Starting /dee2/code/volunteer_pipeline.sh SRR7172493 current disk space = 3058724012032 free memory = 1574041456 SRR7172493 SRAfilesize 8ac0d2963d710532068c5c3226fe6709 SRR7172493.sra SRR7172493.sra file validated SRR7172493 is paired end SRR7172493 is conventional basespace SRR7172493 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172493_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77875 34.0 33.0 34.0 33.0 34.0 2 33.34125 34.0 33.0 34.0 33.0 34.0 3 33.388 34.0 34.0 34.0 33.0 34.0 4 33.47475 34.0 34.0 34.0 33.0 34.0 5 33.51 34.0 34.0 34.0 33.0 34.0 6 37.1975 38.0 38.0 38.0 36.0 38.0 7 37.37375 38.0 38.0 38.0 37.0 38.0 8 37.50425 38.0 38.0 38.0 37.0 38.0 9 37.4265 38.0 38.0 38.0 37.0 38.0 10-14 37.44545 38.0 38.0 38.0 37.4 38.0 15-19 37.4715 38.0 38.0 38.0 37.4 38.0 20-24 37.4552 38.0 38.0 38.0 37.4 38.0 25-29 37.39135 38.0 38.0 38.0 37.2 38.0 30-34 37.36534999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.28895 38.0 38.0 38.0 37.0 38.0 40-44 37.02485 38.0 38.0 38.0 36.0 38.0 45-49 36.9926 38.0 38.0 38.0 36.0 38.0 50-54 36.88615 38.0 38.0 38.0 35.4 38.0 55-59 36.79115 38.0 38.0 38.0 35.4 38.0 60-64 36.7712 38.0 38.0 38.0 35.0 38.0 65-69 36.63005 38.0 38.0 38.0 34.6 38.0 70-74 36.5668 38.0 38.0 38.0 34.0 38.0 75-79 36.3685 38.0 38.0 38.0 34.0 38.0 80-84 36.2608 38.0 37.8 38.0 33.8 38.0 85-89 36.24465 38.0 37.6 38.0 33.6 38.0 90-94 36.0749 38.0 37.0 38.0 33.2 38.0 95-99 35.74665 38.0 37.0 38.0 30.6 38.0 100-104 35.45375 38.0 36.0 38.0 29.8 38.0 105-109 35.5383 38.0 36.4 38.0 29.8 38.0 110-114 35.25335 38.0 36.0 38.0 28.8 38.0 115-119 34.9603 38.0 35.4 38.0 28.0 38.0 120-124 34.65075 38.0 35.0 38.0 26.8 38.0 125-129 34.30915 38.0 35.0 38.0 24.6 38.0 130-134 33.8919 38.0 34.2 38.0 22.2 38.0 135-139 33.361399999999996 38.0 34.0 38.0 18.6 38.0 140-144 32.5564 38.0 32.2 38.0 14.0 38.0 145-149 31.6291 38.0 31.0 38.0 10.8 38.0 150-151 26.306375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 3.0 8 0.0 9 3.0 10 1.0 11 3.0 12 2.0 13 1.0 14 2.0 15 2.0 16 2.0 17 3.0 18 3.0 19 2.0 20 6.0 21 6.0 22 16.0 23 12.0 24 20.0 25 16.0 26 36.0 27 30.0 28 17.0 29 38.0 30 66.0 31 81.0 32 94.0 33 144.0 34 212.0 35 401.0 36 870.0 37 1907.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.909276769741886 14.694607717863532 9.481216457960643 40.91489905443394 2 20.925 21.099999999999998 36.0 21.975 3 18.6 25.25 26.775 29.375 4 22.125 33.925 21.375 22.575 5 20.95 36.95 24.275 17.825 6 17.8 35.975 26.700000000000003 19.525000000000002 7 14.549999999999999 21.85 44.025 19.575 8 17.5 23.1 32.6 26.8 9 17.9 22.900000000000002 33.625 25.575 10-14 20.06 28.544999999999998 26.745 24.65 15-19 20.544999999999998 28.17 28.205000000000002 23.080000000000002 20-24 19.865 28.754999999999995 27.73 23.65 25-29 19.816981698169815 29.062906290629066 27.892789278927893 23.22732273227323 30-34 20.122012201220123 28.337833783378336 27.792779277927792 23.74737473747375 35-39 20.11008256192144 28.58143607705779 27.645734300725543 23.66274706029522 40-44 19.77977977977978 28.893893893893896 