Starting /dee2/code/volunteer_pipeline.sh SRR7172497 current disk space = 3058780606464 free memory = 1386683796 SRR7172497 SRAfilesize ed9a88522465ce140578fffbb510ad92 SRR7172497.sra SRR7172497.sra file validated SRR7172497 is paired end SRR7172497 is conventional basespace SRR7172497 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172497_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.431 34.0 34.0 34.0 33.0 34.0 2 33.35425 34.0 34.0 34.0 33.0 34.0 3 33.4125 34.0 34.0 34.0 33.0 34.0 4 33.59575 34.0 34.0 34.0 33.0 34.0 5 33.63625 34.0 34.0 34.0 33.0 34.0 6 37.42175 38.0 38.0 38.0 37.0 38.0 7 37.63125 38.0 38.0 38.0 38.0 38.0 8 37.613 38.0 38.0 38.0 38.0 38.0 9 37.61575 38.0 38.0 38.0 38.0 38.0 10-14 37.62685 38.0 38.0 38.0 38.0 38.0 15-19 37.6486 38.0 38.0 38.0 38.0 38.0 20-24 37.620850000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.59845 38.0 38.0 38.0 38.0 38.0 30-34 37.533049999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.524249999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.28005 38.0 38.0 38.0 37.2 38.0 45-49 37.235 38.0 38.0 38.0 37.0 38.0 50-54 37.21205 38.0 38.0 38.0 37.0 38.0 55-59 37.25545 38.0 38.0 38.0 37.0 38.0 60-64 37.19109999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.06975 38.0 38.0 38.0 36.4 38.0 70-74 36.956900000000005 38.0 38.0 38.0 36.2 38.0 75-79 36.92195 38.0 38.0 38.0 36.0 38.0 80-84 36.795 38.0 38.0 38.0 36.0 38.0 85-89 36.76135 38.0 38.0 38.0 36.0 38.0 90-94 36.58365 38.0 38.0 38.0 35.0 38.0 95-99 36.5472 38.0 38.0 38.0 34.8 38.0 100-104 36.3415 38.0 38.0 38.0 34.4 38.0 105-109 36.155499999999996 38.0 38.0 38.0 34.0 38.0 110-114 35.969300000000004 38.0 38.0 38.0 33.4 38.0 115-119 35.88485000000001 38.0 37.8 38.0 33.0 38.0 120-124 35.715799999999994 38.0 37.0 38.0 32.4 38.0 125-129 35.35675 38.0 36.2 38.0 31.2 38.0 130-134 34.86035 38.0 36.0 38.0 29.0 38.0 135-139 34.3144 38.0 35.8 38.0 25.8 38.0 140-144 33.9414 38.0 33.4 38.0 23.4 38.0 145-149 33.4764 38.0 33.2 38.0 21.0 38.0 150-151 29.0895 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 2.0 7 0.0 8 0.0 9 0.0 10 3.0 11 1.0 12 1.0 13 1.0 14 4.0 15 5.0 16 6.0 17 7.0 18 6.0 19 12.0 20 4.0 21 9.0 22 10.0 23 7.0 24 8.0 25 15.0 26 18.0 27 17.0 28 21.0 29 23.0 30 31.0 31 53.0 32 58.0 33 74.0 34 115.0 35 201.0 36 559.0 37 2728.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.4012474012474 14.760914760914762 9.355509355509357 28.482328482328484 2 22.725 16.975 34.425 25.874999999999996 3 19.15 24.9 27.6 28.349999999999998 4 22.075 31.65 22.925 23.35 5 22.35 36.025 23.65 17.974999999999998 6 18.05 35.125 25.674999999999997 21.15 7 14.524999999999999 22.8 43.6 19.075 8 16.85 24.55 32.15 26.450000000000003 9 16.7 23.75 33.550000000000004 26.0 10-14 20.064999999999998 30.075000000000003 26.19 23.669999999999998 15-19 20.055 28.73 27.26 23.955000000000002 20-24 19.314999999999998 29.195 27.845 23.645 25-29 19.759999999999998 28.865000000000002 27.334999999999997 24.04 30-34 19.46 29.065 27.46 24.015 35-39 19.816981698169815 29.0979097909791 27.007700770077008 24.077407740774078 40-44 20.219098594367466 29.393226952128458 26.782051923365515 23.60562253013856 45-49 20.339152618678405 28.792956830573758 27.272272522635188 23.59561802811265 50-54 20.054037826478535 28.715100570399276 27.239067347143 23.991794255979183 55-59 19.629444166249375 28.642964446670007 27.546319479218827 