Starting /dee2/code/volunteer_pipeline.sh SRR7172495 current disk space = 3058666659840 free memory = 1350405024 SRR7172495 SRAfilesize 124b72d64241b98ad20cfda52b509ce8 SRR7172495.sra SRR7172495.sra file validated SRR7172495 is paired end SRR7172495 is conventional basespace SRR7172495 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172495_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.593 34.0 33.0 34.0 33.0 34.0 2 33.34825 34.0 34.0 34.0 33.0 34.0 3 33.39675 34.0 34.0 34.0 33.0 34.0 4 33.48825 34.0 34.0 34.0 33.0 34.0 5 33.489 34.0 34.0 34.0 33.0 34.0 6 37.29975 38.0 38.0 38.0 36.0 38.0 7 37.51575 38.0 38.0 38.0 37.0 38.0 8 37.60675 38.0 38.0 38.0 38.0 38.0 9 37.63475 38.0 38.0 38.0 38.0 38.0 10-14 37.58345 38.0 38.0 38.0 38.0 38.0 15-19 37.5878 38.0 38.0 38.0 38.0 38.0 20-24 37.5998 38.0 38.0 38.0 38.0 38.0 25-29 37.52935 38.0 38.0 38.0 38.0 38.0 30-34 37.541450000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.4207 38.0 38.0 38.0 37.4 38.0 40-44 37.26604999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.202 38.0 38.0 38.0 36.8 38.0 50-54 37.080200000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.9802 38.0 38.0 38.0 36.0 38.0 60-64 37.0449 38.0 38.0 38.0 36.0 38.0 65-69 36.9107 38.0 38.0 38.0 35.8 38.0 70-74 36.76675 38.0 38.0 38.0 35.0 38.0 75-79 36.64615 38.0 38.0 38.0 34.4 38.0 80-84 36.48094999999999 38.0 38.0 38.0 34.2 38.0 85-89 36.4431 38.0 38.0 38.0 34.0 38.0 90-94 36.35675 38.0 38.0 38.0 33.8 38.0 95-99 36.17184999999999 38.0 37.4 38.0 33.4 38.0 100-104 36.072250000000004 38.0 37.0 38.0 33.2 38.0 105-109 35.81685 38.0 36.8 38.0 32.0 38.0 110-114 35.34755 38.0 36.2 38.0 29.4 38.0 115-119 35.3386 38.0 36.0 38.0 29.0 38.0 120-124 35.309 38.0 36.0 38.0 29.2 38.0 125-129 34.860400000000006 38.0 35.2 38.0 27.8 38.0 130-134 34.4095 38.0 34.6 38.0 25.2 38.0 135-139 33.844100000000005 38.0 34.4 38.0 22.6 38.0 140-144 33.299099999999996 38.0 33.2 38.0 21.4 38.0 145-149 32.12859999999999 38.0 33.0 38.0 11.2 38.0 150-151 26.951375 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 0.0 11 0.0 12 1.0 13 2.0 14 5.0 15 1.0 16 1.0 17 4.0 18 3.0 19 2.0 20 5.0 21 11.0 22 4.0 23 14.0 24 10.0 25 12.0 26 19.0 27 28.0 28 29.0 29 44.0 30 50.0 31 65.0 32 88.0 33 123.0 34 196.0 35 300.0 36 808.0 37 2172.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.10896941660241 14.263685427910563 8.81521459778977 40.81213055769725 2 20.275000000000002 18.45 37.325 23.95 3 18.2 23.75 26.8 31.25 4 21.85 32.725 21.925 23.5 5 20.9 35.9 24.775 18.425 6 17.474999999999998 34.625 26.6 21.3 7 13.350000000000001 23.45 44.275 18.925 8 17.7 23.849999999999998 32.05 26.400000000000002 9 18.275 23.425 33.074999999999996 25.224999999999998 10-14 20.34 29.13 26.705000000000002 23.825 15-19 19.91 28.54 27.72 23.830000000000002 20-24 19.830000000000002 28.42 28.425 23.325000000000003 25-29 19.75 28.310000000000002 28.29 23.65 30-34 20.275000000000002 29.01 27.185 23.53 35-39 19.748824176923847 28.960272190533377 27.679375562894027 23.611528069648756 40-44 20.16012009006755 29.30197648236177 27.060295221416062 23.477608206154617 45-49 19.694771078308733 28.426319739804857 27.93094821115837 23.947960970728047 50-54 19.744808606454843 28.481361020765572 28.08606454841131 23.687765824368277 55-59 19.44402704733283 28.404708239418987 28.159278737791134 23.99198597545705 60-64 19.318637274549097 28.371743486973948 28.276553106212425 24.03306613226453 65-69 20.192355858337926 