27.62262262262262 23.703703703703706 45-49 20.39141098153061 28.57500375394164 27.498873817508386 23.534711447019372 50-54 19.578599669686202 28.907462088984538 28.201791702117013 23.312146539212254 55-59 20.28651572831096 28.856942496493687 27.13384091364456 23.72270086155079 60-64 20.062130473995392 28.940775628820525 27.933660687443634 23.063433209740456 65-69 20.18440569252355 28.59290438965725 27.535578272198833 23.687111645620366 70-74 20.046117599879693 28.111684796230385 28.156799839590956 23.685397764298962 75-79 20.296831127156036 28.183914961893304 27.622342559165663 23.896911351784997 80-84 20.258555895174627 27.659467855890163 28.135491306308563 23.946484942626647 85-89 20.22944742247382 28.65587896397976 27.608837232603577 23.50583638094284 90-94 19.874718115760462 28.36381859183162 28.41894262089702 23.3425206715109 95-99 20.64525825359451 28.881318571213864 27.643905615951102 22.82951755924052 100-104 20.634046176190715 28.09135072870236 27.765813592427506 23.50878950267942 105-109 20.095285857572716 27.673019057171516 28.480441323971917 23.751253761283852 110-114 20.595458874241892 28.885770136835248 27.38709839105809 23.131672597864767 115-119 20.619486768243785 28.67381716118685 27.120088211708097 23.586607858861267 120-124 21.125 28.965000000000003 26.985 22.925 125-129 20.84 28.105000000000004 27.445000000000004 23.61 130-134 20.919999999999998 28.360000000000003 27.295 23.425 135-139 20.741037051852594 28.48642432121606 26.73133656682834 24.041202060103007 140-144 20.95 28.599999999999998 26.655 23.794999999999998 145-149 20.61 28.84 27.095000000000002 23.455000000000002 150-151 20.1625 27.987499999999997 27.3 24.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 1.0 19 3.0 20 3.5 21 1.0 22 2.0 23 3.5 24 4.0 25 7.0 26 7.0 27 4.5 28 11.5 29 15.0 30 20.0 31 32.0 32 42.0 33 55.5 34 59.0 35 77.5 36 103.5 37 121.5 38 144.5 39 160.5 40 184.0 41 216.5 42 235.5 43 241.0 44 256.0 45 259.5 46 256.5 47 242.0 48 207.0 49 193.5 50 163.5 51 118.0 52 111.0 53 96.0 54 78.5 55 77.0 56 63.0 57 43.5 58 24.0 59 14.0 60 9.0 61 9.0 62 8.5 63 3.5 64 1.5 65 2.0 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.01 35-39 0.075 40-44 0.1 45-49 0.105 50-54 0.095 55-59 0.18 60-64 0.21 65-69 0.22 70-74 0.255 75-79 0.27999999999999997 80-84 0.215 85-89 0.19499999999999998 90-94 0.22499999999999998 95-99 0.19499999999999998 100-104 0.165 105-109 0.3 110-114 0.245 115-119 0.24 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24280666330137 98.3 2 0.6309944472488642 1.25 3 0.10095911155981827 0.3 4 0.0 0.0 5 0.0 0.0 6 0.025239777889954566 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0125 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.0875 0.025 0.0 0.0 0.0 84-85 0.1875 0.025 0.0 0.0 0.0 86-87 0.2 0.025 0.0 0.0 0.0 88-89 0.2625 0.025 0.0 0.0 0.0 90-91 0.30000000000000004 0.025 0.0 0.0 0.0 92-93 0.3875 0.025 0.0 0.0 0.0 94-95 0.4625 0.025 0.0 0.0 0.0 96-97 0.6 0.025 0.0 0.0 0.0 98-99 0.725 0.025 0.0 0.0 0.0 100-101 0.8625 0.025 0.0 0.0 0.0 102-103 1.1875 0.025 0.0 