24.18127190786179 60-64 19.794640621086902 28.910593538692712 27.47808665164037 23.816679188580014 65-69 20.470823941898324 28.239418983220638 27.523165539694467 23.766591535186578 70-74 20.179304818190925 29.079435039567265 26.920765301011716 23.82049484123009 75-79 20.15527172551966 28.855497119959928 27.192587027297773 23.796644127222642 80-84 20.28644398818168 28.093544994741848 27.83814913115329 23.78186188592318 85-89 20.654949677031695 28.76671173201142 27.00916328676581 23.569175304191077 90-94 20.51988380246419 28.813983772413103 26.8356205549434 23.830511870179304 95-99 20.10817849451595 28.35678870135724 27.370160765262685 24.164872038864125 100-104 20.953525641025642 28.495592948717945 26.46734775641026 24.083533653846153 105-109 21.252191334835963 27.823691460055095 27.052341597796143 23.8717756073128 110-114 21.094806430610507 28.441929183152205 26.684028647267994 23.779235738969298 115-119 21.044462247146004 28.099339074704588 26.336871620268376 24.519327057881032 120-124 21.065 28.095 26.43 24.41 125-129 20.954003407155025 28.4798075959515 26.179977953702778 24.386211043190702 130-134 21.86712370198609 27.81026313136405 25.965319084585143 24.357294082064723 135-139 21.862819539357126 28.296633763604152 25.851683118197926 23.9888635788408 140-144 21.698775837848686 27.92996187035922 26.24423038330323 24.127031908488863 145-149 21.634999999999998 27.965 25.929999999999996 24.47 150-151 22.00275034379297 28.55356919614952 25.728216027003377 23.71546443305413 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 2.0 3 1.0 4 0.5 5 2.5 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 2.0 18 2.0 19 0.5 20 1.5 21 2.5 22 3.5 23 4.0 24 3.5 25 5.5 26 7.0 27 11.0 28 17.0 29 21.0 30 28.5 31 33.5 32 53.5 33 72.0 34 78.0 35 87.5 36 90.5 37 113.5 38 134.0 39 150.0 40 178.0 41 188.5 42 204.5 43 217.5 44 214.0 45 219.0 46 219.0 47 213.5 48 203.5 49 203.0 50 185.0 51 147.0 52 116.5 53 101.5 54 97.5 55 77.0 56 66.0 57 60.5 58 46.5 59 34.0 60 24.5 61 18.5 62 13.0 63 8.0 64 4.5 65 1.0 66 0.5 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.045 45-49 0.045 50-54 0.06999999999999999 55-59 0.15 60-64 0.17500000000000002 65-69 0.17500000000000002 70-74 0.16999999999999998 75-79 0.17500000000000002 80-84 0.155 85-89 0.145 90-94 0.16999999999999998 95-99 0.165 100-104 0.16 105-109 0.17500000000000002 110-114 0.165 115-119 0.13999999999999999 120-124 0.0 125-129 0.21 130-134 0.8099999999999999 135-139 1.225 140-144 0.33999999999999997 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39490445859873 96.55 2 1.3503184713375795 2.65 3 0.2038216560509554 0.6 4 0.05095541401273885 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.575 0.0 0.0 0.0 0.0 98-99 1.9249999999999998 0.0 0.0 0.0 0.0 100-101 2.375 0.0 0.0 0.0 0.0 102-103 2.8625 0.0 0.0 0.0 0.0 104-105 3.1125 0.0 0.0 0.0 0.0 106-107 3.5374999999999996 0.0 0.0 0.0 0.0 108-109 3.8499999999999996 0.0 0.0 0.0 0.0 110-111 4.2125 0.0 0.0 0.0 0.0 112-113 4.6625 0.0 0.0 0.0 0.0 114-115 5.137499999999999 0.0 0.0 0.0 0.0 116-117 5.6125 0.0 0.0 0.0 0.0 118-119 6.175000000000001 0.0 0.0 0.0 0.0 120-121 6.550000000000001 0.0 0.0 0.0 0.0 122-123 7.075 0.0 0.0 0.0 0.0 124-125 7.5875 0.0 0.0 0.0 0.0 126-127 8.225 0.0 0.0 0.0 0.0 128-129 9.0 0.0 0.0 0.0 0.0 130-131 9.725 0.0 0.0 0.0 0.0 132-133 10.412500000000001 0.0 0.0 0.0 0.0 134-135 11.1375 0.0 0.0 0.0 0.0 136-137 11.775 0.0 0.0 0.0 0.0 138-139 12.