28.617943194910584 27.29048740169313 23.89921354505836 70-74 20.14629991482539 28.71386342001102 27.751891377323513 23.387945287840072 75-79 20.027056819320574 28.67521795771119 27.02174566589839 24.275979557069846 80-84 20.580131255949098 28.290165823355544 27.789188918390863 23.340514002304495 85-89 20.32259680408756 28.477683714872516 27.550969293192406 23.64875018784752 90-94 19.978958969991485 28.78112319022093 27.819247532688745 23.420670307098842 95-99 20.38669605289521 28.786816269284714 27.534562211981566 23.29192546583851 100-104 20.099168586597216 28.378243013122308 27.757187218271064 23.765401182009416 105-109 20.65457097032879 27.716519647153167 28.082397754611065 23.546511627906977 110-114 20.96984270113215 28.088367899008116 27.512273319306686 23.42951608055305 115-119 20.62124248496994 28.266533066132265 27.61022044088176 23.50200400801603 120-124 20.265 28.065 27.905 23.765 125-129 20.580290145072535 28.66933466733367 27.218609304652325 23.53176588294147 130-134 20.925907308736303 28.561375289031872 27.088569417914947 23.42414798431688 135-139 20.61149448446079 28.97295119125573 26.837253815544248 23.578300508739233 140-144 20.78403850010026 28.198315620613595 27.280930419089632 23.73671546019651 145-149 20.965 28.275 27.26 23.5 150-151 21.425 27.35 28.000000000000004 23.225 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 3.0 23 2.0 24 2.0 25 6.5 26 8.5 27 8.0 28 9.0 29 19.0 30 25.0 31 25.5 32 36.5 33 52.0 34 64.5 35 80.0 36 97.5 37 103.0 38 122.5 39 162.0 40 192.5 41 211.5 42 234.5 43 254.0 44 259.5 45 266.5 46 265.0 47 251.0 48 242.5 49 212.0 50 164.0 51 130.5 52 114.5 53 93.0 54 67.5 55 53.0 56 41.0 57 32.0 58 20.5 59 14.0 60 11.0 61 10.0 62 7.5 63 5.0 64 4.0 65 1.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.06999999999999999 40-44 0.075 45-49 0.075 50-54 0.075 55-59 0.17500000000000002 60-64 0.2 65-69 0.185 70-74 0.20500000000000002 75-79 0.21 80-84 0.19499999999999998 85-89 0.185 90-94 0.19499999999999998 95-99 0.18 100-104 0.16999999999999998 105-109 0.24 110-114 0.19 115-119 0.2 120-124 0.0 125-129 0.05 130-134 0.53 135-139 0.735 140-144 0.26 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.7125 0.0 0.0 0.0 0.0 128-129 4.1375 0.0 0.0 0.0 0.0 130-131 4.6375 0.0 0.0 0.0 0.0 132-133 4.975 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.625 0.0 0.0 0.0 0.0 138-139 6.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATAC 10 0.006832588 144.9875 3 TTGATTT 10 0.006832588 144.9875 9 TAGGTGG 10 0.006832588 144.9875 9 >>END_MODULE SRR7172495 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172495_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8575 33.0 33.0 34.0 32.0 34.0 2 32.866 34.0 33.0 34.0 32.0 34.0 3 32.94575 34.0 33.0 34.0 32.0 34.0 4 32.88925 34.0 33.0 34.0 32.0 34.0 5 32.95225 34.0 33.0 34.0 32.0 34.0 6 37.1415 38.0 38.0 38.0 37.0 38.0 7 37.16975 38.0 38.0 38.0 37.0 38.0 8 37.1535 38.0 38.0 38.0 37.0 38.0 9 37.0595 38.0 38.0 38.0 37.0 38.0 10-14 37.1842 38.0 38.0 38.0 37.0 38.0 15-19 37.176750000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.08775 38.0 38.0 38.0 37.0 38.0 25-29 37.20025 38.0 38.0 38.0 37.0 38.0 30-34 37.103899999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.0649 38.0 38.0 38.0 37.0 38.0 40-44 37.04285 38.0 38.0 38.0 37.0 38.0 45-49 37.07809999999999 38.0 38.0 38.0 37.0 38.0 50-54 36.989700000000006 38.0 38.0 38.0 36.8 38.0 55-59 36.96175 38.0 38.0 38.0 36.2 38.0 