_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7835 34.0 33.0 34.0 33.0 34.0 2 33.435 34.0 34.0 34.0 33.0 34.0 3 33.461 34.0 34.0 34.0 33.0 34.0 4 33.51675 34.0 34.0 34.0 33.0 34.0 5 33.508 34.0 34.0 34.0 33.0 34.0 6 37.16925 38.0 38.0 38.0 36.0 38.0 7 37.50325 38.0 38.0 38.0 37.0 38.0 8 37.55025 38.0 38.0 38.0 38.0 38.0 9 37.56625 38.0 38.0 38.0 38.0 38.0 10-14 37.58475 38.0 38.0 38.0 38.0 38.0 15-19 37.56045 38.0 38.0 38.0 37.8 38.0 20-24 37.5708 38.0 38.0 38.0 38.0 38.0 25-29 37.545500000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.49465 38.0 38.0 38.0 38.0 38.0 35-39 37.4254 38.0 38.0 38.0 37.6 38.0 40-44 37.2559 38.0 38.0 38.0 37.0 38.0 45-49 37.208 38.0 38.0 38.0 36.4 38.0 50-54 37.09455 38.0 38.0 38.0 36.0 38.0 55-59 37.11905 38.0 38.0 38.0 36.0 38.0 60-64 37.04905 38.0 38.0 38.0 36.0 38.0 65-69 36.93145 38.0 38.0 38.0 35.4 38.0 70-74 36.78485 38.0 38.0 38.0 34.8 38.0 75-79 36.67425000000001 38.0 38.0 38.0 34.4 38.0 80-84 36.610699999999994 38.0 38.0 38.0 34.2 38.0 85-89 36.372 38.0 38.0 38.0 34.0 38.0 90-94 36.2924 38.0 38.0 38.0 34.0 38.0 95-99 36.2071 38.0 37.4 38.0 33.8 38.0 100-104 35.922250000000005 38.0 37.0 38.0 32.6 38.0 105-109 35.8149 38.0 37.0 38.0 32.0 38.0 110-114 35.43575 38.0 36.4 38.0 29.4 38.0 115-119 35.50515 38.0 36.2 38.0 30.6 38.0 120-124 35.03315 38.0 35.8 38.0 28.2 38.0 125-129 34.621300000000005 38.0 35.0 38.0 26.4 38.0 130-134 34.408049999999996 38.0 35.0 38.0 25.2 38.0 135-139 33.73695 38.0 34.2 38.0 22.2 38.0 140-144 33.122 38.0 33.2 38.0 18.6 38.0 145-149 32.0835 38.0 32.2 38.0 10.8 38.0 150-151 27.528624999999998 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 2.0 17 4.0 18 4.0 19 4.0 20 7.0 21 7.0 22 9.0 23 13.0 24 13.0 25 22.0 26 27.0 27 35.0 28 39.0 29 36.0 30 48.0 31 60.0 32 84.0 33 107.0 34 169.0 35 315.0 36 756.0 37 2235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.66683699540113 15.099642309657641 9.32549821154829 39.90802248339295 2 21.175 20.275000000000002 35.275 23.275000000000002 3 19.05 25.0 26.875 29.075 4 21.625 34.949999999999996 21.675 21.75 5 19.900000000000002 36.725 25.525 17.849999999999998 6 17.724999999999998 36.725 25.974999999999998 19.575 7 14.2 22.225 43.974999999999994 19.6 8 17.675 22.7 31.175000000000004 28.449999999999996 9 16.950000000000003 23.925 32.975 26.150000000000002 10-14 19.955000000000002 29.685 26.88 23.48 15-19 19.93 28.525 27.91 23.635 20-24 20.005 28.275 27.54 24.18 25-29 19.814999999999998 29.134999999999998 27.92 23.13 30-34 19.759999999999998 28.4 27.944999999999997 23.895 35-39 20.26 28.33 27.96 23.45 40-44 20.105 28.64 27.765 23.49 45-49 19.38 28.65 27.644999999999996 24.325 50-54 20.244999999999997 28.71 27.875 23.169999999999998 55-59 19.689999999999998 29.005 27.644999999999996 23.66 60-64 19.400000000000002 28.845 28.050000000000004 23.705000000000002 65-69 20.49 28.225 28.585 22.7 70-74 20.044999999999998 28.725 27.68 23.549999999999997 75-79 20.07 28.970000000000002 27.62 23.34 80-84 20.085 27.99 28.235 23.69 85-89 20.23 28.455000000000002 27.525 23.79 90-94 20.405 28.665000000000003 27.450000000000003 