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172497 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172497_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91525 34.0 33.0 34.0 32.0 34.0 2 32.98225 34.0 33.0 34.0 32.0 34.0 3 33.02425 34.0 33.0 34.0 32.0 34.0 4 32.894 34.0 33.0 34.0 32.0 34.0 5 32.89425 34.0 33.0 34.0 32.0 34.0 6 37.08825 38.0 38.0 38.0 37.0 38.0 7 37.02925 38.0 38.0 38.0 37.0 38.0 8 37.125 38.0 38.0 38.0 37.0 38.0 9 37.07975 38.0 38.0 38.0 37.0 38.0 10-14 37.1291 38.0 38.0 38.0 37.0 38.0 15-19 37.1195 38.0 38.0 38.0 37.0 38.0 20-24 37.06205 38.0 38.0 38.0 37.0 38.0 25-29 37.05045 38.0 38.0 38.0 37.0 38.0 30-34 36.97115 38.0 38.0 38.0 37.0 38.0 35-39 36.96715 38.0 38.0 38.0 37.0 38.0 40-44 37.0167 38.0 38.0 38.0 37.0 38.0 45-49 37.01515 38.0 38.0 38.0 37.0 38.0 50-54 37.00840000000001 38.0 38.0 38.0 37.0 38.0 55-59 36.983900000000006 38.0 38.0 38.0 37.0 38.0 60-64 36.98735 38.0 38.0 38.0 37.0 38.0 65-69 36.90515 38.0 38.0 38.0 37.0 38.0 70-74 36.8573 38.0 38.0 38.0 36.8 38.0 75-79 36.822199999999995 38.0 38.0 38.0 36.6 38.0 80-84 36.73245 38.0 38.0 38.0 36.0 38.0 85-89 36.62500000000001 38.0 38.0 38.0 35.6 38.0 90-94 36.5619 38.0 38.0 38.0 35.8 38.0 95-99 36.40475 38.0 38.0 38.0 34.8 38.0 100-104 36.40595 38.0 38.0 38.0 35.0 38.0 105-109 36.251599999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.09085 38.0 38.0 38.0 34.0 38.0 115-119 35.74115 38.0 38.0 38.0 33.0 38.0 120-124 35.6468 38.0 38.0 38.0 32.4 38.0 125-129 35.419 38.0 37.4 38.0 31.6 38.0 130-134 34.86075 38.0 36.4 38.0 28.6 38.0 135-139 34.39875 38.0 36.0 38.0 25.6 38.0 140-144 33.79325 38.0 35.0 38.0 22.6 38.0 145-149 32.6278 38.0 33.0 38.0 10.4 38.0 150-151 27.804499999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 3.0 4 5.0 5 3.0 6 0.0 7 0.0 8 2.0 9 1.0 10 0.0 11 1.0 12 2.0 13 1.0 14 4.0 15 11.0 16 2.0 17 10.0 18 6.0 19 10.0 20 6.0 21 7.0 22 11.0 23 17.0 24 13.0 25 16.0 26 10.0 27 24.0 28 27.0 29 35.0 30 45.0 31 35.0 32 56.0 33 79.0 34 119.0 35 167.0 36 446.0 37 2811.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.13423491109442 21.788129226145756 11.520160280490858 18.55747558226897 2 28.249436513899322 23.36589030803907 29.40145254194841 18.9832206361132 3 21.187077385424494 26.746806912096165 31.755572251440018 20.31054345103932 4 23.96694214876033 35.286751815677434 20.9366391184573 19.809666917104934 5 24.492862509391436 36.36363636363637 21.91334835962935 17.230152767342847 6 21.782674011016525 36.20430645968953 23.109664496745115 18.903355032548824 7 20.625782227784732 20.275344180225282 37.34668335419274 21.752190237797247 8 21.376720901126408 24.730913642052567 27.50938673341677 26.382978723404253 9 20.40560841261893 25.63845768652979 30.17025538307461 23.785678517776667 10-14 24.639423076923077 27.909655448717945 25.916466346153843 21.534455128205128 15-19 24.157275231655397 27.553218131730528 27.002253944402703 21.28725269221137 20-24 24.442774855997996 27.783621337340346 26.666666666666668 21.10693713999499 25-29 24.062484353877736 27.882641566114252 27.27682371201122 20.778050367996794 30-34 23.979974968710888 27.5694618272841 26.938673341677095 21.51188986232791 35-39 23.794502027940513 27.439787692153622 27.584998247458813 21.18071203244705 40-44 24.58178904137033 27.251327256335774 27.46168486426926 20.705198838024643 45-49 24.052091159529176 27.40796393688956 