0.0 0.0 104-105 1.35 0.025 0.0 0.0 0.0 106-107 1.6 0.025 0.0 0.0 0.0 108-109 1.7875 0.025 0.0 0.0 0.0 110-111 2.0375 0.025 0.0 0.0 0.0 112-113 2.3625 0.025 0.0 0.0 0.0 114-115 2.6500000000000004 0.025 0.0 0.0 0.0 116-117 2.9625 0.025 0.0 0.0 0.0 118-119 3.2 0.025 0.0 0.0 0.0 120-121 3.7125000000000004 0.025 0.0 0.0 0.0 122-123 4.125 0.025 0.0 0.0 0.0 124-125 4.512499999999999 0.025 0.0 0.0 0.0 126-127 4.9 0.025 0.0 0.0 0.0 128-129 5.375 0.025 0.0 0.0 0.0 130-131 5.9625 0.025 0.0 0.0 0.0 132-133 6.512499999999999 0.025 0.0 0.0 0.0 134-135 6.975 0.025 0.0 0.0 0.0 136-137 7.8125 0.025 0.0 0.0 0.0 138-139 8.4375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAATGA 10 0.0063298983 148.6923 1 CTTTTAT 10 0.0068343505 144.975 6 TCTTTTA 10 0.0068343505 144.975 5 >>END_MODULE SRR7172493 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172493_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7005 33.0 33.0 34.0 32.0 34.0 2 32.75475 33.0 33.0 34.0 32.0 34.0 3 32.78175 34.0 33.0 34.0 32.0 34.0 4 32.6855 34.0 33.0 34.0 32.0 34.0 5 32.6725 34.0 33.0 34.0 32.0 34.0 6 36.80525 38.0 38.0 38.0 36.0 38.0 7 36.94175 38.0 38.0 38.0 37.0 38.0 8 36.96975 38.0 38.0 38.0 37.0 38.0 9 36.91575 38.0 38.0 38.0 37.0 38.0 10-14 36.799249999999994 38.0 38.0 38.0 36.2 38.0 15-19 36.862350000000006 38.0 38.0 38.0 36.4 38.0 20-24 36.8539 38.0 38.0 38.0 36.6 38.0 25-29 36.89505 38.0 38.0 38.0 36.6 38.0 30-34 36.86895 38.0 38.0 38.0 36.4 38.0 35-39 36.7351 38.0 38.0 38.0 36.0 38.0 40-44 36.7998 38.0 38.0 38.0 36.2 38.0 45-49 36.7257 38.0 38.0 38.0 36.0 38.0 50-54 36.678200000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.6129 38.0 38.0 38.0 35.8 38.0 60-64 36.57855 38.0 38.0 38.0 35.4 38.0 65-69 36.426300000000005 38.0 38.0 38.0 34.4 38.0 70-74 36.400200000000005 38.0 38.0 38.0 34.8 38.0 75-79 36.39149999999999 38.0 38.0 38.0 34.4 38.0 80-84 36.2622 38.0 38.0 38.0 34.2 38.0 85-89 36.1043 38.0 38.0 38.0 33.6 38.0 90-94 36.012350000000005 38.0 38.0 38.0 33.8 38.0 95-99 35.883950000000006 38.0 38.0 38.0 33.0 38.0 100-104 35.72445 38.0 37.8 38.0 32.4 38.0 105-109 35.440549999999995 38.0 37.0 38.0 30.6 38.0 110-114 35.26174999999999 38.0 37.0 38.0 30.0 38.0 115-119 34.97615 38.0 36.4 38.0 28.2 38.0 120-124 34.8641 38.0 36.0 38.0 27.8 38.0 125-129 34.44435 38.0 35.8 38.0 25.4 38.0 130-134 33.774800000000006 38.0 35.0 38.0 19.4 38.0 135-139 33.09 38.0 33.0 38.0 15.8 38.0 140-144 32.41965 38.0 33.0 38.0 13.0 38.0 145-149 31.437850000000005 38.0 32.2 38.0 6.2 38.0 150-151 26.577375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 9.0 4 3.0 5 1.0 6 1.0 7 1.0 8 0.0 9 1.0 10 2.0 11 5.0 12 1.0 13 5.0 14 5.0 15 4.0 16 5.0 17 10.0 18 6.0 19 7.0 20 14.0 21 9.0 22 19.0 23 14.0 24 14.0 25 19.0 26 33.0 27 26.0 28 42.0 29 46.0 30 50.0 31 66.0 32 69.0 33 125.0 34 163.0 35 262.0 36 605.0 37 2338.