23.48 95-99 19.88 29.075 27.889999999999997 23.155 100-104 20.435544430538172 29.131414267834792 27.669586983729662 22.763454317897374 105-109 20.16306522609044 28.416366546618647 28.096238495398158 23.324329731892757 110-114 20.73286881547947 28.5678480124317 26.998847060003005 23.700436112085818 115-119 20.49909981996399 28.790758151630325 27.725545109021805 22.984596919383876 120-124 20.69 28.645 27.6 23.064999999999998 125-129 20.86 28.725 27.58 22.835 130-134 20.830000000000002 28.465 27.605 23.1 135-139 20.265 28.720000000000002 26.97 24.044999999999998 140-144 20.52 28.335 27.455000000000002 23.69 145-149 20.77 29.185 26.575 23.47 150-151 21.349999999999998 28.725 26.5 23.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 2.0 22 2.0 23 3.0 24 4.0 25 3.0 26 9.5 27 11.0 28 12.5 29 17.0 30 21.5 31 33.5 32 42.5 33 48.0 34 61.0 35 81.0 36 96.0 37 113.0 38 143.5 39 169.0 40 190.0 41 218.5 42 231.5 43 252.5 44 278.0 45 268.5 46 252.5 47 242.5 48 217.0 49 196.5 50 174.0 51 128.5 52 98.5 53 88.0 54 71.5 55 58.0 56 42.5 57 29.5 58 22.0 59 16.5 60 14.0 61 9.0 62 7.5 63 5.0 64 3.5 65 2.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.125 105-109 0.04 110-114 0.255 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4249999999999998 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.2249999999999996 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 2.9000000000000004 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.1125 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.95 0.0 0.0 0.0 0.0 132-133 5.325 0.0 0.0 0.0 0.0 134-135 5.6625 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATGCA 10 0.006832588 144.9875 6 >>END_MODULE SRR7172492 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172492_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.606 33.0 33.0 34.0 32.0 34.0 2 32.717 34.0 33.0 34.0 32.0 34.0 3 32.7265 34.0 33.0 34.0 32.0 34.0 4 32.6155 34.0 33.0 34.0 32.0 34.0 5 32.604 34.0 33.0 34.0 32.0 34.0 6 36.75375 38.0 38.0 38.0 36.0 38.0 7 36.82775 38.0 38.0 38.0 36.0 38.0 8 36.79325 38.0 38.0 38.0 36.0 38.0 9 36.67675 38.0 38.0 38.0 36.0 38.0 10-14 36.7961 38.0 38.0 38.0 36.6 38.0 15-19 36.786 38.0 38.0 38.0 36.6 38.0 20-24 36.802600000000005 38.0 38.0 38.0 36.6 38.0 25-29 36.761199999999995 38.0 38.0 38.0 36.4 38.0 30-34 36.725049999999996 38.0 38.0 38.0 36.4 38.0 35-39 36.637550000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.700599999999994 38.0 38.0 38.0 36.2 38.0 45-49 36.657650000000004 38.0 38.0 38.0 36.2 38.0 50-54 36.6666 38.0 38.0 38.0 36.0 38.0 55-59 36.601549999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.5334 38.0 38.0 38.0 36.0 38.0 65-69 36.489850000000004 38.0 38.0 38.0 35.4 38.0 70-74 36.44725 38.0 38.0 38.0 35.4 38.0 75-79 36.28905 38.0 38.0 38.0 34.6 38.0 80-84 36.20190000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.13345 38.0 38.0 38.0 34.0 38.0 90-94 35.919349999999994 38.0 38.0 38.0 33.2 38.0 95-99 35.72475 38.0 38.0 38.0 32.6 38.0 100-104 35.60325 38.0 38.0 38.0 31.8 38.0 105-109 35.47745 38.0 37.6 38.0 31.0 38.0 110-114 35.315149999999996 