60-64 36.9834 38.0 38.0 38.0 36.4 38.0 65-69 36.85915 38.0 38.0 38.0 36.0 38.0 70-74 36.799400000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.68795 38.0 38.0 38.0 35.6 38.0 80-84 36.59185 38.0 38.0 38.0 35.2 38.0 85-89 36.44515 38.0 38.0 38.0 34.8 38.0 90-94 36.259100000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.160450000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.068400000000004 38.0 38.0 38.0 33.2 38.0 105-109 36.001250000000006 38.0 38.0 38.0 33.6 38.0 110-114 35.810249999999996 38.0 37.4 38.0 32.6 38.0 115-119 35.480900000000005 38.0 37.0 38.0 31.0 38.0 120-124 35.2812 38.0 36.6 38.0 30.0 38.0 125-129 34.94735 38.0 36.0 38.0 28.2 38.0 130-134 34.660700000000006 38.0 35.4 38.0 26.6 38.0 135-139 34.14635 38.0 34.4 38.0 23.8 38.0 140-144 33.493449999999996 38.0 33.2 38.0 20.2 38.0 145-149 32.573699999999995 38.0 33.0 38.0 11.2 38.0 150-151 28.1315 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 1.0 5 2.0 6 1.0 7 1.0 8 0.0 9 0.0 10 3.0 11 2.0 12 3.0 13 1.0 14 1.0 15 3.0 16 4.0 17 7.0 18 9.0 19 12.0 20 11.0 21 9.0 22 9.0 23 15.0 24 19.0 25 14.0 26 19.0 27 21.0 28 37.0 29 26.0 30 48.0 31 50.0 32 71.0 33 108.0 34 139.0 35 244.0 36 588.0 37 2513.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.425000000000004 20.275000000000002 12.775 29.525000000000002 2 25.41906429822367 25.01876407305479 34.475856892669505 15.086314736052039 3 20.07007007007007 26.25125125125125 33.233233233233236 20.445445445445447 4 22.62262262262262 35.73573573573574 22.7977977977978 18.843843843843842 5 23.998998998999 37.93793793793794 21.846846846846844 16.216216216216218 6 19.15 39.225 24.425 17.2 7 19.125 19.175 41.55 20.150000000000002 8 20.05 23.974999999999998 30.049999999999997 25.924999999999997 9 21.775 25.25 30.825000000000003 22.15 10-14 23.21 28.7 26.63 21.46 15-19 22.564999999999998 28.485 27.534999999999997 21.415 20-24 22.81 28.01 28.310000000000002 20.87 25-29 22.830000000000002 28.535 27.950000000000003 20.685000000000002 30-34 22.68 28.065 28.01 21.245 35-39 22.82 27.67 28.655 20.855 40-44 22.825 27.634999999999998 28.37 21.17 45-49 22.34 27.284999999999997 29.099999999999998 21.275 50-54 22.35 27.834999999999997 28.444999999999997 21.37 55-59 22.96 28.23 27.655 21.154999999999998 60-64 22.725 28.15 28.165000000000003 20.96 65-69 23.445 28.060000000000002 27.83 20.665 70-74 22.935 27.67 28.23 21.165 75-79 23.165 27.68 28.03 21.125 80-84 23.27 27.800000000000004 28.294999999999998 20.635 85-89 24.11 27.950000000000003 27.875 20.064999999999998 90-94 24.09620481024051 27.86639331966598 27.51137556877844 20.526026301315063 95-99 23.29 28.615000000000002 27.515 20.580000000000002 100-104 23.005 27.76 28.17 21.065 105-109 23.24 27.93 28.005000000000003 20.825 110-114 23.205000000000002 28.035 28.139999999999997 20.62 115-119 24.055 28.505000000000003 27.689999999999998 19.75 120-124 23.575 28.410000000000004 27.055 20.96 125-129 24.5 28.21 27.38 19.91 130-134 24.008204512481864 28.385612086647654 27.945369953474408 19.660813447396066 135-139 24.187653331998195 28.03785109898363 27.982776748610622 19.79171882040755 140-144 24.285 28.16 27.48 20.075000000000003 145-149 24.135 28.28 27.62 19.965 150-151 24.75 28.000000000000004 27.474999999999998 19.