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.3 19.725 12.825000000000001 31.15 2 25.48774387193597 25.987993996998497 33.74187093546773 14.7823911955978 3 20.08504252126063 29.114557278639317 31.51575787893947 19.28464232116058 4 23.29246935201401 36.12709532149112 21.51613710282712 19.06429822366775 5 23.036518259129565 37.81890945472736 21.885942971485743 17.258629314657327 6 19.025 38.375 24.95 17.65 7 18.725 18.975 42.425000000000004 19.875 8 20.674999999999997 24.75 28.975 25.6 9 21.85 24.725 29.75 23.674999999999997 10-14 23.195 28.785 26.39 21.63 15-19 22.335 27.775 28.485 21.404999999999998 20-24 22.509999999999998 28.335 28.825 20.330000000000002 25-29 22.955000000000002 28.345 27.87 20.830000000000002 30-34 22.634999999999998 28.305000000000003 28.475 20.585 35-39 21.95 28.485 28.225 21.34 40-44 22.205 28.144999999999996 28.185 21.465 45-49 22.830000000000002 28.139999999999997 28.32 20.71 50-54 22.425 28.685 28.33 20.560000000000002 55-59 23.49 27.339999999999996 28.27 20.9 60-64 23.365 27.315 28.660000000000004 20.66 65-69 23.285 28.03 27.68 21.005 70-74 23.47 27.68 28.055000000000003 20.794999999999998 75-79 23.395 27.58 28.03 20.995 80-84 23.185 27.43 28.439999999999998 20.945 85-89 23.27 28.025 27.955000000000002 20.75 90-94 23.407340734073408 27.792779277927792 27.85778577857786 20.94209420942094 95-99 23.445 27.900000000000002 28.13 20.525 100-104 23.494999999999997 28.055000000000003 28.194999999999997 20.255000000000003 105-109 23.52 28.185 28.275 20.02 110-114 23.919999999999998 28.084999999999997 28.084999999999997 19.91 115-119 24.404999999999998 28.185 27.375 20.035 120-124 23.57 28.57 27.855 20.005 125-129 24.58 28.194999999999997 27.235 19.99 130-134 24.884999999999998 27.810000000000002 27.439999999999998 19.865 135-139 24.875 27.87 27.155 20.1 140-144 25.095 28.4 26.865 19.64 145-149 25.380000000000003 28.07 27.084999999999997 19.465 150-151 27.425 26.887499999999996 27.0 18.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 1.0 21 2.5 22 2.5 23 2.5 24 3.0 25 4.5 26 5.5 27 9.5 28 12.0 29 14.5 30 22.5 31 25.5 32 27.5 33 38.0 34 49.0 35 62.5 36 81.0 37 118.0 38 167.0 39 179.0 40 193.5 41 230.0 42 268.5 43 280.0 44 269.5 45 270.5 46 249.0 47 219.0 48 188.5 49 179.0 50 173.5 51 131.5 52 97.5 53 86.0 54 79.0 55 64.5 56 51.0 57 39.5 58 26.0 59 22.0 60 15.5 61 9.0 62 7.0 63 5.5 64 4.5 65 1.0 66 1.0 67 1.0 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.075 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26526475804408 97.95 2 0.532049657968077 1.05 3 0.07600709399543958 0.22499999999999998 4 0.02533569799847986 0.1 5 0.05067139599695972 0.25 6 0.02533569799847986 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02533569799847986 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 11 0.27499999999999997 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.7375 0.0 0.0 0.0 0.0 110-111 1.9875 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.225 0.0 0.0 0.0 0.0 120-121 3.7125000000000004 0.0 0.0 0.0 0.0 122-123 4.1125 0.0 0.0 0.0 0.0 124-125 4.487500000000001 0.0 0.0 0.0 0.0 126-127 4.85 0.0 0.0 0.0 0.0 128-129 5.3125 0.0 0.0 0.0 0.0 130-131 5.875 0.0 0.0 0.0 0.0 132-133 6.4125 0.0 0.0 0.0 0.0 134-135 6.9125 0.0 0.0 0.0 0.0 136-137 7.725 0.0 0.0 0.0 0.0 138-139 8.