27.658402203856745 20.881542699724516 50-54 23.961933383420984 27.157525669922368 27.723516153268218 21.15702479338843 55-59 23.953325320512818 27.358774038461537 27.754407051282055 20.93349358974359 60-64 24.10115172759139 27.1707561342013 27.846770155232846 20.881321982974463 65-69 24.163661858974358 27.34875801282051 27.83453525641026 20.653044871794872 70-74 24.256384576865297 27.636454682023036 27.361041562343512 20.74611917876815 75-79 24.131022738655712 27.326454973454872 27.47170189321847 21.070820394670942 80-84 24.08473982070416 27.53042520158261 27.209896328942758 21.17493864877047 85-89 24.6656984023639 26.949466619922873 27.725747483347522 20.659087494365703 90-94 23.97695967943902 27.543200601051844 27.588279489105936 20.891560230403204 95-99 23.84052889912852 27.867374536712415 27.561855153761393 20.730241410397674 100-104 24.452792386676684 27.42299023290759 27.548209366391184 20.576008014024545 105-109 24.96494391025641 27.28866185897436 27.358774038461537 20.387620192307693 110-114 24.540491811488955 28.006210246907397 27.410226874342662 20.043071067260982 115-119 25.141483447688685 27.98116892873241 26.864326138127907 20.013021485450995 120-124 24.74335219590365 27.487605788972907 27.402473834443384 20.36656818068005 125-129 25.343014521782674 27.456184276414625 27.135703555333002 20.065097646469702 130-134 25.428227987578882 27.326454973454872 27.246318741861163 19.99899829710508 135-139 25.722442029348425 27.495367356137628 27.064656683527822 19.71753393098613 140-144 26.366140746306037 27.042324067117455 26.882043576258454 19.709491610318057 145-149 26.52642123716504 27.43801652892562 26.65664913598798 19.378913097921362 150-151 26.872026045579766 27.32281492612071 27.07237665915352 18.732782369146005 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 1.5 24 2.0 25 4.0 26 4.0 27 5.5 28 8.5 29 13.0 30 16.0 31 20.0 32 25.5 33 33.5 34 47.0 35 66.5 36 68.0 37 77.0 38 106.0 39 133.5 40 154.0 41 180.5 42 226.5 43 241.0 44 253.5 45 247.5 46 229.0 47 245.5 48 246.5 49 231.0 50 200.5 51 151.5 52 134.0 53 133.0 54 111.5 55 89.5 56 70.0 57 56.0 58 42.0 59 29.0 60 21.5 61 18.5 62 15.0 63 9.5 64 6.0 65 2.0 66 2.0 67 2.0 68 0.5 69 0.5 70 1.0 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.15 7 0.125 8 0.125 9 0.15 10-14 0.16 15-19 0.17500000000000002 20-24 0.17500000000000002 25-29 0.135 30-34 0.125 35-39 0.145 40-44 0.16999999999999998 45-49 0.17500000000000002 50-54 0.17500000000000002 55-59 0.16 60-64 0.15 65-69 0.16 70-74 0.15 75-79 0.16999999999999998 80-84 0.165 85-89 0.165 90-94 0.17500000000000002 95-99 0.16999999999999998 100-104 0.17500000000000002 105-109 0.16 110-114 0.165 115-119 0.165 120-124 0.155 125-129 0.15 130-134 0.16999999999999998 135-139 0.165 140-144 0.17500000000000002 145-149 0.17500000000000002 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4925907000511 96.375 2 1.2263668880940215 2.4 3 0.1021972406745018 0.3 4 0.07664793050587634 0.3 5 0.02554931016862545 0.125 6 0.02554931016862545 0.15 7 0.0510986203372509 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.875 0.0 0.0 0.0 0.0 100-101 2.3 0.0 0.0 0.0 0.0 102-103 2.7874999999999996 0.0 0.0 0.0 0.0 104-105 3.0375 0.0 0.0 0.0 0.0 106-107 3.4625000000000004 0.0 0.0 0.0 0.0 108-109 3.7375 0.0 0.0 0.0 0.0 110-111 4.0875 0.0 0.0 0.0 0.0 112-113 4.5875 0.0 0.0 0.0 0.0 114-115 5.05 0.0 0.0 0.0 0.0 116-117 