Starting /dee2/code/volunteer_pipeline.sh SRR7172496 current disk space = 3058618544128 free memory = 1452653640 SRR7172496 SRAfilesize e9cd98fc5531ab61b24f472886fa9b5b SRR7172496.sra SRR7172496.sra file validated SRR7172496 is paired end SRR7172496 is conventional basespace SRR7172496 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172496_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.333 34.0 33.0 34.0 32.0 34.0 2 33.33425 34.0 33.0 34.0 33.0 34.0 3 33.34325 34.0 34.0 34.0 32.0 34.0 4 33.47075 34.0 34.0 34.0 33.0 34.0 5 33.47975 34.0 34.0 34.0 33.0 34.0 6 37.1915 38.0 38.0 38.0 36.0 38.0 7 37.38575 38.0 38.0 38.0 37.0 38.0 8 37.4855 38.0 38.0 38.0 37.0 38.0 9 37.515 38.0 38.0 38.0 37.0 38.0 10-14 37.4852 38.0 38.0 38.0 37.8 38.0 15-19 37.50195 38.0 38.0 38.0 37.8 38.0 20-24 37.48304999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.465999999999994 38.0 38.0 38.0 37.6 38.0 30-34 37.45545 38.0 38.0 38.0 37.8 38.0 35-39 37.33855 38.0 38.0 38.0 37.2 38.0 40-44 37.120799999999996 38.0 38.0 38.0 36.4 38.0 45-49 37.04834999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.91415 38.0 38.0 38.0 36.0 38.0 55-59 36.935950000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.879549999999995 38.0 38.0 38.0 35.8 38.0 65-69 36.79885 38.0 38.0 38.0 35.0 38.0 70-74 36.7024 38.0 38.0 38.0 35.0 38.0 75-79 36.506150000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.386849999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.35465000000001 38.0 38.0 38.0 34.0 38.0 90-94 36.1625 38.0 37.4 38.0 33.2 38.0 95-99 36.00675 38.0 37.0 38.0 32.2 38.0 100-104 35.64775 38.0 37.0 38.0 30.8 38.0 105-109 35.53144999999999 38.0 36.4 38.0 30.6 38.0 110-114 35.340599999999995 38.0 36.0 38.0 29.4 38.0 115-119 35.037800000000004 38.0 35.6 38.0 28.6 38.0 120-124 34.7207 38.0 35.0 38.0 27.0 38.0 125-129 34.42575 38.0 35.0 38.0 25.4 38.0 130-134 33.883449999999996 38.0 34.2 38.0 22.2 38.0 135-139 33.48665 38.0 34.0 38.0 19.0 38.0 140-144 32.6906 38.0 32.8 38.0 14.0 38.0 145-149 31.862300000000005 38.0 31.6 38.0 10.8 38.0 150-151 26.5015 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 1.0 8 1.0 9 4.0 10 0.0 11 3.0 12 0.0 13 1.0 14 2.0 15 0.0 16 0.0 17 3.0 18 4.0 19 4.0 20 6.0 21 5.0 22 11.0 23 9.0 24 10.0 25 20.0 26 35.0 27 29.0 28 44.0 29 41.0 30 50.0 31 71.0 32 92.0 33 127.0 34 213.0 35 391.0 36 877.0 37 1944.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.76522415133454 14.770665975641359 9.277014770665975 42.18709510235812 2 20.375 20.0 36.65 22.975 3 19.05 23.9 26.35 30.7 4 23.125 32.225 22.975 21.675 5 21.975 35.775 24.275 17.974999999999998 6 17.05 35.775 25.85 21.325 7 13.275 22.8 45.324999999999996 18.6 8 18.475 22.6 32.175 26.75 9 17.8 23.275000000000002 32.550000000000004 26.375 10-14 19.814999999999998 29.505 27.025 23.655 15-19 19.35 28.749999999999996 28.335 23.565 20-24 20.205000000000002 29.110000000000003 27.134999999999998 23.549999999999997 25-29 19.64 28.860000000000003 27.755000000000003 23.745 30-34 19.580000000000002 28.67 27.815 23.935000000000002 35-39 19.573701591113778 28.72510757530271 28.064645251676172 23.636545581907335 40-44 19.755682387103235 29.00270351456894 28.051466906979073 23.190147191348753 45-49 20.075093867334168 28.9261576971214 27.399249061326657 23.59949937421777 50-54 19.587525654502677 28.332582469840318 28.07228312559443 24.007608750062573 55-59 