Starting /dee2/code/volunteer_pipeline.sh SRR7172494 current disk space = 3058827780096 free memory = 1387123092 SRR7172494 SRAfilesize 478e9bf4967a7bfaa8fe8c9744a8c5cc SRR7172494.sra SRR7172494.sra file validated SRR7172494 is paired end SRR7172494 is conventional basespace SRR7172494 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172494_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99475 34.0 33.0 34.0 33.0 34.0 2 33.3495 34.0 33.0 34.0 33.0 34.0 3 33.405 34.0 34.0 34.0 33.0 34.0 4 33.41975 34.0 34.0 34.0 33.0 34.0 5 33.26625 34.0 33.0 34.0 33.0 34.0 6 36.99125 38.0 37.0 38.0 36.0 38.0 7 37.35925 38.0 38.0 38.0 37.0 38.0 8 37.47575 38.0 38.0 38.0 37.0 38.0 9 37.50425 38.0 38.0 38.0 37.0 38.0 10-14 37.466249999999995 38.0 38.0 38.0 37.4 38.0 15-19 37.485949999999995 38.0 38.0 38.0 37.2 38.0 20-24 37.480000000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.423249999999996 38.0 38.0 38.0 37.2 38.0 30-34 37.414100000000005 38.0 38.0 38.0 37.6 38.0 35-39 37.3386 38.0 38.0 38.0 37.0 38.0 40-44 37.21835 38.0 38.0 38.0 37.0 38.0 45-49 37.16725 38.0 38.0 38.0 36.8 38.0 50-54 37.0745 38.0 38.0 38.0 36.2 38.0 55-59 37.016650000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.00419999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.9932 38.0 38.0 38.0 36.0 38.0 70-74 36.8897 38.0 38.0 38.0 35.8 38.0 75-79 36.7099 38.0 38.0 38.0 35.0 38.0 80-84 36.563599999999994 38.0 38.0 38.0 34.2 38.0 85-89 36.575750000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.4132 38.0 38.0 38.0 34.0 38.0 95-99 36.2913 38.0 38.0 38.0 34.0 38.0 100-104 36.1209 38.0 38.0 38.0 33.4 38.0 105-109 35.95145 38.0 37.4 38.0 32.8 38.0 110-114 35.677099999999996 38.0 37.0 38.0 31.0 38.0 115-119 35.5843 38.0 36.8 38.0 31.0 38.0 120-124 35.408750000000005 38.0 36.4 38.0 30.4 38.0 125-129 35.0965 38.0 36.0 38.0 28.4 38.0 130-134 34.69345 38.0 35.4 38.0 26.8 38.0 135-139 34.290000000000006 38.0 35.0 38.0 24.0 38.0 140-144 33.80805 38.0 34.8 38.0 22.2 38.0 145-149 33.063250000000004 38.0 33.4 38.0 18.2 38.0 150-151 28.666874999999997 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 0.0 13 1.0 14 6.0 15 3.0 16 1.0 17 3.0 18 2.0 19 5.0 20 8.0 21 11.0 22 8.0 23 12.0 24 11.0 25 18.0 26 15.0 27 21.0 28 30.0 29 41.0 30 53.0 31 67.0 32 65.0 33 120.0 34 161.0 35 256.0 36 641.0 37 2437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.45647773279352 15.915991902834008 8.021255060728745 27.606275303643724 2 22.675 18.425 32.15 26.75 3 18.55 26.5 28.525 26.424999999999997 4 23.724999999999998 31.7 24.25 20.325 5 21.73477061920281 36.55051391326147 23.84056154424668 17.874153923289047 6 16.75 36.775000000000006 26.35 20.125 7 14.299999999999999 21.8 44.775 19.125 8 16.55 23.674999999999997 32.25 27.525 9 16.425 22.625 34.375 26.575 10-14 20.39 29.34 26.8 23.47 15-19 19.72 28.205000000000002 28.16 23.915 20-24 20.119999999999997 28.410000000000004 28.105000000000004 23.365 25-29 20.105 29.085 27.744999999999997 23.064999999999998 30-34 20.380000000000003 28.715000000000003 27.615000000000002 23.29 35-39 19.53 28.544999999999998 27.644999999999996 24.279999999999998 40-44 20.169999999999998 28.945 27.825 23.06 45-49 19.955000000000002 28.325 27.584999999999997 24.135 50-54 20.61 28.785 27.634999999999998 22.97 