38.0 37.2 38.0 30.6 38.0 115-119 35.1271 38.0 36.8 38.0 29.6 38.0 120-124 34.72044999999999 38.0 36.0 38.0 27.0 38.0 125-129 34.56275000000001 38.0 36.0 38.0 26.4 38.0 130-134 34.052600000000005 38.0 35.2 38.0 23.0 38.0 135-139 33.59075 38.0 33.8 38.0 19.8 38.0 140-144 32.87825 38.0 33.0 38.0 14.2 38.0 145-149 32.0309 38.0 32.8 38.0 10.8 38.0 150-151 27.360500000000002 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 4.0 4 1.0 5 0.0 6 5.0 7 2.0 8 1.0 9 2.0 10 0.0 11 6.0 12 3.0 13 4.0 14 2.0 15 6.0 16 6.0 17 8.0 18 9.0 19 8.0 20 7.0 21 12.0 22 15.0 23 18.0 24 12.0 25 19.0 26 14.0 27 24.0 28 39.0 29 46.0 30 43.0 31 51.0 32 67.0 33 97.0 34 139.0 35 256.0 36 581.0 37 2456.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.029233870967744 19.884072580645164 12.348790322580646 29.73790322580645 2 24.35089488278296 26.039828585833124 33.65263423241744 15.956642298966472 3 20.468868162339298 28.686664986135618 30.72851020922612 20.115956642298965 4 21.93093017393496 35.77010335265944 24.32568691706579 17.9732795563398 5 23.191328459793294 37.8371565414671 23.01487269977313 15.956642298966472 6 18.131453034500126 38.42860740367666 24.452279022916144 18.987660538907075 7 17.515120967741936 18.901209677419356 43.069556451612904 20.514112903225808 8 20.0050390526581 24.54018644494835 27.739984882842027 27.71478961955152 9 20.65491183879093 24.911838790931988 30.151133501259448 24.28211586901763 10-14 22.853688029020557 28.48649738008867 27.01531640467553 21.644498186215237 15-19 23.004836759371223 27.554413542926238 28.093510681176948 21.34723901652559 20-24 22.484759937528338 28.167665877374176 28.419567736409896 20.92800644868759 25-29 22.424822444970534 28.19724978592656 28.544804311690932 20.83312345741198 30-34 21.887590652699433 28.06708299758259 28.77215954875101 21.273166800966962 35-39 22.194237356437636 28.385049365303246 28.138222849083217 21.2824904291759 40-44 22.200947294165072 28.045953844603446 28.695958883402195 21.057139977829287 45-49 22.12478580788227 28.228001209555487 28.399354903739543 21.2478580788227 50-54 22.647785113138134 27.55631708914983 28.559189638663508 21.236708159048533 55-59 22.98624754420432 27.731600423152486 28.22527832351015 21.056873709133043 60-64 22.68674759482194 27.56762202186068 28.892358837455294 20.853271545862086 65-69 23.06141986194387 27.69688114072656 27.802690582959645 21.43900841436993 70-74 23.33350128482894 27.948808384138662 28.21585126215549 20.501839068876908 75-79 22.69521410579345 27.309823677581864 28.362720403022667 21.632241813602015 80-84 23.519629088343496 27.485763241445344 27.74782039006199 21.24678728014917 85-89 23.56408706166868 28.02801289802499 28.179161628375653 20.22873841193067 90-94 23.135456561177183 27.706107639588794 28.210038298730094 20.948397500503933 95-99 24.131848193135426 27.72037699712716 27.8362985736606 20.31147623607681 100-104 23.488208022576092 28.05381979439629 27.50453537593227 20.953436807095343 105-109 23.697470523027313 27.320366824549026 28.499445732137456 20.482716920286204 110-114 24.236621989317747 27.542073969565656 