19.86778184003606 28.852606801222013 28.06130114689237 23.218310211849552 60-64 19.808674747070018 28.313132324952416 28.122808774917356 23.755384153060202 65-69 20.07412601422418 28.513472903936695 28.463387759190624 22.949013322648504 70-74 20.150262960180314 28.81041823190584 27.973954420235415 23.065364387678436 75-79 20.070122714750813 28.244427748559982 27.67843726521412 24.00701227147508 80-84 19.694465314300025 28.81041823190584 27.838717756073127 23.656398697721013 85-89 20.057091346153847 28.685897435897434 27.799479166666668 23.45753205128205 90-94 19.58427247683446 28.419734535437012 28.18432256448785 23.81167042324067 95-99 20.138228076325937 27.79085491060249 28.101367255972352 23.969549757099216 100-104 20.82186295610391 27.939336303118274 27.909304770008507 23.329495970769308 105-109 20.022040775434554 28.25226669338276 27.85653458898963 23.869157942193056 110-114 20.14622665130953 28.49917371926486 28.148630377084483 23.20596925234113 115-119 20.66599899849775 28.44266399599399 27.531296945418127 23.360040060090135 120-124 20.025000000000002 28.16 28.025 23.79 125-129 20.974999999999998 28.355000000000004 27.33 23.34 130-134 20.630000000000003 28.21 27.67 23.49 135-139 21.005 27.939999999999998 27.665 23.39 140-144 20.29 28.144999999999996 27.765 23.799999999999997 145-149 20.185 27.905 27.765 24.145 150-151 20.65 28.962500000000002 26.9125 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.5 17 1.0 18 0.5 19 2.5 20 2.5 21 0.5 22 0.5 23 3.0 24 5.5 25 6.0 26 8.0 27 9.0 28 11.0 29 17.0 30 22.0 31 31.0 32 43.0 33 54.5 34 68.5 35 82.5 36 94.0 37 111.0 38 147.5 39 172.0 40 189.0 41 209.0 42 242.0 43 262.5 44 254.5 45 271.0 46 270.0 47 240.5 48 223.5 49 190.5 50 155.0 51 139.5 52 106.5 53 75.5 54 65.5 55 57.0 56 41.0 57 30.5 58 27.5 59 19.5 60 10.0 61 5.0 62 4.5 63 5.0 64 3.5 65 1.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.06999999999999999 40-44 0.13 45-49 0.125 50-54 0.11499999999999999 55-59 0.165 60-64 0.16999999999999998 65-69 0.16999999999999998 70-74 0.17500000000000002 75-79 0.17500000000000002 80-84 0.17500000000000002 85-89 0.16 90-94 0.17500000000000002 95-99 0.165 100-104 0.105 105-109 0.185 110-114 0.155 115-119 0.15 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.8624999999999998 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.35 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 3.9875 0.0 0.0 0.0 0.0 130-131 4.237500000000001 0.0 0.0 0.0 0.0 132-133 4.5 0.0 0.0 0.0 0.0 134-135 4.925000000000001 0.0 0.0 0.0 0.0 136-137 5.4 0.0 0.0 0.0 0.0 138-139 5.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172496 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172496_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7125 33.0 33.0 34.0 32.0 34.0 2 32.84625 34.0 33.0 34.0 32.0 34.0 3 32.84675 34.0 33.0 34.0 32.0 34.0 4 32.756 34.0 33.0 34.0 32.0 34.0 5 32.757 34.0 33.0 34.0 32.0 34.0 6 36.88275 38.0 38.0 38.0 36.0 38.0 7 36.998 38.0 38.0 38.0 37.0 38.0 8 36.877 38.0 38.0 38.0 36.0 38.0 9 37.03025 38.0 38.0 38.0 37.0 38.0 10-14 36.8842 38.0 38.0 38.0 36.2 38.0 15-19 36.8837 38.0 38.0 38.0 36.2 38.0 20-24 36.937799999999996 38.0 38.0 38.0 36.6 38.0 25-29 36.867149999999995 38.0 38.0 38.0 36.4 38.0 30-34 36.8651 38.0 38.0 38.0 36.4 38.0 35-39 36.7296 38.0 38.0 38.0 36.0 38.0 40-44 36.77265 38.0 38.0 38.0 36.0 38.0 45-49 36.76845 38.0 38.0 38.0 36.0 38.0 50-54 