55-59 20.27108132439732 28.553566069820945 27.448234470341106 23.727118135440634 60-64 19.6248124062031 28.459229614807402 27.883941970985493 24.032016008004 65-69 20.202070724753664 28.08482969039164 27.609663382183765 24.103436202670935 70-74 20.33016508254127 28.134067033516757 28.119059529764883 23.41670835417709 75-79 20.225112556278138 28.929464732366185 27.22361180590295 23.621810905452726 80-84 20.686205861758527 27.78333500050015 27.69330799239772 23.8371511453436 85-89 20.57 28.244999999999997 27.735 23.45 90-94 20.810000000000002 28.310000000000002 27.1 23.78 95-99 20.65 28.125 27.58 23.645 100-104 20.089173889083714 27.954511297029207 28.109814137568257 23.846500676318822 105-109 20.505252626313155 27.933966983491747 27.87393696848424 23.686843421710854 110-114 20.636431971936858 28.2335254322225 27.807567025808066 23.322475570032573 115-119 20.928371348539414 28.011204481792717 27.25090036014406 23.809523809523807 120-124 20.630000000000003 28.535 27.095000000000002 23.74 125-129 21.44107205360268 28.30141507075354 26.996349817490874 23.26116305815291 130-134 21.592618593922374 28.407381406077626 26.95316417611072 23.04683582388928 135-139 21.108656356698134 28.48463546896967 26.305483028720626 24.10122514561157 140-144 21.080810607955964 27.570678008506377 27.110332749562172 24.238178633975483 145-149 21.13 27.88 27.215 23.775 150-151 20.3 27.750000000000004 27.325 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.5 3 1.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 1.0 21 1.0 22 1.5 23 3.0 24 3.5 25 3.5 26 7.5 27 12.0 28 13.5 29 19.0 30 23.5 31 30.0 32 40.0 33 51.0 34 66.5 35 85.0 36 101.0 37 108.0 38 126.5 39 152.5 40 181.0 41 193.0 42 217.5 43 252.0 44 250.0 45 242.0 46 240.0 47 233.5 48 220.5 49 210.5 50 188.5 51 155.5 52 119.0 53 95.5 54 81.5 55 70.0 56 56.0 57 37.0 58 29.0 59 23.0 60 17.0 61 11.0 62 5.5 63 4.0 64 3.0 65 0.5 66 1.5 67 2.0 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.03 60-64 0.05 65-69 0.034999999999999996 70-74 0.05 75-79 0.05 80-84 0.03 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.19499999999999998 105-109 0.05 110-114 0.22499999999999998 115-119 0.04 120-124 0.0 125-129 0.005 130-134 0.29 135-139 0.42 140-144 0.075 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2687846696924 98.425 2 0.6303580433686334 1.25 3 0.07564296520423601 0.22499999999999998 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.1375 0.0 0.0 0.0 0.0 118-119 3.4125 0.0 0.0 0.0 0.0 120-121 3.7875 0.0 0.0 0.0 0.0 122-123 4.0 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.9625 0.0 0.0 0.0 0.0 128-129 5.3375 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.175000000000001 0.0 0.0 0.0 0.0 134-135 6.8125 0.0 0.0 0.0 0.0 136-137 7.2875 0.0 0.0 0.0 0.0 138-139 7.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGTC 20 0.005972756 28.9625 140-144 CTGAACT 20 0.005972756 28.9625 135-139 >>END_MODULE SRR7172494 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172494_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43675 33.0 33.0 34.0 32.0 34.0 2 32.46775 33.0 33.0 34.0 32.0 34.0 3 32.4525 34.0 33.0 34.0 32.0 34.0 4 32.40475 34.0 33.0 34.0 32.0 34.0 5 32.41125 34.0 33.0 34.0 32.0 34.0 6 36.40275 38.0 38.0 38.0 34.0 38.0 7 36.5105 38.0 38.0 