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 1.0 20 1.5 21 2.5 22 2.5 23 2.0 24 3.0 25 4.5 26 6.5 27 9.0 28 11.5 29 12.0 30 15.0 31 21.5 32 30.5 33 41.0 34 53.5 35 71.5 36 93.0 37 116.5 38 135.5 39 161.0 40 203.0 41 236.5 42 255.0 43 250.5 44 255.5 45 279.5 46 253.0 47 235.5 48 224.5 49 188.0 50 178.5 51 138.5 52 95.0 53 92.5 54 88.0 55 66.5 56 40.5 57 36.0 58 29.0 59 18.5 60 13.5 61 6.0 62 5.0 63 5.5 64 2.5 65 2.0 66 2.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.1 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.055 135-139 0.135 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4275653923541248 0.8500000000000001 3 0.05030181086519115 0.15 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.0375 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.0875 0.0 0.0 0.0 0.0 130-131 4.5875 0.0 0.0 0.0 0.0 132-133 4.9375 0.0 0.0 0.0 0.0 134-135 5.300000000000001 0.0 0.0 0.0 0.0 136-137 5.675000000000001 0.0 0.0 0.0 0.0 138-139 6.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCCTA 10 0.006830828 145.0 4 >>END_MODULE Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra Read 634200 spots for SRR7172495.sra Written 634200 spots for SRR7172495.sra Read 634192 spots for SRR7172495.sra Written 634192 spots for SRR7172495.sra SRR ids: ['SRR7172495.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1iw4bu9c SRR7172495.sra spots: 12683848 blocks: [[1, 634192], [634193, 1268384], [1268385, 1902576], [1902577, 2536768], [2536769, 3170960], [3170961, 3805152], [3805153, 4439344], [4439345, 5073536], [5073537, 5707728], [5707729, 6341920], [6341921, 6976112], [6976113, 7610304], [7610305, 8244496], [8244497, 8878688], [8878689, 9512880], [9512881, 10147072], [10147073, 10781264], [10781265, 11415456], [11415457, 12049648], [12049649, 12683848]] SRR7172495 file size 4276439 SRR7172495 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172495 SRR7172495_1.fastq SRR7172495_2.fastq Input file: SRR7172495_1.fastq Paired file: SRR7172495_2.fastq trimmed: SRR7172495-trimmed-pair1.fastq, SRR7172495-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:33:56 2025 >> started Mon Feb 10 12:34:09 2025 >> done (13.268s) 12683848 read pairs processed; of these: 12319 ( 0.10%) short read pairs filtered out after trimming by size control 49408 ( 0.39%) empty read pairs filtered out after trimming by size control 12622121 (99.51%) read pairs available; of these: 6228296 (49.34%) trimmed read pairs available after processing 6393825 (50.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 1 0.00% 21 8 0.00% 22 7 0.00% 23 6 0.00% 24 6 0.00% 25 2 0.00% 26 4 0.00% 27 11 0.00% 28 2 0.00% 29 7 0.00% 30 9 0.00% 31 7 0.00% 32 6 0.00% 33 4 0.00% 34 10 0.00% 35 14 0.00% 36 11 0.00% 37 6 0.00% 38 11 0.00% 39 10 0.00% 40 16 0.00% 41 13 0.00% 42 25 0.00% 43 21 0.00% 44 22 0.00% 45 24 0.00% 46 27 0.00% 47 33 0.00% 48 43 0.00% 49 38 0.00% 50 48 0.00% 51 55 0.00% 52 50 0.00% 53 71 0.00% 54 55 0.00% 55 89 0.00% 56 91 0.00% 57 119 0.00% 58 128 0.00% 59 135 0.00% 60 143 0.00% 61 155 0.00% 62 226 0.00% 63 241 0.00% 64 245 0.00% 65 279 0.00% 66 305 0.00% 67 344 0.00% 68 401 0.00% 69 447 0.00% 70 555 0.00% 71 576 0.00% 72 653 0.01% 73 740 0.01% 74 824 0.01% 75 883 0.01% 76 990 0.01% 77 1168 0.01% 78 1299 0.01% 79 1453 0.01% 80 1596 0.01% 81 1831 0.01% 82 2035 0.02% 83 2367 0.02% 84 3094 0.02% 85 3546 0.03% 86 3972 0.03% 87 4012 0.03% 88 4474 0.04% 89 4779 0.04% 90 5165 0.04% 91 5557 0.04% 92 6601 0.05% 93 6650 0.05% 94 6983 0.06% 95 7618 0.06% 96 7546 0.06% 97 8295 0.07% 98 8558 0.07% 99 8835 0.07% 100 9473 0.08% 101 10341 0.08% 102 11086 0.09% 103 11519 0.09% 104 11907 