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGATT 10 0.006830828 145.0 2 TATGTTA 10 0.006830828 145.0 5 CATCAAC 10 0.006830828 145.0 8 >>END_MODULE Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra Read 677690 spots for SRR7172493.sra Written 677690 spots for SRR7172493.sra Read 677672 spots for SRR7172493.sra Written 677672 spots for SRR7172493.sra SRR ids: ['SRR7172493.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p1bm9zn1 SRR7172493.sra spots: 13553458 blocks: [[1, 677672], [677673, 1355344], [1355345, 2033016], [2033017, 2710688], [2710689, 3388360], [3388361, 4066032], [4066033, 4743704], [4743705, 5421376], [5421377, 6099048], [6099049, 6776720], [6776721, 7454392], [7454393, 8132064], [8132065, 8809736], [8809737, 9487408], [9487409, 10165080], [10165081, 10842752], [10842753, 11520424], [11520425, 12198096], [12198097, 12875768], [12875769, 13553458]] SRR7172493 file size 4571121 SRR7172493 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172493 SRR7172493_1.fastq SRR7172493_2.fastq Input file: SRR7172493_1.fastq Paired file: SRR7172493_2.fastq trimmed: SRR7172493-trimmed-pair1.fastq, SRR7172493-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:29:19 2025 >> started Mon Feb 10 12:29:41 2025 >> done (22.468s) 13553458 read pairs processed; of these: 21360 ( 0.16%) short read pairs filtered out after trimming by size control 66833 ( 0.49%) empty read pairs filtered out after trimming by size control 13465265 (99.35%) read pairs available; of these: 7117444 (52.86%) trimmed read pairs available after processing 6347821 (47.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 9 0.00% 25 8 0.00% 26 7 0.00% 27 9 0.00% 28 11 0.00% 29 9 0.00% 30 13 0.00% 31 10 0.00% 32 15 0.00% 33 12 0.00% 34 16 0.00% 35 21 0.00% 36 19 0.00% 37 20 0.00% 38 17 0.00% 39 22 0.00% 40 28 0.00% 41 18 0.00% 42 29 0.00% 43 31 0.00% 44 38 0.00% 45 55 0.00% 46 53 0.00% 47 57 0.00% 48 56 0.00% 49 68 0.00% 50 94 0.00% 51 107 0.00% 52 96 0.00% 53 119 0.00% 54 128 0.00% 55 122 0.00% 56 155 0.00% 57 189 0.00% 58 199 0.00% 59 251 0.00% 60 290 0.00% 61 311 0.00% 62 353 0.00% 63 416 0.00% 64 454 0.00% 65 470 0.00% 66 551 0.00% 67 591 0.00% 68 670 0.00% 69 821 0.01% 70 980 0.01% 71 1039 0.01% 72 1181 0.01% 73 1294 0.01% 74 1440 0.01% 75 1705 0.01% 76 1774 0.01% 77 2046 0.02% 78 2236 0.02% 79 2600 0.02% 80 2914 0.02% 81 3291 0.02% 82 3683 0.03% 83 4185 0.03% 84 5328 0.04% 85 5961 0.04% 86 6462 0.05% 87 6815 0.05% 88 7152 0.05% 89 7623 0.06% 90 8269 0.06% 91 8907 0.07% 92 9865 0.07% 93 10561 0.08% 94 11231 0.08% 95 11834 0.09% 96 12216 0.09% 97 13160 0.10% 98 13678 0.10% 99 14158 0.11% 100 15185 0.11% 101 16044 0.12% 102 17110 0.13% 103 17672 0.13% 104 18526 0.14% 105 19408 0.14% 106 20486 0.15% 107 21133 0.16% 108 21586 0.16% 109 22840 0.17% 110 23395 0.17% 111 24742 0.18% 112 25712 0.19% 113 26935 0.20% 114 28310 0.21% 115 29589 0.22% 116 30917 0.23% 117 31671 0.24% 118 32644 0.24% 119 33889 0.25% 120 34627 0.26% 121 35668 0.26% 122 37113 0.28% 123 