38.0 35.0 38.0 8 36.465 38.0 38.0 38.0 35.0 38.0 9 36.434 38.0 38.0 38.0 36.0 38.0 10-14 36.40795 38.0 38.0 38.0 35.2 38.0 15-19 36.3667 38.0 38.0 38.0 35.6 38.0 20-24 36.33285 38.0 38.0 38.0 35.0 38.0 25-29 36.36155 38.0 38.0 38.0 35.6 38.0 30-34 36.33605 38.0 38.0 38.0 35.6 38.0 35-39 36.2532 38.0 38.0 38.0 34.8 38.0 40-44 36.1866 38.0 38.0 38.0 34.8 38.0 45-49 36.208999999999996 38.0 38.0 38.0 35.0 38.0 50-54 36.233700000000006 38.0 38.0 38.0 35.2 38.0 55-59 36.180400000000006 38.0 38.0 38.0 34.8 38.0 60-64 36.13785 38.0 38.0 38.0 34.4 38.0 65-69 35.9708 38.0 38.0 38.0 34.0 38.0 70-74 35.9306 38.0 38.0 38.0 34.0 38.0 75-79 35.84145 38.0 38.0 38.0 33.2 38.0 80-84 35.68895 38.0 38.0 38.0 32.8 38.0 85-89 35.6404 38.0 38.0 38.0 33.0 38.0 90-94 35.47985 38.0 38.0 38.0 31.4 38.0 95-99 35.3366 38.0 38.0 38.0 30.6 38.0 100-104 35.25260000000001 38.0 37.8 38.0 29.8 38.0 105-109 35.137350000000005 38.0 37.6 38.0 29.0 38.0 110-114 34.89565 38.0 37.0 38.0 27.8 38.0 115-119 34.71125 38.0 37.0 38.0 27.0 38.0 120-124 34.469049999999996 38.0 36.0 38.0 25.2 38.0 125-129 34.087450000000004 38.0 36.0 38.0 22.6 38.0 130-134 33.73629999999999 38.0 35.0 38.0 18.6 38.0 135-139 33.12545 38.0 33.8 38.0 14.6 38.0 140-144 32.4349 38.0 33.2 38.0 13.2 38.0 145-149 31.493550000000006 38.0 32.2 38.0 6.4 38.0 150-151 27.051875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 15.0 4 7.0 5 5.0 6 7.0 7 2.0 8 3.0 9 5.0 10 5.0 11 5.0 12 5.0 13 7.0 14 9.0 15 7.0 16 5.0 17 6.0 18 5.0 19 11.0 20 13.0 21 14.0 22 19.0 23 22.0 24 20.0 25 16.0 26 28.0 27 24.0 28 43.0 29 49.0 30 40.0 31 56.0 32 84.0 33 91.0 34 131.0 35 215.0 36 508.0 37 2480.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.822055137844615 21.478696741854638 10.751879699248121 18.947368421052634 2 28.399397892624183 22.503763171098846 31.10888108379328 17.987957852483692 3 20.441988950276244 26.268206931190356 33.17428427925665 20.115519839276747 4 24.10153304850465 35.41090726313144 22.844935913546117 17.642623774817793 5 23.850213621512943 37.0696154812767 21.73913043478261 17.341040462427745 6 18.405833542871513 36.83681166708575 24.767412622579833 19.989942167462914 7 19.959778783308195 18.954248366013072 41.42785319255908 19.65811965811966 8 19.92963056044232 23.825081678813774 28.826338275948732 27.418949484795174 9 21.49321266968326 24.76118652589241 29.034690799396685 24.710910005027653 10-14 23.215004022526145 28.39903459372486 26.644207562349152 21.74175382139984 15-19 23.247863247863247 27.702362996480645 27.918552036199095 21.131221719457013 20-24 22.769091548941734 28.35453220049268 27.590367502890757 21.286008747674828 25-29 22.87509424478512 28.32872581050515 27.896456396079415 20.89972354863031 30-34 23.05101784367932 27.70042724302589 27.695400854486053 21.553154058808747 35-39 22.79581783452297 27.485674072584697 28.305016587915954 21.413491504976374 40-44 23.40222255744959 28.199326192990398 27.600945341177653 20.79750590838236 45-49 22.76201971434319 28.072822369744515 28.15328907664454 21.011868839267752 50-54 23.11406155703078 28.123114061557033 27.549788774894385 21.213035606517803 55-59 23.38243426675381 27.253531748026745 28.4098335930823 20.95420039213715 60-64 22.730471498944404 27.686739720518748 28.470895747461544 21.111893033075297 