0.09% 105 12311 0.10% 106 13203 0.10% 107 13640 0.11% 108 14242 0.11% 109 14967 0.12% 110 15713 0.12% 111 16136 0.13% 112 17438 0.14% 113 18114 0.14% 114 19159 0.15% 115 20575 0.16% 116 21190 0.17% 117 22239 0.18% 118 22786 0.18% 119 23843 0.19% 120 24759 0.20% 121 25689 0.20% 122 26788 0.21% 123 28166 0.22% 124 29476 0.23% 125 30825 0.24% 126 32599 0.26% 127 33867 0.27% 128 35461 0.28% 129 36624 0.29% 130 38344 0.30% 131 39964 0.32% 132 41965 0.33% 133 44907 0.36% 134 47110 0.37% 135 49748 0.39% 136 52911 0.42% 137 56553 0.45% 138 60712 0.48% 139 65014 0.52% 140 69985 0.55% 141 76547 0.61% 142 84388 0.67% 143 94694 0.75% 144 110857 0.88% 145 132220 1.05% 146 166605 1.32% 147 222262 1.76% 148 330651 2.62% 149 644655 5.11% 150 3057373 24.22% 151 6393825 50.66% 12622121 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=22 prefix-density=0.47 prefix-fanout=1.9 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=15.21 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=2.8 sequence=TGCTTGCTTCTAATCTTAATGGCGCCCACAATTACGCTTGTAAGGATT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=25 prefix-density=0.32 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=63.02 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.2 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCA SRR7172495 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:34:58 Started mapping on | Feb 10 12:34:58 Finished on | Feb 10 12:36:20 Mapping speed, Million of reads per hour | 554.14 Number of input reads | 12622121 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11938630 Uniquely mapped reads % | 94.58% Average mapped length | 293.88 Number of splices: Total | 11533090 Number of splices: Annotated (sjdb) | 11262383 Number of splices: GT/AG | 11309261 Number of splices: GC/AG | 178857 Number of splices: AT/AC | 6672 Number of splices: Non-canonical | 38300 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313090 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 37353 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.57% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 381606 381606 381606 N_multimapping 313090 313090 313090 N_noFeature 504436 11713340 619186 N_ambiguous 188539 925 77395 UnstrandedReadsAssigned:11245655 PositiveStrandReadsAssigned:224365 NegativeStrandReadsAssigned:11242049 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172495 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172495-trimmed-pair1.fastq SRR7172495-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,622,121 reads, 11,199,225 reads pseudoaligned [quant] estimated average fragment length: 251.832 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR7172495.ke.tsv 34699 SRR7172495.se.tsv 87100 total ==> SRR7172495.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.17 456 20.9359 Potri.005G024800.1.v4.1 1035 784.168 122 12.6228 Potri.004G059700.1.v4.1 961 710.255 9 1.02809 Potri.007G009000.2.v4.1 1416 1165.17 0 0 Potri.003G141000.2.v4.1 2943 2692.17 743 22.3919 Potri.016G087400.1.v4.1 270 79.6399 692 704.985 Potri.015G069301.1.v4.1 564 321.711 0 0 Potri.010G195200.1.v4.1 1773 1522.17 25 1.33254 Potri.012G127500.1.v4.1 977 726.23 128 14.3001 ==> SRR7172495.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 555 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 232 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 30 SRR7172495 completed mapping pipeline successfully