36.677949999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.5786 38.0 38.0 38.0 35.4 38.0 60-64 36.5299 38.0 38.0 38.0 35.4 38.0 65-69 36.388349999999996 38.0 38.0 38.0 34.6 38.0 70-74 36.37865000000001 38.0 38.0 38.0 34.6 38.0 75-79 36.36875 38.0 38.0 38.0 34.6 38.0 80-84 36.29135 38.0 38.0 38.0 34.2 38.0 85-89 36.15455 38.0 38.0 38.0 34.0 38.0 90-94 35.98 38.0 38.0 38.0 33.2 38.0 95-99 35.82170000000001 38.0 38.0 38.0 33.0 38.0 100-104 35.716449999999995 38.0 37.6 38.0 32.2 38.0 105-109 35.422250000000005 38.0 37.0 38.0 31.0 38.0 110-114 35.19255 38.0 37.0 38.0 28.6 38.0 115-119 34.9014 38.0 36.2 38.0 27.8 38.0 120-124 34.772400000000005 38.0 36.2 38.0 27.4 38.0 125-129 34.344100000000005 38.0 35.6 38.0 24.2 38.0 130-134 33.6974 38.0 35.0 38.0 20.2 38.0 135-139 33.09205 38.0 33.0 38.0 14.6 38.0 140-144 32.460699999999996 38.0 33.0 38.0 13.0 38.0 145-149 31.42425 38.0 32.2 38.0 6.2 38.0 150-151 26.402124999999998 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 3.0 4 5.0 5 3.0 6 2.0 7 2.0 8 3.0 9 2.0 10 0.0 11 5.0 12 3.0 13 7.0 14 3.0 15 2.0 16 6.0 17 5.0 18 6.0 19 3.0 20 16.0 21 17.0 22 15.0 23 23.0 24 26.0 25 24.0 26 28.0 27 33.0 28 44.0 29 34.0 30 50.0 31 55.0 32 87.0 33 101.0 34 172.0 35 265.0 36 607.0 37 2329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.475 20.95 12.6 29.975 2 24.975 25.95 34.300000000000004 14.774999999999999 3 19.35 28.95 31.424999999999997 20.275000000000002 4 23.367525644233176 35.20140105078809 24.39329497122842 17.03777833375031 5 23.575 37.5 22.225 16.7 6 18.975 37.824999999999996 24.825 18.375 7 18.525 17.825 43.375 20.275000000000002 8 20.349999999999998 25.45 28.050000000000004 26.150000000000002 9 21.45 25.025 30.425 23.1 10-14 23.075000000000003 28.16 27.02 21.745 15-19 22.24 28.59 28.51 20.66 20-24 22.439999999999998 28.83 28.035 20.695 25-29 22.395 28.945 27.845 20.815 30-34 22.215 28.38 28.465 20.94 35-39 23.365 28.24 27.79 20.605 40-44 22.314999999999998 28.799999999999997 27.939999999999998 20.945 45-49 22.82 27.73 28.549999999999997 20.9 50-54 22.725 28.875 27.810000000000002 20.59 55-59 22.53 28.025 27.905 21.54 60-64 22.955000000000002 27.765 28.110000000000003 21.17 65-69 23.150000000000002 27.66 28.15 21.04 70-74 23.055 28.044999999999998 27.825 21.075 75-79 23.03 28.08 27.815 21.075 80-84 23.275000000000002 28.64 27.16 20.925 85-89 23.25 27.985 27.85 20.915 90-94 22.805 28.485 28.025 20.685000000000002 95-99 23.385 27.655 28.610000000000003 20.349999999999998 100-104 23.28 28.125 28.439999999999998 20.155 105-109 23.305 27.46 28.685 20.549999999999997 110-114 23.54 28.470000000000002 27.994999999999997 19.994999999999997 115-119 23.189999999999998 28.42 27.725 20.665 120-124 23.515 28.59 27.76 20.135 125-129 24.495 27.99 27.455000000000002 20.06 130-134 23.455000000000002 28.235 28.194999999999997 20.115 135-139 24.4 28.28 27.639999999999997 19.68 140-144 24.495 27.61 28.075 19.82 145-149 24.665 28.139999999999997 27.54 19.655 150-151 24.887500000000003 28.95 27.187499999999996 18.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 2.0 23 3.0 24 4.0 25 7.5 26 12.0 27 15.0 28 17.5 29 16.5 30 16.0 31 27.0 32 36.0 33 41.5 34 56.5 35 75.5 36 93.5 37 108.5 38 139.0 39 172.0 40 207.0 41 246.5 42 251.5 43 245.5 44 271.5 45 273.0 46 239.0 47 223.5 48 207.5 49 193.0 50 165.5 51 124.5 52 103.0 53 92.0 54 76.0 55 63.5 56 47.0 57 30.0 58 23.0 59 19.5 60 15.0 61 9.0 62 10.0 63 8.0 64 2.5 65 2.0 66 2.