39221 0.29% 124 40533 0.30% 125 41948 0.31% 126 43608 0.32% 127 45208 0.34% 128 46809 0.35% 129 47903 0.36% 130 50091 0.37% 131 51782 0.38% 132 53954 0.40% 133 56773 0.42% 134 59554 0.44% 135 63187 0.47% 136 66332 0.49% 137 70636 0.52% 138 74315 0.55% 139 78896 0.59% 140 84981 0.63% 141 91837 0.68% 142 101047 0.75% 143 112924 0.84% 144 131261 0.97% 145 157481 1.17% 146 191891 1.43% 147 258275 1.92% 148 380397 2.83% 149 727354 5.40% 150 3173392 23.57% 151 6347821 47.14% 13465265 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=20 prefix-density=0.32 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=42.95 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.2 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=26 prefix-density=0.47 prefix-fanout=2.3 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=54.37 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.3 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7172493 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:30:25 Started mapping on | Feb 10 12:30:25 Finished on | Feb 10 12:32:09 Mapping speed, Million of reads per hour | 466.11 Number of input reads | 13465265 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12581994 Uniquely mapped reads % | 93.44% Average mapped length | 291.76 Number of splices: Total | 12158496 Number of splices: Annotated (sjdb) | 11858796 Number of splices: GT/AG | 11927329 Number of splices: GC/AG | 178617 Number of splices: AT/AC | 8012 Number of splices: Non-canonical | 44538 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357480 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 73646 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 541120 541120 541120 N_multimapping 357480 357480 357480 N_noFeature 551284 12321397 657935 N_ambiguous 237864 958 83280 UnstrandedReadsAssigned:11792846 PositiveStrandReadsAssigned:259639 NegativeStrandReadsAssigned:11840779 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172493 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172493-trimmed-pair1.fastq SRR7172493-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,465,265 reads, 11,801,570 reads pseudoaligned [quant] estimated average fragment length: 239.559 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 988 rounds 52401 SRR7172493.ke.tsv 34699 SRR7172493.se.tsv 87100 total ==> SRR7172493.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.44 467 17.5568 Potri.005G024800.1.v4.1 1035 796.441 569 47.7938 Potri.004G059700.1.v4.1 961 722.545 0 0 Potri.007G009000.2.v4.1 1416 1177.44 0 0 Potri.003G141000.2.v4.1 2943 2704.44 782 19.3438 Potri.016G087400.1.v4.1 270 85.8067 824 642.42 Potri.015G069301.1.v4.1 564 333.166 0 0 Potri.010G195200.1.v4.1 1773 1534.44 254.933 11.1145 Potri.012G127500.1.v4.1 977 738.504 149 13.4973 ==> SRR7172493.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 334 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 56 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 116 SRR7172493 completed mapping pipeline successfully