28.00564345460042 20.215660586516172 115-119 23.910304862685816 28.581506676744773 27.180650037792898 20.327538422776517 120-124 23.977226924627164 28.189238210399033 28.05824264409512 19.77529222087868 125-129 23.88390607679129 27.985488259598913 28.035876247102692 20.094729416507104 130-134 24.478589420654913 28.04534005037783 28.161209068010074 19.31486146095718 135-139 24.62344466273739 27.585512064883382 27.63084983124276 20.160193441136467 140-144 24.274486094316806 28.174123337363966 27.85671100362757 19.694679564691654 145-149 24.43559766176174 28.32090304374118 27.519653295706508 19.723845998790566 150-151 26.042585359707697 27.428499433035153 27.453697870732015 19.075217336525135 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 29.0 1 14.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 2.5 24 4.5 25 7.0 26 8.5 27 10.5 28 14.5 29 12.0 30 17.0 31 25.0 32 35.0 33 49.5 34 59.0 35 71.5 36 86.0 37 110.5 38 138.5 39 170.5 40 191.5 41 201.5 42 231.5 43 272.0 44 278.5 45 253.5 46 264.0 47 259.5 48 224.0 49 200.0 50 156.0 51 131.0 52 120.5 53 86.5 54 69.5 55 53.5 56 32.5 57 32.0 58 30.0 59 17.5 60 9.5 61 9.5 62 7.0 63 3.5 64 3.0 65 2.0 66 1.5 67 1.5 68 1.0 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.8250000000000001 3 0.8250000000000001 4 0.8250000000000001 5 0.8250000000000001 6 0.7250000000000001 7 0.8 8 0.775 9 0.75 10-14 0.76 15-19 0.76 20-24 0.755 25-29 0.735 30-34 0.72 35-39 0.74 40-44 0.77 45-49 0.79 50-54 0.7849999999999999 55-59 0.745 60-64 0.735 65-69 0.765 70-74 0.765 75-79 0.75 80-84 0.7849999999999999 85-89 0.76 90-94 0.7799999999999999 95-99 0.795 100-104 0.7799999999999999 105-109 0.77 110-114 0.77 115-119 0.775 120-124 0.76 125-129 0.77 130-134 0.75 135-139 0.745 140-144 0.76 145-149 0.7799999999999999 150-151 0.7875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.33959867919737 97.775 2 0.40640081280162554 0.8 3 0.17780035560071122 0.525 4 0.05080010160020319 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025400050800101596 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 28 0.7000000000000001 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.025 0.0 72-73 0.075 0.0 0.0 0.025 0.0 74-75 0.075 0.0 0.0 0.025 0.0 76-77 0.0875 0.0 0.0 0.025 0.0 78-79 0.1 0.0 0.0 0.025 0.0 80-81 0.125 0.0 0.0 0.025 0.0 82-83 0.15 0.0 0.0 0.025 0.0 84-85 0.21250000000000002 0.0 0.0 0.025 0.0 86-87 0.30000000000000004 0.0 0.0 0.025 0.0 88-89 0.3375 0.0 0.0 0.025 0.0 90-91 0.4 0.0 0.0 0.025 0.0 92-93 0.4625 0.0 0.0 0.025 0.0 94-95 0.575 0.0 0.0 0.025 0.0 96-97 0.7 0.0 0.0 0.025 0.0 98-99 0.7375 0.0 0.0 0.025 0.0 100-101 0.8 0.0 0.0 0.025 0.0 102-103 1.0375 0.0 0.0 0.025 0.0 104-105 1.275 0.0 0.0 0.025 0.0 106-107 1.4500000000000002 0.0 0.0 0.025 0.0 108-109 1.65 0.0 0.0 0.025 0.0 110-111 2.025 0.0 0.0 0.025 0.0 112-113 2.2249999999999996 0.0 0.0 0.025 0.0 114-115 2.5125 0.0 0.0 0.025 0.0 116-117 2.7750000000000004 0.0 0.0 0.025 0.0 118-119 2.925 0.0 0.0 0.025 0.0 120-121 3.275 0.0 0.0 0.025 0.0 122-123 3.5875 0.0 0.0 0.025 0.0 124-125 3.875 0.0 0.0 0.025 0.0 126-127 4.0875 0.0 0.0 0.025 0.0 