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44598337950139 98.725 2 0.4281037522034752 0.8500000000000001 3 0.1007302946361118 0.3 4 0.0 0.0 5 0.02518257365902795 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.5499999999999998 0.0 0.0 0.0 0.0 114-115 1.8875000000000002 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 3.0375 0.0 0.0 0.0 0.0 124-125 3.4000000000000004 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.324999999999999 0.0 0.0 0.0 0.0 132-133 4.574999999999999 0.0 0.0 0.0 0.0 134-135 5.025 0.0 0.0 0.0 0.0 136-137 5.5375 0.0 0.0 0.0 0.0 138-139 6.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTACA 10 0.006830828 145.0 7 >>END_MODULE Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830162 spots for SRR7172496.sra Written 830162 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra Read 830147 spots for SRR7172496.sra Written 830147 spots for SRR7172496.sra SRR ids: ['SRR7172496.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ktg2hou6 SRR7172496.sra spots: 16602955 blocks: [[1, 830147], [830148, 1660294], [1660295, 2490441], [2490442, 3320588], [3320589, 4150735], [4150736, 4980882], [4980883, 5811029], [5811030, 6641176], [6641177, 7471323], [7471324, 8301470], [8301471, 9131617], [9131618, 9961764], [9961765, 10791911], [10791912, 11622058], [11622059, 12452205], [12452206, 13282352], [13282353, 14112499], [14112500, 14942646], [14942647, 15772793], [15772794, 16602955]] SRR7172496 file size 5604496 SRR7172496 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172496 SRR7172496_1.fastq SRR7172496_2.fastq Input file: SRR7172496_1.fastq Paired file: SRR7172496_2.fastq trimmed: SRR7172496-trimmed-pair1.fastq, SRR7172496-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:41:58 2025 >> started Mon Feb 10 12:42:16 2025 >> done (18.792s) 16602955 read pairs processed; of these: 25275 ( 0.15%) short read pairs filtered out after trimming by size control 82622 ( 0.50%) empty read pairs filtered out after trimming by size control 16495058 (99.35%) read pairs available; of these: 8504224 (51.56%) trimmed read pairs available after processing 7990834 (48.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 5 0.00% 21 6 0.00% 22 6 0.00% 23 5 0.00% 24 7 0.00% 25 7 0.00% 26 10 0.00% 27 12 0.00% 28 10 0.00% 29 5 0.00% 30 19 0.00% 31 13 0.00% 32 12 0.00% 33 10 0.00% 34 19 0.00% 35 21 0.00% 36 17 0.00% 37 22 0.00% 38 27 0.00% 39 33 0.00% 40 24 0.00% 41 33 0.00% 42 26 0.00% 43 32 0.00% 44 53 0.00% 45 56 0.00% 46 65 0.00% 47 60 0.00% 48 72 0.00% 49 89 0.00% 50 101 0.00% 51 123 0.00% 52 121 0.00% 53 101 0.00% 54 133 0.00% 55 131 0.00% 56 178 0.00% 57 161 0.00% 58 233 0.00% 59 258 0.00% 60 287 0.00% 61 339 0.00% 62 400 0.00% 63 439 0.00% 64 482 0.00% 65 546 0.00% 66 578 0.00% 67 675 0.00% 68 773 0.00% 69 898 0.01% 70 975 0.01% 71 1001 0.01% 72 1218 0.01% 73 1464 0.01% 74 1537 0.01% 75 1740 0.01% 76 1932 0.01% 77 2167 0.01% 78 2354 0.01% 79 2758 0.02% 80 3133 0.02% 81 3453 0.02% 82 3864 0.02% 83 4413 0.03% 84 5682 0.03% 85 6525 0.04% 86 6957 0.04% 87 7424 0.05% 88 7855 0.05% 89 8226 0.05% 90 8912 0.05% 91 9670 0.06% 92 10412 0.06% 93 11442 0.07% 94 12013 0.07% 95 12607 0.08% 96 13008 0.08% 97 13879 0.08% 98 14213 0.09% 99 14700 0.09% 100 15924 0.10% 101 17097 0.10% 102 18035 0.11% 103 18885 0.11% 104 19845 0.12% 105 20861 0.13% 