65-69 23.476468222043444 27.795655671761864 27.710176991150444 21.01769911504425 70-74 23.443628683495927 27.411244091320526 27.778336518153473 21.366790707030074 75-79 23.081950729009552 27.74258421317245 28.46153846153846 20.71392659627954 80-84 22.812751407884154 27.83085277554304 27.861021721641187 21.495374094931616 85-89 23.627949092006638 27.581870315408217 27.773026812213896 21.017153780371245 90-94 23.432940939732365 27.4574906932287 28.020927658718183 21.088640708320757 95-99 23.118333668746228 28.290400482994567 28.0690279734353 20.522237874823908 100-104 23.663699904460202 28.174184140393223 27.726655604163525 20.435460350983053 105-109 23.668996028354535 27.384244130511288 28.238902015987126 20.70785782514705 110-114 23.410244809732067 27.70823907907304 28.2712511938873 20.610264917307596 115-119 23.989340305711988 28.464400643604183 27.398431214802898 20.147827835880932 120-124 24.013273668862183 28.211574237015434 27.150686309015033 20.624465785107347 125-129 24.32378079436903 27.983911513323278 27.310206133735544 20.382101558572145 130-134 24.533802462930385 27.906509173159083 27.182709223422968 20.37697914048756 135-139 25.059066003116676 28.210928467300057 26.98436636002614 19.74563916955713 140-144 25.19237539606699 27.84791027510939 27.108585223557814 19.851129105265805 145-149 25.005031193399073 28.406117931173274 26.765948883075062 19.822901992352588 150-151 25.522012578616355 27.761006289308177 27.433962264150942 19.28301886792453 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 11.0 1 8.5 2 4.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 1.5 14 1.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 1.0 21 2.0 22 2.0 23 3.5 24 4.5 25 2.0 26 3.5 27 8.0 28 9.5 29 13.0 30 19.0 31 23.0 32 32.5 33 39.5 34 48.0 35 64.5 36 80.5 37 103.0 38 131.5 39 158.0 40 182.5 41 197.5 42 232.0 43 257.0 44 266.5 45 268.0 46 240.0 47 240.5 48 227.0 49 200.0 50 186.5 51 153.5 52 116.5 53 98.0 54 85.0 55 66.0 56 58.5 57 39.5 58 28.0 59 23.0 60 12.0 61 16.0 62 13.5 63 6.0 64 2.0 65 1.0 66 1.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.35000000000000003 3 0.44999999999999996 4 0.525 5 0.525 6 0.575 7 0.5499999999999999 8 0.525 9 0.5499999999999999 10-14 0.5599999999999999 15-19 0.5499999999999999 20-24 0.545 25-29 0.525 30-34 0.525 35-39 0.53 40-44 0.565 45-49 0.58 50-54 0.58 55-59 0.545 60-64 0.53 65-69 0.5599999999999999 70-74 0.5700000000000001 75-79 0.5499999999999999 80-84 0.5599999999999999 85-89 0.605 90-94 0.61 95-99 0.62 100-104 0.565 105-109 0.545 110-114 0.5349999999999999 115-119 0.5599999999999999 120-124 0.555 125-129 0.5499999999999999 130-134 0.525 135-139 0.5349999999999999 140-144 0.585 145-149 0.62 150-151 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1139240506329 97.875 2 0.7341772151898734 1.4500000000000002 3 0.0759493670886076 0.22499999999999998 4 0.05063291139240507 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025316455696202535 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.6625 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.2 0.0 0.0 0.0 0.0 120-121 3.5875 0.0 0.0 0.0 0.0 122-123 3.8125 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.6625 0.0 0.0 0.0 0.0 128-129 4.9875 0.0 0.0 0.0 0.0 130-131 5.275 0.0 0.0 0.0 0.0 132-133 5.7625 0.0 0.0 0.0 0.0 134-135 6.387499999999999 0.0 0.0 0.0 0.0 136-137 6.875 0.0 0.0 0.0 0.0 138-139 7.