5.525 0.0 0.0 0.0 0.0 118-119 6.0625 0.0 0.0 0.0 0.0 120-121 6.4625 0.0 0.0 0.0 0.0 122-123 7.0375 0.0 0.0 0.0 0.0 124-125 7.5875 0.0 0.0 0.0 0.0 126-127 8.275 0.0 0.0 0.0 0.0 128-129 9.0 0.0 0.0 0.0 0.0 130-131 9.662500000000001 0.0 0.0 0.0 0.0 132-133 10.325 0.0 0.0 0.0 0.0 134-135 11.0125 0.0 0.0 0.0 0.0 136-137 11.65 0.0 0.0 0.0 0.0 138-139 12.399999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTTTT 10 0.006830828 145.0 3 AACCAAC 10 0.006830828 145.0 6 TCTTCAC 10 0.006830828 145.0 145 >>END_MODULE Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846141 spots for SRR7172497.sra Written 846141 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra Read 846122 spots for SRR7172497.sra Written 846122 spots for SRR7172497.sra SRR ids: ['SRR7172497.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hne7zl86 SRR7172497.sra spots: 16922459 blocks: [[1, 846122], [846123, 1692244], [1692245, 2538366], [2538367, 3384488], [3384489, 4230610], [4230611, 5076732], [5076733, 5922854], [5922855, 6768976], [6768977, 7615098], [7615099, 8461220], [8461221, 9307342], [9307343, 10153464], [10153465, 10999586], [10999587, 11845708], [11845709, 12691830], [12691831, 13537952], [13537953, 14384074], [14384075, 15230196], [15230197, 16076318], [16076319, 16922459]] SRR7172497 file size 5712765 SRR7172497 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172497 SRR7172497_1.fastq SRR7172497_2.fastq Input file: SRR7172497_1.fastq Paired file: SRR7172497_2.fastq trimmed: SRR7172497-trimmed-pair1.fastq, SRR7172497-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:59:31 2025 >> started Mon Feb 10 12:59:48 2025 >> done (17.331s) 16922459 read pairs processed; of these: 30469 ( 0.18%) short read pairs filtered out after trimming by size control 103876 ( 0.61%) empty read pairs filtered out after trimming by size control 16788114 (99.21%) read pairs available; of these: 9450853 (56.29%) trimmed read pairs available after processing 7337261 (43.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 16 0.00% 20 20 0.00% 21 32 0.00% 22 18 0.00% 23 24 0.00% 24 29 0.00% 25 22 0.00% 26 30 0.00% 27 28 0.00% 28 38 0.00% 29 31 0.00% 30 40 0.00% 31 53 0.00% 32 42 0.00% 33 31 0.00% 34 38 0.00% 35 61 0.00% 36 60 0.00% 37 99 0.00% 38 70 0.00% 39 102 0.00% 40 84 0.00% 41 79 0.00% 42 111 0.00% 43 121 0.00% 44 146 0.00% 45 237 0.00% 46 266 0.00% 47 295 0.00% 48 250 0.00% 49 241 0.00% 50 288 0.00% 51 317 0.00% 52 362 0.00% 53 377 0.00% 54 440 0.00% 55 427 0.00% 56 477 0.00% 57 582 0.00% 58 639 0.00% 59 703 0.00% 60 852 0.01% 61 1009 0.01% 62 1129 0.01% 63 1239 0.01% 64 1386 0.01% 65 1540 0.01% 66 1609 0.01% 67 1903 0.01% 68 2190 0.01% 69 2916 0.02% 70 4755 0.03% 71 4637 0.03% 72 4316 0.03% 73 4574 0.03% 74 4785 0.03% 75 4975 0.03% 76 5427 0.03% 77 5795 0.03% 78 6426 0.04% 79 7282 0.04% 80 7938 0.05% 81 9015 0.05% 82 10169 0.06% 83 11445 0.07% 84 14034 0.08% 85 15270 0.09% 86 16153 0.10% 87 16959 0.10% 88 18042 0.11% 89 18859 0.11% 90 20180 0.12% 91 21577 0.13% 92 22572 0.13% 93 25514 0.15% 94 26589 0.16% 95 27809 0.17% 96 28480 0.17% 97 28584 0.17% 98 29107 0.17% 99 30945 0.18% 100 33100 0.20% 101 33336 0.20% 102 36135 0.22% 103 38974 0.23% 104 39920 0.24% 105 42834 0.26% 106 42169 0.25% 107 42172 0.25% 108 43779 0.26% 109 46836 0.28% 110 47361 0.28% 111 47145 0.28% 112 49339 0.29% 113 52916 0.32% 114 53228 0.32% 115 55929 0.33% 