106 21851 0.13% 107 22492 0.14% 108 23131 0.14% 109 23980 0.15% 110 25087 0.15% 111 25789 0.16% 112 27075 0.16% 113 28718 0.17% 114 30186 0.18% 115 31694 0.19% 116 33010 0.20% 117 34002 0.21% 118 34982 0.21% 119 35782 0.22% 120 37299 0.23% 121 38697 0.23% 122 40202 0.24% 123 42327 0.26% 124 44045 0.27% 125 46311 0.28% 126 48163 0.29% 127 49761 0.30% 128 51512 0.31% 129 53156 0.32% 130 55433 0.34% 131 57465 0.35% 132 60526 0.37% 133 63878 0.39% 134 67116 0.41% 135 70554 0.43% 136 74675 0.45% 137 79875 0.48% 138 85703 0.52% 139 91354 0.55% 140 97486 0.59% 141 106487 0.65% 142 117763 0.71% 143 132353 0.80% 144 154738 0.94% 145 186159 1.13% 146 228804 1.39% 147 310318 1.88% 148 460260 2.79% 149 889554 5.39% 150 3950546 23.95% 151 7990834 48.44% 16495058 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=23 prefix-density=0.36 prefix-fanout=2.4 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=386.62 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=18.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=17 prefix-density=0.64 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=151.51 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.1 sequence=AAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7172496 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:43:18 Started mapping on | Feb 10 12:43:18 Finished on | Feb 10 12:45:04 Mapping speed, Million of reads per hour | 560.21 Number of input reads | 16495058 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 14101157 Uniquely mapped reads % | 85.49% Average mapped length | 285.55 Number of splices: Total | 13307282 Number of splices: Annotated (sjdb) | 12964959 Number of splices: GT/AG | 13055778 Number of splices: GC/AG | 194937 Number of splices: AT/AC | 8326 Number of splices: Non-canonical | 48241 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 447822 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 143618 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.74% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1970806 1970806 1970806 N_multimapping 447822 447822 447822 N_noFeature 679861 13865764 782462 N_ambiguous 311757 2285 177218 UnstrandedReadsAssigned:13109539 PositiveStrandReadsAssigned:233108 NegativeStrandReadsAssigned:13141477 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172496 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172496-trimmed-pair1.fastq SRR7172496-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,495,058 reads, 14,380,224 reads pseudoaligned [quant] estimated average fragment length: 240.983 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR7172496.ke.tsv 34699 SRR7172496.se.tsv 87100 total ==> SRR7172496.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.02 1140 43.3989 Potri.005G024800.1.v4.1 1035 795.017 186 15.836 Potri.004G059700.1.v4.1 961 721.127 3 0.281591 Potri.007G009000.2.v4.1 1416 1176.02 2 0.115114 Potri.003G141000.2.v4.1 2943 2703.02 699.062 17.5056 Potri.016G087400.1.v4.1 270 87.7696 932 718.756 Potri.015G069301.1.v4.1 564 332.37 0 0 Potri.010G195200.1.v4.1 1773 1533.02 181 7.99174 Potri.012G127500.1.v4.1 977 737.07 228 20.938 ==> SRR7172496.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 807 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 35 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR7172496 completed mapping pipeline successfully