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTGA 10 0.00682755 145.0 4 TAATTTG 10 0.00682755 145.0 3 GGAAGTT 10 0.00682755 145.0 1 CTTAACC 10 0.00682755 145.0 7 TTAACCC 10 0.00682755 145.0 8 CCCTTAA 10 0.00682755 145.0 5 ACTATGG 10 0.00682755 145.0 6 CCCCCCC 20 0.0059333243 29.0 15-19 >>END_MODULE Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815632 spots for SRR7172494.sra Written 815632 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra Read 815620 spots for SRR7172494.sra Written 815620 spots for SRR7172494.sra SRR ids: ['SRR7172494.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_apjqfa05 SRR7172494.sra spots: 16312412 blocks: [[1, 815620], [815621, 1631240], [1631241, 2446860], [2446861, 3262480], [3262481, 4078100], [4078101, 4893720], [4893721, 5709340], [5709341, 6524960], [6524961, 7340580], [7340581, 8156200], [8156201, 8971820], [8971821, 9787440], [9787441, 10603060], [10603061, 11418680], [11418681, 12234300], [12234301, 13049920], [13049921, 13865540], [13865541, 14681160], [14681161, 15496780], [15496781, 16312412]] SRR7172494 file size 5506040 SRR7172494 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172494 SRR7172494_1.fastq SRR7172494_2.fastq Input file: SRR7172494_1.fastq Paired file: SRR7172494_2.fastq trimmed: SRR7172494-trimmed-pair1.fastq, SRR7172494-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:24:52 2025 >> started Mon Feb 10 12:25:11 2025 >> done (18.177s) 16312412 read pairs processed; of these: 47210 ( 0.29%) short read pairs filtered out after trimming by size control 98344 ( 0.60%) empty read pairs filtered out after trimming by size control 16166858 (99.11%) read pairs available; of these: 8112838 (50.18%) trimmed read pairs available after processing 8054020 (49.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 13 0.00% 20 17 0.00% 21 11 0.00% 22 16 0.00% 23 14 0.00% 24 14 0.00% 25 10 0.00% 26 17 0.00% 27 16 0.00% 28 11 0.00% 29 11 0.00% 30 16 0.00% 31 22 0.00% 32 16 0.00% 33 15 0.00% 34 14 0.00% 35 25 0.00% 36 21 0.00% 37 45 0.00% 38 31 0.00% 39 38 0.00% 40 25 0.00% 41 31 0.00% 42 37 0.00% 43 43 0.00% 44 48 0.00% 45 130 0.00% 46 107 0.00% 47 85 0.00% 48 80 0.00% 49 84 0.00% 50 111 0.00% 51 128 0.00% 52 117 0.00% 53 135 0.00% 54 147 0.00% 55 142 0.00% 56 162 0.00% 57 194 0.00% 58 226 0.00% 59 280 0.00% 60 312 0.00% 61 338 0.00% 62 411 0.00% 63 426 0.00% 64 476 0.00% 65 566 0.00% 66 627 0.00% 67 775 0.00% 68 947 0.01% 69 1320 0.01% 70 1402 0.01% 71 1212 0.01% 72 1331 0.01% 73 1426 0.01% 74 1635 0.01% 75 1740 0.01% 76 1922 0.01% 77 2112 0.01% 78 2471 0.02% 79 2672 0.02% 80 3023 0.02% 81 3560 0.02% 82 4176 0.03% 83 4622 0.03% 84 6581 0.04% 85 7983 0.05% 86 8388 0.05% 87 8624 0.05% 88 9246 0.06% 89 9417 0.06% 90 10088 0.06% 91 10788 0.07% 92 11407 0.07% 93 12871 0.08% 94 13622 0.08% 95 13829 0.09% 96 14345 0.09% 97 14861 0.09% 98 15748 0.10% 99 16218 0.10% 100 17536 0.11% 101 18253 0.11% 102 19667 0.12% 103 20617 0.13% 104 21691 0.13% 105 22782 0.14% 106 23480 0.15% 107 24068 0.15% 108 25509 0.16% 109 26521 0.16% 110 27507 0.17% 111 28648 0.18% 112 30443 0.19% 113 32093 0.20% 114 33035 0.20% 115 34257 