116 57087 0.34% 117 56711 0.34% 118 57197 0.34% 119 58163 0.35% 120 60251 0.36% 121 60941 0.36% 122 62552 0.37% 123 65631 0.39% 124 69055 0.41% 125 70246 0.42% 126 72132 0.43% 127 72291 0.43% 128 74027 0.44% 129 76688 0.46% 130 76825 0.46% 131 78412 0.47% 132 81247 0.48% 133 84881 0.51% 134 88465 0.53% 135 93154 0.55% 136 95447 0.57% 137 100027 0.60% 138 104382 0.62% 139 107652 0.64% 140 111489 0.66% 141 120036 0.72% 142 126602 0.75% 143 138717 0.83% 144 156907 0.93% 145 180318 1.07% 146 217131 1.29% 147 276196 1.65% 148 393691 2.35% 149 750389 4.47% 150 3975415 23.68% 151 7337261 43.71% 16788114 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=17 prefix-density=0.67 prefix-fanout=2.3 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=36.72 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=17 prefix-density=0.64 prefix-fanout=2.3 sequence=GAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=30.56 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.7 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7172497 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:00:43 Started mapping on | Feb 10 13:00:44 Finished on | Feb 10 13:04:11 Mapping speed, Million of reads per hour | 291.97 Number of input reads | 16788114 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14362510 Uniquely mapped reads % | 85.55% Average mapped length | 287.76 Number of splices: Total | 11799602 Number of splices: Annotated (sjdb) | 11554091 Number of splices: GT/AG | 11538018 Number of splices: GC/AG | 209744 Number of splices: AT/AC | 7801 Number of splices: Non-canonical | 44039 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.03% Deletion average length | 2.39 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 475967 % of reads mapped to multiple loci | 2.84% Number of reads mapped to too many loci | 205590 % of reads mapped to too many loci | 1.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.02% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1981602 1981602 1981602 N_multimapping 475967 475967 475967 N_noFeature 502512 13978857 635429 N_ambiguous 353634 1141 102321 UnstrandedReadsAssigned:13506364 PositiveStrandReadsAssigned:382512 NegativeStrandReadsAssigned:13624760 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7172497 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172497-trimmed-pair1.fastq SRR7172497-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,788,114 reads, 13,881,921 reads pseudoaligned [quant] estimated average fragment length: 216.479 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,265 rounds 52401 SRR7172497.ke.tsv 34699 SRR7172497.se.tsv 87100 total ==> SRR7172497.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.52 436 13.608 Potri.005G024800.1.v4.1 1035 819.521 290 19.9079 Potri.004G059700.1.v4.1 961 745.566 5 0.377286 Potri.007G009000.2.v4.1 1416 1200.52 0 0 Potri.003G141000.2.v4.1 2943 2727.52 829.544 17.1103 Potri.016G087400.1.v4.1 270 95.0668 567 335.538 Potri.015G069301.1.v4.1 564 353.141 0 0 Potri.010G195200.1.v4.1 1773 1557.52 142 5.1291 Potri.012G127500.1.v4.1 977 761.541 89 6.57482 ==> SRR7172497.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 649 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 471 Potri.001G212900.v4.1 294 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7172497 completed mapping pipeline successfully