128-129 4.449999999999999 0.0 0.0 0.025 0.0 130-131 4.925 0.0 0.0 0.025 0.0 132-133 5.3 0.0 0.0 0.025 0.0 134-135 5.625 0.0 0.0 0.025 0.0 136-137 5.9375 0.0 0.0 0.025 0.0 138-139 6.5 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAACAA 10 0.006830828 145.0 8 >>END_MODULE Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878233 spots for SRR7172492.sra Written 878233 spots for SRR7172492.sra Read 878247 spots for SRR7172492.sra Written 878247 spots for SRR7172492.sra SRR ids: ['SRR7172492.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_namrecd0 SRR7172492.sra spots: 17564674 blocks: [[1, 878233], [878234, 1756466], [1756467, 2634699], [2634700, 3512932], [3512933, 4391165], [4391166, 5269398], [5269399, 6147631], [6147632, 7025864], [7025865, 7904097], [7904098, 8782330], [8782331, 9660563], [9660564, 10538796], [10538797, 11417029], [11417030, 12295262], [12295263, 13173495], [13173496, 14051728], [14051729, 14929961], [14929962, 15808194], [15808195, 16686427], [16686428, 17564674]] SRR7172492 file size 5930391 SRR7172492 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172492 SRR7172492_1.fastq SRR7172492_2.fastq Input file: SRR7172492_1.fastq Paired file: SRR7172492_2.fastq trimmed: SRR7172492-trimmed-pair1.fastq, SRR7172492-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:18:14 2025 >> started Mon Feb 10 12:18:33 2025 >> done (19.704s) 17564674 read pairs processed; of these: 20763 ( 0.12%) short read pairs filtered out after trimming by size control 118742 ( 0.68%) empty read pairs filtered out after trimming by size control 17425169 (99.21%) read pairs available; of these: 9108703 (52.27%) trimmed read pairs available after processing 8316466 (47.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 9 0.00% 21 3 0.00% 22 6 0.00% 23 7 0.00% 24 5 0.00% 25 4 0.00% 26 7 0.00% 27 9 0.00% 28 7 0.00% 29 18 0.00% 30 10 0.00% 31 13 0.00% 32 13 0.00% 33 11 0.00% 34 11 0.00% 35 7 0.00% 36 17 0.00% 37 16 0.00% 38 13 0.00% 39 19 0.00% 40 28 0.00% 41 28 0.00% 42 40 0.00% 43 27 0.00% 44 32 0.00% 45 45 0.00% 46 56 0.00% 47 60 0.00% 48 58 0.00% 49 81 0.00% 50 88 0.00% 51 127 0.00% 52 122 0.00% 53 115 0.00% 54 121 0.00% 55 145 0.00% 56 160 0.00% 57 195 0.00% 58 200 0.00% 59 237 0.00% 60 276 0.00% 61 338 0.00% 62 390 0.00% 63 402 0.00% 64 450 0.00% 65 507 0.00% 66 578 0.00% 67 674 0.00% 68 801 0.00% 69 908 0.01% 70 1056 0.01% 71 1094 0.01% 72 1246 0.01% 73 1416 0.01% 74 1541 0.01% 75 1768 0.01% 76 1965 0.01% 77 2014 0.01% 78 2350 0.01% 79 2579 0.01% 80 2877 0.02% 81 3280 0.02% 82 3802 0.02% 83 4248 0.02% 84 5365 0.03% 85 6129 0.04% 86 6493 0.04% 87 6768 0.04% 88 7299 0.04% 89 7860 0.05% 90 8532 0.05% 91 9209 0.05% 92 9954 0.06% 93 11219 0.06% 94 11834 0.07% 95 12253 0.07% 96 12570 0.07% 97 13258 0.08% 98 13794 0.08% 99 14557 0.08% 100 15564 0.09% 101 16442 0.09% 102 17466 0.10% 103 18494 0.11% 104 19326 0.11% 105 20736 0.12% 106 21369 0.12% 107 22159 0.13% 108 23333 0.13% 109 23917 0.14% 110 25322 0.15% 111 26350 0.15% 112 27752 0.16% 113 29314 0.17% 114 30728 0.18% 115 32283 0.19% 116 33377 0.19% 117 34649 0.20% 