0.21% 116 36074 0.22% 117 36999 0.23% 118 37534 0.23% 119 38801 0.24% 120 40415 0.25% 121 41453 0.26% 122 42777 0.26% 123 45598 0.28% 124 47596 0.29% 125 49080 0.30% 126 51211 0.32% 127 52957 0.33% 128 53872 0.33% 129 56817 0.35% 130 58669 0.36% 131 60519 0.37% 132 63659 0.39% 133 66783 0.41% 134 69443 0.43% 135 73943 0.46% 136 77778 0.48% 137 81566 0.50% 138 86515 0.54% 139 91466 0.57% 140 96777 0.60% 141 104204 0.64% 142 113712 0.70% 143 126332 0.78% 144 144969 0.90% 145 169331 1.05% 146 205476 1.27% 147 271021 1.68% 148 403202 2.49% 149 793870 4.91% 150 3690083 22.82% 151 8054020 49.82% 16166858 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=15 prefix-density=0.55 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=20 fanout-score=332.21 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=15.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=22 prefix-density=0.90 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=30.68 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=6.0 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR7172494 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:25:56 Started mapping on | Feb 10 12:25:56 Finished on | Feb 10 12:27:52 Mapping speed, Million of reads per hour | 501.73 Number of input reads | 16166858 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14935966 Uniquely mapped reads % | 92.39% Average mapped length | 292.00 Number of splices: Total | 13829834 Number of splices: Annotated (sjdb) | 13519083 Number of splices: GT/AG | 13562195 Number of splices: GC/AG | 214254 Number of splices: AT/AC | 8455 Number of splices: Non-canonical | 44930 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406349 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 53857 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.67% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 864002 864002 864002 N_multimapping 406349 406349 406349 N_noFeature 611026 14628782 757590 N_ambiguous 249348 1264 88006 UnstrandedReadsAssigned:14075592 PositiveStrandReadsAssigned:305920 NegativeStrandReadsAssigned:14090370 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172494 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172494-trimmed-pair1.fastq SRR7172494-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,166,858 reads, 14,082,824 reads pseudoaligned [quant] estimated average fragment length: 246.331 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR7172494.ke.tsv 34699 SRR7172494.se.tsv 87100 total ==> SRR7172494.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.67 458 16.327 Potri.005G024800.1.v4.1 1035 789.669 249 19.9261 Potri.004G059700.1.v4.1 961 715.819 6 0.529683 Potri.007G009000.2.v4.1 1416 1170.67 0 0 Potri.003G141000.2.v4.1 2943 2697.67 734 17.1939 Potri.016G087400.1.v4.1 270 85.5536 618.635 456.945 Potri.015G069301.1.v4.1 564 328.247 0 0 Potri.010G195200.1.v4.1 1773 1527.67 14 0.579117 Potri.012G127500.1.v4.1 977 731.732 278 24.0082 ==> SRR7172494.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 832 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 300 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 118 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR7172494 completed mapping pipeline successfully