118 36111 0.21% 119 36662 0.21% 120 38382 0.22% 121 39728 0.23% 122 41282 0.24% 123 43843 0.25% 124 46044 0.26% 125 47806 0.27% 126 50190 0.29% 127 51878 0.30% 128 54027 0.31% 129 56038 0.32% 130 58755 0.34% 131 60628 0.35% 132 64044 0.37% 133 67973 0.39% 134 71661 0.41% 135 75925 0.44% 136 81037 0.47% 137 86604 0.50% 138 91959 0.53% 139 98376 0.56% 140 106168 0.61% 141 116355 0.67% 142 128519 0.74% 143 146774 0.84% 144 172013 0.99% 145 203125 1.17% 146 252590 1.45% 147 339732 1.95% 148 505601 2.90% 149 975176 5.60% 150 4229279 24.27% 151 8316466 47.73% 17425169 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=19 prefix-density=0.65 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=402.76 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=25 prefix-density=0.75 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=48.88 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=15.3 sequence=AAAGAAAAGAAAA SRR7172492 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:19:18 Started mapping on | Feb 10 12:19:19 Finished on | Feb 10 12:21:23 Mapping speed, Million of reads per hour | 505.89 Number of input reads | 17425169 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16415850 Uniquely mapped reads % | 94.21% Average mapped length | 292.85 Number of splices: Total | 15736217 Number of splices: Annotated (sjdb) | 15362066 Number of splices: GT/AG | 15440629 Number of splices: GC/AG | 233237 Number of splices: AT/AC | 9003 Number of splices: Non-canonical | 53348 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 445621 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 16483 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 580627 580627 580627 N_multimapping 445621 445621 445621 N_noFeature 720700 16131308 837139 N_ambiguous 275714 1072 106963 UnstrandedReadsAssigned:15419436 PositiveStrandReadsAssigned:283470 NegativeStrandReadsAssigned:15471748 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172492 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172492-trimmed-pair1.fastq SRR7172492-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,425,169 reads, 15,356,451 reads pseudoaligned [quant] estimated average fragment length: 246.694 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 959 rounds 52401 SRR7172492.ke.tsv 34699 SRR7172492.se.tsv 87100 total ==> SRR7172492.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.31 556 18.3861 Potri.005G024800.1.v4.1 1035 789.306 156 11.5833 Potri.004G059700.1.v4.1 961 715.422 22 1.80225 Potri.007G009000.2.v4.1 1416 1170.31 0 0 Potri.003G141000.2.v4.1 2943 2697.31 1131 24.5746 Potri.016G087400.1.v4.1 270 82.0677 1100 785.551 Potri.015G069301.1.v4.1 564 326.611 0 0 Potri.010G195200.1.v4.1 1773 1527.31 66 2.53263 Potri.012G127500.1.v4.1 977 731.359 147 11.7799 ==> SRR7172492.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1275 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 278 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 41 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR7172492 completed mapping pipeline successfully